* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein Synthesis
Non-coding DNA wikipedia , lookup
Ribosomally synthesized and post-translationally modified peptides wikipedia , lookup
Fatty acid metabolism wikipedia , lookup
Citric acid cycle wikipedia , lookup
Polyadenylation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Fatty acid synthesis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Metalloprotein wikipedia , lookup
Gene expression wikipedia , lookup
Peptide synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Proteolysis wikipedia , lookup
Epitranscriptome wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Biochemistry wikipedia , lookup
Cell Biology and Genetics: the Central Dogma Transcription and Translation DNA directs the synthesis of proteins by indirectly specifying the exact sequence of amino acids in each protein. This is accomplished through a series of chemical coding and decoding steps. Each sequence of three nucleotides in a strand of the DNA helix is called a triplet code word. The DNA is used as a template to make complementary RNA. In this way, the sequence of nucleotides in DNA is transcribed into RNA. The complementary nucleotide triplets in the RNA are called codons. The RNA (actually messenger RNA or mRNA) then carries the message to ribosomes in the cytoplasm, where protein synthesis occurs. Meanwhile, another type of RNA, transfer RNA, picks up amino acids and transfers them to the site of protein synthesis. There are many different tRNAs, each specific for a particular amino acid. Each tRNA also contains a specific triplet of nucleotides (an anti-codon) that is complementary to the mRNA codon. For protein synthesis to occur, each anticodon pairs with the appropriate codon, which aligns a particular amino acid and gets it ready to become part of a growing protein chain. The amino acids can then be linked together in the specified order. Although proteins are three-dimensional molecules, the principle of encoding and making proteins can be illustrated on paper. 1. Your instructor will assign you a sequence of 63 nucleotides forming 21 DNA code words. Beginning at the left and proceeding to the right, transcribe (by writing the sequence on paper) the DNA code words into mRNA codons using the following key to transcription: A (adenine) in DNA transcribes to U (uracil) in mRNA G (guanine) in DNA transcribes to C (cytosine) in mRNA T (thymine) in DNA transcribes to A in mRNA C in DNA transcribes to G in mRNA As a matter of convenience, bracket each mRNA triplet (codon). For example, the DNA code word of ATT would transcribe to a mRNA codon of UAA. When all of the code words have been transcribed you have, in effect, synthesized a strand of mRNA. 2. Each codon specifies a particular amino acid, as shown in the Standard Genetic Code Table on page 3 of this handout. Using this table, determine the specific type of amino acid that is coded for by each mRNA codon. As you proceed with this translation step, you are setting up the primary structure of a polypeptide molecule. An examination of the table will reveal several features of the genetic code: a. The code is degenerate - that is, there is more than one codon for most of the amino acids. For example, serine is specified by six different codons. Only two amino acids are represented by a single codon. What are they? ______________________ b. The codon AUG not only encodes Methionine but also functions as a “start” signal for ribosomes to begin translating the mRNA at that point. Thus, AUG is also called a start codon. c. The three codons UAA, UAG, and UGA are frequently called nonsense codons because they do not specify any amino acid at all. Rather, they serve as punctuation marks: they are “stop” signals or termination codons, marking the end of translation. Amino Acids and Their Abbreviations Amino Acid alanine arginine asparagine aspartic acid cysteine glutamic acid glutamine glycine histidine isoleucine Abbreviation ala arg asn asp cys glu gln gly his ile Amino Acid leucine lysine methionine phenylalanine proline serine threonine tryptophan tyrosine valine -2- Abbreviation leu lys met phe pro ser thr trp tyr val Standard Genetic Code Table: Codons and the Amino Acids They Specify: d. Once you have determined the sequence of amino acids, get twenty labels or post-its from your instructor. These labels may need to have their edges trimmed to reduce their overall size. Your instructor will give directions for doing this if it is necessary. Number each label by placing a small numeral (1 through 20) in its lower left hand corner. Then print the abbreviation of the first amino acid on the first label and so on until you have done this for all twenty amino acids. Place the first label near the middle of the bottom of a blank page of paper. (Don't glue it or any other label until you get them all properly positioned on the page.) As you position each succeeding amino acid adjacent to the one before, obey the following rules to determine the two dimensional conformation of your protein. Position each additional amino acid to the right of its predecessor, observing the following : -3- A proline makes a left turn, i.e., place the proline label at right angles to the previous amino acid. (See Fig. 1.) PRO MET THR Reading Direction Figure 1 A serine amino acid makes a right turn, i.e., place the serine at right angles to the previous amino acid. (See Fig. 2.) SER PRO MET THR Reading Direction Figure 2 -4- 4. Note that each polypeptide configuration will fit in its entirety on an 8 1/2 x II" piece of paper. After you have worked out the arrangement of your 20 amino acid polypeptide, ask your lab instructor to check it before you stick the labels onto the paper. 5. The peptide bonds that form between the adjacent amino acids are somewhat flexible. Further stabilization of a particular protein conformation occurs by joining two parts of the chain together by a disulfide bond (-S-S-). These bonds form between cysteine amino acids. Therefore, whenever two cysteines are within two label lengths apart, indicate a disulfide bond (see Fig. 3). SER CYS PRO LEU S MET PRO S CYS LEU Reading Direction Figure 3 Can you ascertain, from your polypeptide model, if there are any regions which seem to have a very specific and unusual conformation; unusual in the sense that a particular shaped substrate molecule might fit into the area like a key into a lock? ____________________ 6. Mutations can be of several types. One type is a "reading frame mutation" in which a single nucleotide within a sequence is missing or added. This then changes all the succeeding (or “downstream”) triplets to completely -5- different code words, some of which may be "nonsense" and therefore completely prevent that protein from being synthesized. Shift the reading frame on your DNA sequence of nucleotides at any point and estimate the length of the polypeptide that can be synthesized before a break in the chain occurs, due to the lack of an appropriate codon and amino acid. Another kind of mutation which can occur is one in which one nucleotide is replaced by a different nucleotide (base substitution mutation). It is known that in some cases a single substitution can cause rather drastic changes in the biological properties of a given protein, while in other cases nucleotide substitutions can occur without apparent changes. Can you reason why this might be predicted from what you have learned during this exercise? _______________________________________________________________ Nucleotide Sequences: 1. TACCCAGGTGAATGAGGGGGAACAAGAGTAAGCACGAGTGGCGGACAAAGGATAAGTCTTACT 2. TACGGGGGGACGTCGGACTCGACAGGGGGGTGGTTTTAAGGGCATCAGGGGTCAAAAGGGATT 3. TACCTGGGTGGTAGTAGTGGTGAGGGTCCGGGTACAAGTGGTAGTAGTTGAACATATTCGATC 4. TACGGGACCGGCACGTCATCGGGTACAGGAGTTCGAGGCACGGGATCATCGGGGACGGGTACT 5. TACGCAGTGGGAGGCAGGAGTGGATTAGGGGGTAGTGTGAGAACGAGGGGAGGGACAGGTATC Questions: Answer the following questions in your laboratory notebook. 1. Both nucleic acids and protein molecules are examples of polymers. What does this mean? 2. What is the effect of a reading frame mutation. 3. What is the effect of a base substitution. -6- Circular Genetic Code Table -7-