Download Name

Name ________________________________
Lab: Nicotine Addiction
Nicotine is a substance that acts as a
stimulant in mammals and is the main factor
responsible for the dependence-forming
properties of tobacco smoking. According to
the American Heart Association, nicotine
addiction has historically been one of the
hardest addictions to break.
Scientists say that they have pinpointed a
genetic link that makes people more likely to
get hooked on nicotine, causing them to
smoke more cigarettes, making it harder to
quit, and leading more often to lung cancer.
In this lab, we will refer to this genetic link
as the fictitious lung cancer predisposition
(LCP) gene.
Is this molecule
organic or inorganic?
Pause for the Cause: Vocabulary









allele ______________________________________________________________
chromosome _________________________________________________________
DNA ______________________________________________________________
gene _______________________________________________________________
genome ____________________________________________________________
genotype ___________________________________________________________
phenotype __________________________________________________________
predisposition ________________________________________________________
trait ______________________________________________________________
Part 1: Pedigree Investigation
In this part of the lab, we will explore a pedigree chart to see how it can be applied to a realworld situation. We will use the following website to fill in the pedigree chart on the back of
this page: http://learn.genetics.utah.edu/content/addiction/genetics/pi.html
1
g-$.
Wilson Commencement Academy Rochester, NY
2
g-$.
Wilson Commencement Academy Rochester, NY
Once you’ve filled in the pedigree, answer the questions below in complete sentences on a
separate sheet of paper.
1.
2.
3.
4.
5.
6.
7.
What is a pedigree?
What is the value of pedigrees for researchers studying human disease?
What is a risk factor?
Why do researchers consider environmental risk factors when studying a trait?
What were some of the risk factors for nicotine addiction?
What clues in a pedigree would indicate that a trait can be inherited?
Why is it difficult to predict whether or not a disease like nicotine addiction will be an issue
for an individual?
8. If a pedigree shows evidence that a trait can be inherited, what might scientists do next?
Part 2: Research Review
Now read through the research article that your teacher has given you. Once you are done
reading, answer the questions below in complete sentences on a separate sheet of paper.
9. According to the research, what is determined by the environment?
10. According to the research, what is determined by genes?
Part 3: Punnett Square Predictions
In this section of the lab, you will make predictions using Punnett squares. You will then use
pennies to simulate the crosses. Finally, you will compare the actual percentages with the
predicted percentages.
The trait that you are investigating– lung cancer predisposition– is coded for by a gene that
gives someone a predisposition to nicotine addiction and, potentially, lung cancer (the LCP gene).
T represents the dominant allele (no LCP); t is the recessive allele (LCP).
11. Fill in the missing genotype names and phenotypes for the following possibilities:
Genotype
Genotype Name
Phenotype
If this person smokes…
TT
homozygous dominant
________
__________________
Tt
________________
no LCP
__________________
t t
________________
________
__________________
3
g-$.
Wilson Commencement Academy Rochester, NY
12. Use a Punnett square to predict the probability of offspring in a cross where the parents
are both Tt. This Punnett square is set up for you below.
What proportion of the offspring (out of 4)
will have:
No LCP ______
LCP ______
Note: These are your predicted ratios.
Now you will determine the actual percentages by using pennies to represent the crosses. You
have two pennies. On one side of the penny is the letter T (representing the dominant allele)
and on the other side is the letter t (representing the recessive allele). This penny represents
a parent that has the hybrid a.k.a. heterozygous genotype Tt. A second penny, labeled the
same, represents the other parent. One partner is going to play the role of the female and the
other will play the role of the male. Very romantic! When the coin is flipped, you are
determining what haploid sperm or what haploid egg is being donated to the diploid zygote
(fertilized egg cell).
13. Flip the two pennies to find the genotype of your offspring. Did you get TT, Tt, or tt? ____
14. What is the phenotype of your offspring: predisposed to lung cancer or not? ___________
15. To determine actual percentages, you will flip your coins 50 times, recording in the table
below how often each combination comes up. Use tally marks to record your data and then
summarize as a percentage.
