Download Recombinant reflectin-based camouflage materials

Supplementary Information:
Recombinant Reflectin-based Optical Materials
Guokui Qin,1 Patrick B. Dennis,2 Yuji Zhang, 1 Xiao Hu, 1 Jason E. Bressner, 1 Zhongyuan Sun, 1
Wendy J. Crookes-Goodson, 2 Rajesh R. Naik, 2 Fiorenzo G. Omenetto, 1 David L. Kaplan 1
1
Department of Biomedical Engineering, Tufts University, 4 Colby Street, Medford, MA 02155,
USA
2
Air Force Research Laboratory, Materials and Manufacturing Directorate Biotechnology Group,
Wright-Patterson Air Force Base, Dayton, Ohio 45433, USA
Correspondence to: D. L. Kaplan (E-mail: [email protected])
FIGURE S1. The entire amino acid sequence of reflectin 1a, with five repeating domains
indicated in blue boxes (GenBank accession AY294649). The refCBA reported in this paper is
from the second repeat region of reflectin1a. Three subgroups of this subdomain refCBA are
defined: refC, the longest non-repetitive sequence found in the reflectin 1a (highlighted in
yellow area); refB, the repetitive sequence found in each subdomain of reflectin 1a (highlighted
in green area); refA, the highly conserved region between 5 subdomains of reflectin 1a
(highlighted in red area), having a consensus motif [M/FD(X)5MD(X)5MD(X)3/4]
FIGURE S2. Determination of defined subdomains of E. scolopes reflectin 1a. Each repeat was
previously divided into 2 subdomains based on a Rapid Detection and Alignment of Repeats
alignment.1 The carboxyl-terminal half (A) consists of the highly conserved core subdomain,
containing the repeating motif [M/FD(X)5MD(X)5MD(X)3/4].1 The amino-terminal portion (B) of
the repeat is less conserved among repeats, is enriched in tyrosine and asparagine residues, and
is often terminated by a YPERY motif. Most reflectins also contain a domain between repeats 1
and 2 that is enriched in dityrosines, which we have termed the ‘C’ subdomain.
Gene and Plasmid Construction
The construction of the cloning vector pET30L was performed in a same fashion as the
procedure described previously.2-4 The cloning cassette linker with cohesive ends was generated
by NcoI and XhoI (NEB, Ipswich, MA) and ligated into pET30a(+) plasmid (Novagen, San Diego,
CA) previously digested with NcoI and XhoI. The resulting cloning vector was referred to as
pET30L.5 Three amino acid modules, refC, refB and refA derived from repeating domains of
reflectin 1a in the E. scolopes squid were connected to a short peptide refCBA by site-directed
assembly of synthetic genes (Figure S3).
Oligonucleotides refCF
(CTAGCGATTACTATGGTCGTTTCAACGATTACGATCGTTATTATGGTCGCAGTATGTTCA)
(CTAGTGAACATACTGCGACCATAATAACGATCGTAATCGTTGAAACGACCATAGTAATCG),
and
refCR
refBF
(CTAGCAACTATGGCTGGATGATGGATGGCGATCGCTATAACCGCTATAACCGCTGGATGGATTATCCGG
AACGCTATA)
and
refBR
(CTAGTATAGCGTTCCGGATAATCCATCCAGCGGTTATAGCGGTTATAGCGATCGCCATCCATCATCCAGC
CATAGTTG),
refAF
(CTAGCATGGACATGAGCGGCTACCAGATGGATATGTCCGGCCGTTGGATGGATATGCAGGGCCGCA)
and
refAR
(CTAGTGCGGCCCTGCATATCCATCCAACGGCCGGACATATCCATCTGGTAGCCGCTCATGTCCATG)
were synthesized separately for refA, refB and refC modules by MWG-Biotech (High Point, NC).
Reflectin block modules sequences were constructed by annealing two synthetic nucleotides for
each module as described previously.5 Reflectin block modules containing NheI and SpeI
restriction sites were digested with these endonucleases and ligated into a pET30L vector that
was previously digested, gel purified and dephosphorylated. Ligation reactions were done using
T4 DNA ligase (Invitrogen, Carlsbad, CA) at 16°C. First, the refC block was ligated into a vector
following stepwise ligation of the refB and refA blocks to generate refCBA reflectin-like block
copolymers. The ligation product was used to transform E.coli DH5α strain (Invitrogen, Carlsbad
CA) and successful transformants were identified by plating and incubation on medium
containing 30 μg/ml kanamycin. The presence of correct inserts in each construct was identified
by colony PCR and confirmed by DNA sequencing.
