Download MULTIPLE CHOICE

BioSc 231
General Genetics
Exam 4
Name __________________________________
Multiple Choice. (1 points each)
_____ When an organism gains one extra copy of a chromosome but not a complete haploid set, the conditions is known as
A. polyploidy
B. euploidy
C. aneuploidy
D. triploidy
E. trisomy
_____ It was once thought that the ____ karyotype was related to criminal disposition because it led to aggressive behavior due to
excessive "maleness".
A. XO
B. XY
C. XXY
D. XYY
E. YY
_____ Polyploid plants found in nature usually have even numbers of chromosomes because organisms having odd numbers
A. exhibit altered mitosis
B. exhibit altered growth
C. have low fertility
D. are not viable
_____ Pollen from one species germinates on the stigma of another related species and sexually fertilizes the ovule. Most of the
resulting plants are sterile but some of the resulting offspring undergo chromosome duplication resulting fertile plants. The
fertile offspring are known as
A. hexaploid
B. autopolyploid
C. monoploid
D. diploid
E. allopolyploid
_____ In a mammal 2 Barr bodies are observed. How many X chromosomes does the organism have?
A. 0
B. 1
C. 2
D. 3
E. 4
_____ When an allotetraploid (AABB) is backcrossed to one of its progenitor species (AA), a sterile progeny is produced. The
genomic composition of this sterile individual can be best represented by
A. AB
B. AABB
C. AA
D. BB
E. AAB
_____ Euploidy is
A. a chromosome number that is not an exact multiple of the haploid number
B. an example of aneuploidy
C. a chromosome number that is an exact multiple of the haploid number
D. the addition of an extra copy of a particular chromosome
E. the absence of a particular copy of a chromosome
_____ The basic diploid chromosome number in Rye Secale cereale is 14. A new species of rye is found that has 28 chromosome
species. This species is said to be
A. haploid
B. diploid
C. triploid
D. tetraploid
E. pentaploid
_____ Consider a species with a diploid (2n) number of 16 chromosomes. How many chromosomes would be found in a trisomic
body cell?
A. 8
B. 9
C. 16
D. 17
E. 24
_____ A base change resulting in a codon specifying an amino acid which is different than in the wild-type polypeptide
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ Mosaicism is due to
A. X-inactivation
B. chromosome duplication
C. chromosome deletion
D. somatic mutations
E. gametic mutations
_____ When a diploid organism undergoes one or more rounds of endoreduplication (resulting in a gain of more than one complete
haploid set of chromosomes), the resulting cells are best described as
A. polyploid
B. triploid
C. aneuploid
D. trisomic
_____ Type of mutation in which a pyrimidine is substituted for a purine
A. Transition
B. Transversion
C. Frameshift
D. Conversion
E. Inversion
_____ A type of microorganism that can exist on minimal medium
A. Conditional
B. Autotroph
C. Auxotroph
D. Prototroph
_____ A biochemical mutant that must be supplied with a particular nutrient for growth would be described as a(n)
A. Conditional
B. Lethal
C. Auxotroph
D. Prototroph
E. Autotroph
_____ A base change that changes a codon for an amino acid to a stop codon
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ A bacterial histidine mutant was plated on minimal medium and a single colony grew. You decide to sequence the histidine
biosynthetic gene of the revertant and discover that the original mutation is still present. This colony must have been able grow
due to a
A. forward mutation
B. suppressor mutation
C. auxotrophic mutation
D. back mutation
E. back mutation OR suppressor mutation
_____ A cell is exposed to EMS (a mutagen that causes guanine to mispair with thymine) and allowed to undergo a few rounds of
DNA replication. The mutational event caused by this mutagen will be
A. AT to CG
B. GC to AT
C. AT to TA
D. AT to GC
E. GC to CG
_____ A researcher studying bacterial toxin predicts that a lysine within the toxin is important for binding it’s target cell. She used
site-directed mutagenesis to change a codon for lysine (AAA) to one for asparagine (AAU). However, the mutant toxin still binds to
its target cell just as well as the wild-type toxin bound and appears to have no other changes. This type of mutation is probably
A. suppression
B. synonymous
C. nonsense
D. silent
E. frameshift
_____ Type of mutation caused by an addition or deletion of a base in a polypeptide-encoding
part of a gene
A. Transition
B. Transversion
C. Frameshift
D. Conversion
E. Inversion
_____ A new E. coli mutant was tested for auxotrophy. The mutant grows on:
minimal medium (M) + arginine (A) + proline (P)
M + P + histidine (H)
M+A+H+P
but not on M
or on M + A + H. The mutant requires
A. Arginine
B. Histidine and proline
C. Histidine
D. Arginine and proline
E. Proline
_____ Consider a species with a diploid (2n) number of 28 chromosomes. How many chromosomes would be found in a monoploid
body cell?