Actual Ratios
Genotype (alleles)
Tally
Total
homozygous dominant
( TT )
hybrid a.k.a. heterozygous
( __ __ )
homozygous recessive
( __ __ )
4
g-$.
Wilson Commencement Academy Rochester, NY
Total X 2= ____%
16. Now combine the data from the previous page to calculate phenotype percentages.
Phenotype
Total %
No LCP (add TT + Tt )
LCP (tt)
Your totals above represent a percentage. Your proportions from the Punnett square in your
prediction can also represent a percentage.
1/4 = 25 %
2/4 = 50%
3/4= 75%
4/4 = 100%
17. Now compare your predicted percentages to your actual percentages in the chart below.
Predicted %s
(from the square you did)
Actual %s
(from the flips)
TT
Tt
tt
No LCP
LCP
18. When you compare the predicted values to the actual values, are they the same, close to the
same, or not at all the same? _______________________________________________
***You will now repeat the procedure for parents that are Tt and tt.***
19. First, make your predictions by setting up a Punnett square for the parents. This one is not
set up for you. Sick!
What proportion of the offspring (out of 4)
will have:
No LCP ______
LCP ______
5
g-$.
Wilson Commencement Academy Rochester, NY
***Replace one of your pennies with a tt penny.***
20. Perform the flips with your new set of parents. Record your data in the table below.
Tally
Total
Total X 2= ____%
Tt
tt
21. What percentage of your offspring are Tt? ___
What percentage do not have LCP? ___
22. What percentage of your offspring are tt? ___
What percentage do have LCP? ___
23. Compare the predicted percentages of the cross to the actual percentages.
Predicted %s
(from square)
Actual %s
(from flips)
No LCP
LCP
Again, answer the following in complete sentences on a separate sheet of paper:
24.
25.
26.
27.
Why are the predicted percents rarely the same as the actual percents?
Why are Punnett squares useful for determining phenotype chances in offspring?
What do the pennies represent in the simulation?
When you toss the coin to see which side lands up, you are actually simulating what part of
the process of sexual reproduction?
28. When you put the two coins that are flipped together, you are simulating what part of the
process of sexual reproduction?
29. Can you accurately determine a person’s genotype by observing their phenotype? Explain.
30. If you are genetically predisposed to nicotine addiction because you have the LCP gene,
what choices can you make to avoid being addicted to nicotine and, therefore, dying from
lung cancer?
6
g-$.
Wilson Commencement Academy Rochester, NY
Part 4: Mapping the LCP Gene
Now that we have some idea of how this LCP gene can be inherited, we want to locate it.
Scientists currently think that there are about 23,000 protein-coding genes in the human
genome spread out over our 46 chromosomes. Somewhere, in this human genome, is our LCP
gene. The human karyotype shows all of the chromosomes that we have in the nuclei of our body
cells. Each of our body cells has this same set of genetic information— the same genome. In the
space below, perform the following tasks:
31.
32.
33.
34.
Label the nuclear membrane.
Draw the human karyotype.
Label each chromosome pair with a number.
For the last chromosome pair– the sex chromosomes– label whether you are XX or XY.
Separate sheet:
35. What percentage of these chromosomes came from each parent?
36. What process made it possible for your parents to donate only half of their chromosomes to
you in their haploid gametes?
37. Deep thoughts: If males have XY as their sex chromosomes and females have XX, who
determines the gender of the offspring?
38. On average, how many genes are found on each chromosome?
7
g-$.
Wilson Commencement Academy Rochester, NY
Now we will zoom in on one pair of chromosomes where the LCP gene is found— pair 19. Because
this pair of chromosomes code for the same genes, they are called homologous chromosomes
(“homo” means the same). Because one of the chromosomes is inherited from the organism’s
mother and the other from the father, homologous chromosomes are rarely identical.
We have enlarged an image of chromosome pair 19 below. Your task is to consider the traits
that you and your partner have and predict what the gene map of your future offspring could
look like.
This one is
from the
dad!
This one is
from the
mom!
39. Draw the LCP gene as a line 2.8 cm up from the bottom. Give you or your partner the
dominant “T” allele with an orange line if nicotine addiction does not seem to run in the
family. Otherwise, draw a red line for the recessive “t” allele if nicotine addiction does run in
the family.