FIGURE S3. Cloning strategy for constructing synthetic reflectin-like genes. A. The cloning
cassette comprised restriction sites required for module multimerization (NheI and SpeI) and for
excising assembled genes (NcoI and XhoI). During gene construction, the synthetic gene region
was replaced with modules. B. Site-directed connecting of two modules was accomplished by
ligating two appropriate plasmid fragments. C. Module multimers were connected like single
modules, resulting in controlled assembly of synthetic genes.
Expression and Purification
All expression vectors were transformed into E. coli RY-3041 strain, a mutant strain of E. coli
BLR(DE3) defective in the expression of SlyD protein.6 Authenticity of the clones was confirmed
by DNA sequencing. 5 ml of over night cultures were grown in LB medium with 30 μg/ml
kanamycin at 37oC in a rotary shaker and were used for inoculation of 1 L of LB cultures with 30
μg/ml kanamycin at a ratio of 1/100 of starter to culture volume. At O.D.600 of 0.8 to 0.9
expression was induced with 1 mM ITPG (isopropyl β-D-thiogalactoside) (Fisher Scientific,
Hampton, NH). Following 4 to 6 h from induction bacteria were harvested by centrifugation
(10,000 g for 20 min at 4°C, Sorvall, Fisher Scientific, Hampton, NH). Pellets were stored at -80oC.
Protein purification was performed under native conditions on a Ni-NTA resin (Qiagen, Valencia,
CA) using the manufacturer’s guidelines. Briefly, the cell pellets were thawed and resuspended
in lysis buffer containing 1 X BugBuster Protein Extraction Reagent (Novagen EMD Chemicals, Inc.
CA), Lysonase™ Bioprocessing Reagent (Novagen EMD Chemicals, Inc. CA), 1 X phosphatebuffered saline, and 10 mM imidazole. The cell suspension was lysed by stirring for 30 min at
room temperature. The soluble protein fraction was collected by centrifugation at 10,000 g for
25 min at 4°C. The resulting supernatant was loaded into a column with Ni-NTA resin (Qiagen,
Valencia, CA), then washed four times with wash buffer (pH 8.0), and further four times with
elution buffer (pH 8.0). The proteins were dialyzed against 20 mM sodium acetate followed by
dialysis against water using SnakeSkin Dialysis Tubing (Pierce, Rockford, IL) with MWCO of 3,500
Da. Dialyzed proteins were lyophilized using a LabConco Lyophilizer. Purity and recovery rates
were assessed by SDS-PAGE on 4-12% Bis-Tris precast gels (Invitrogen, CA). Protein identity was
confirmed by N-terminal amino acid sequencing (Tufts Core Chemistry Facility, Boston, MA).
FIGURE S4. Absorbance spectra with full-wavelength scanning for reflectin-based refCBA protein
solution of 0.5 mg/ml
FIGURE S5. Cross-sectional SEM images of reflectin-based refCBA films. Films were prepared
with a concentration of 20 mg/ml.
FIGURE S6. Normalized reflectance spectra obtained with a visible wavelength range of 400 950 nm for reflectin-based refCBA thin films with different concentrations (from top to bottom:
5%, 4%, 3%, 2%, 1%). Black line: measured reflectance spectra; Red line: simulated reflectance
spectra.
References and Notes:
1. Crookes, W. J.; Ding, L. L.; Huang, Q. L.; Kimbell, J. R.; Horwitz, J.; McFall-Ngai, M. J. Science
2004, 303, 235-238.
2. Huang, J.; Wong, C.; George, A.; Kaplan, D. L. Biomaterials 2007, 28, 2358-2367.
3. Qin, G.; Rivkin, A.; Lapidot, S.; Hu, X.; Preis, I.; Arinus, S. B.; Dgany, O.; Shoseyov, O.; Kaplan,
D. L. Biomaterials 2011, 32, 9231-9243.
4. Qin, G.; Lapidot, S.; Numata, K.; Hu, X.; Meirovitch, S.; Dekel, M.; Podoler, I.; Shoseyov, O.;
Kaplan, D. L. Biomacromolecules 2009, 10, 3227-3234.
5. Rabotyagova, O. S.; Cebe, P.; Kaplan, D. L. Biomacromolecules 2009, 10, 229-236.
6. Bini, E.; Knight, D. P.; Kaplan, D. L. J. Mol. Biol. 2004, 335, 27-40.