A. 7
B. 14
C. 15
D. 28
E. 29
_____ A base change resulting in a codon specifying the same amino acid as found in the wild-type polypeptide.
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ The fluctuation test of Luria and Delbruck (studying resistance to bacteriophge T1 infection) established that
A. T1 phage was a mutagen.
B. Mutations could arise prior to the time they were selected
C. The mutation rate varies greatly from experiment to experiment.
D. In E. coli the number of mutants per clone was relatively constant.
_____ E. coli cells were spread on an agar plate, producing 1000 colonies. The colonies are replica plated on two agar plates
containing the antibiotic kanamycin and one agar plate without antibiotics. All of the colonies are able to grow on the agar plate
without antibiotic but only 4 colonies are able to grow on each of the agar plates containing kanamycin. You notice that the four
colonies that grew on each of the kanamycin containing plates are in the exact same position. This demonstrates
A) how to screen for environmental mutagens
B) that mutations occur in prokaryotes as well as in eukaryotes
C) that in some cases mutations are caused by the selective agent itself
D) that mutations occur in the absence of the selective agent
E) a direct correlation between the amount of the selective agent used and the number of resistant mutants (one-hit relationship)
_____ An individual cell homozygous for a mutant allele of the gene for a human enzyme contains no detectable activity for that
enzyme. The mutation is best described as
A. dominant
B. codominant
C. prototrophic
D. null
_____ A mutation that causes a mutant phenotype only under restrictive conditions
A. Conditional
B. Lethal
C. Auxotroph
D. Prototroph
E. Autotroph
_____ A wild-type chromosome can be represented as ABC * DEFGH, and from this a chromosomal aberration arises that can be
represented AFED * CBGH. This is known as
(* = centromere)
A. Deletion
B. Pericentric inversion
C. Translocation
D. Paracentric inversion
E. Duplication
_____ How many different trisomics could be formed in a plant with a diploid number of 12?
A. 1
B. 6
C. 12
D. 18
E. 24
_____ Turner syndrome in humans is caused by which chromosomal conditions?
A. 47, XXY
B. 47, 21+
C. 45, X
D. 47, XYY
E. triploidy
_____ An enzyme that repairs thymine dimers in visible light in E. coli
A. resolvase
B. polymerase
C. photolyase
D. excision repair
E. DNA glycosylase
_____ Exposure to gamma radiation leads to severe damage to DNA. The bacterium Deinococcus radiodurans is able to survive
exposure to levels of gamma radiation that would kill any other known organism. This organism is able to survive because
A. it is covered with a very thick cell wall that blocks radiation
B. it produces its own mutagens that quickly revert mutations that result from radiation exposure
C. it has several very efficient DNA repair systems
D. it has hundreds of copies of its chromosome so it has a good chance of at least one surviving
_____ A hybrid allotetraploid species (2n = 60) was backcrossed to one of the suspected parents (2n = 30). When the F 1 underwent
meiosis, the prophase chromosome configuration was examined. If the guess about the suspected parent is correct, what would the
chromosome configuration look like?
A. 30 pairs
B. 30 pairs and 15 singles
C. 45 singles
D. 15 pairs and 15 singles
E. 60 singles
_____ Fragile X syndrome is caused by
A. Trinucleotide repeats
B. 5-Bromouracil
C. Free radicals
D. Depurination
E. Microdeletions
_____47,XXY is a condition known as
A. Trisomy-X syndrome
B. Klinefelter syndrome
C. Turner syndrome
D. Double-Y syndrome
E. Fragile-X syndrome
(bonus) _____ A missense mutation in Neurospora will revert by treatment with nitrous acid (causes transversions), but not by
hydroxylamine (causes AT -> GC transitions). The original mutation (not the reversion) must have been
A. AT to GC
B. AT to TA
C. AT to CG
D. GC to AT
Short Answer (variable points each)
(2 pts) Why do calico cats have patches of black and orange fur?
(Bonus) - Calico cats are almost always female. What would it take to have a calico male cat?
(2 pts) Cancer causing agents are frequently identified by their ability to cause mutations in bacteria (The Ames Test). Briefly
explain the connection between the ability to cause mutations in bacteria and the ability to cause cancer in humans.
(2 pt) Briefly explain the purpose of the mouse liver extracts used in the Ames test.
(2 pts) A set of Drosophila deletions in chromosome 2 was assembled as follows (the lines indicate the region that has been deleted)
Regions
1
a
b
c
d
e
f
2
3
4
5
6
7
_________
_______________
____________
________
___________
_____
white
white
white
red
white
red
A mutation leading to white eye color is mapped to chromosome 2. A geneticist crosses a strain with the white eye color allele to each
of the above deletion strains. The phenotype of the offspring of each cross is indicated to the right. In which region of the
chromosome is the white eye gene located?
(2 pts) What happens when monoploid plant cells are treated with colchicine?
(2 pts) Briefly explain why back mutations generated by a mutagen occur less frequently than forward mutations.
(2 pts) Why is polysomy more harmful than polyploidy?
(5 pts) Using the table below, determine the amino acid sequence of the polypeptide produced by the following messenger RNA:
ACGUAUGGCGACGUUGCGUUUUCGCUGCUGCAUGAACCGAGAUUGACGCUAAGGCAUGAAAA
(2 pts) A single base change in the above sequence results in a polypeptide that is only 7 amino acids in length. Which codon is
changed and what is the specific nucleotide change?
(2 pts) The protein produced by the above mRNA functions as a signal molecule and scientists predict that the phenylalanine (F) in
this protein is necessary for its function. What mutation(s) would you make to test this hypothesis? (Note, the typical strategy
for determining the function of a single amino acid residue in a protein is to replace that amino acid with an alanine (A) amino
acid residue)
(2 pts) Recessive alleles a, b, c, d, e, f and g are closely linked but their order is unknown. A set of 7 deletions are used to determine
the gene order as revealed by the genes exposed by each deletion. The genes exposed by each mutation are as follows:
deletion number
1
2
3
4
5
6
7
gene(s) exposed
f and a
f, a and c
a and d
d
g and e
g, e and b
e, b and c
What is the order of the genes?
(Bonus essay - 4 points). Two enrichment strategies were described in class that make it easier to find mutations in a large population
of cells. Describe one of those enrichment strategies.