40. Draw the tongue roller gene as a line 1.7 cm up from the bottom. Give you or your partner
the dominant “R” allele with a blue line if the tongue can curl or a recessive “r” allele with a
green line if the tongue can’t roll.
41. Draw the attached earlobe gene as a line 4.2 cm up from the bottom. Give you or your
partner the dominant “A” allele with a purple line if the earlobes are attached to the head or
a recessive “a” allele with a brown line if the earlobes are swaying in the wind.
Separate sheet:
42. What is the relationship between chromosomes, genes, and the nucleus?
43. What is a gene map?
8
g-$.
Wilson Commencement Academy Rochester, NY
Part 5: Making the LCP Protein
Now that we have located the LCP gene on chromosome pair 19, we can splice that gene out of
the genome with the help of a specific restriction enzyme and look at its code. Then we can see
how this code forms an actual protein. Here’s an analogy: DNA is like a recipe, two-dimensional
words on paper. Proteins, on the other hand, are like the delicious three-dimensional macaroni
and cheese, all bubbly and fantastic as it comes out of the oven. In the same way, you are
three-dimensional, bubbly and fantastic…but without your DNA “recipe”, you wouldn’t exist. You
feel me? Anyways, let’s see what this LCP gene looks like and what kind of protein it makes.
When spliced from the genome, the LCP gene has this sequence of DNA bases:
TACAAACAGTTAGTCGTAGACACACCCTCAGTGGAT
___________________________________________
CAGGTCCGGGATATAAACCAAACGCCGCTCTCTCCCAAG
___________________________________________
AAAATGATGGGGTTTCGTCCATAACACCTTGTCACA
___________________________________________
ACAGCAAGACAAACAAGCAACATGGTTAACCTCTTA
___________________________________________
ATAACATTGATC
___________________________________________
9
g-$.
Wilson Commencement Academy Rochester, NY
44. The first step in making a 3-D LCP protein from the 2-D LCP gene “recipe” is transcription.
During transcription, DNA is transcribed, or rewritten, into mRNA. Transcribe the DNA
bases on the previous page into mRNA codons with the help of your teacher. This is very fun!
45. Now that you have the mRNA codons, you can translate them into the corresponding amino
acid using The Universal Genetic Code chart provided by your teacher. This is also very fun!
The first three letters of each amino acid should be used as an abbreviation on the next
page. As you can see, amino acids are the subunits of proteins.
Here is an easier chart for you to use after you have mastered the other one:
10
g-$.
Wilson Commencement Academy Rochester, NY
The LCP Protein
11
g-$.
Wilson Commencement Academy Rochester, NY
Use complete sentences on a separate sheet.
46. Infer where in the cell transcription takes place.
47. Use the following words to describe how proteins are made: DNA, mRNA, nucleus, protein,
ribosome, transcription, translation.
48. Proteins are very specific shapes with very specific jobs. Draw what your LCP protein looks
like and what it might look like if it was denatured by high heat or the wrong pH.
Part 6: Modeling Genetic Organization
Your teacher will now provide you with the following materials: a paper clip, some yarn, a large
plastic bag, a small plastic bag, and a popsicle stick. Using what you know about genetic
organization, model the connection between cells, nuclei, chromosomes, DNA, and genes.
49. When you are ready to explain what you came up with, call your teacher over and have
him/her initial in this box if your model and explanation are correct:
Use complete sentences on a separate sheet.
50. Use the following words to explain how genetic information is organized: cells, nuclei,
chromosomes, DNA, and genes.
Part 7: Treating the Recessive Trait
Spend some time reading the passages, provided by your teacher, that relate to genetic
engineering and the treatment of inherited disease.
Use complete sentences on a separate sheet.
51. Describe one possible way that genetic engineering could help someone who has inherited a
recessive LCP allele from both parents.
52. Describe another possible way that genetic engineering could help someone who has
inherited a recessive LCP allele from both parents.
You are done!
Take a deep breath and relax!
12
g-$.
Wilson Commencement Academy Rochester, NY
13
g-$.
Wilson Commencement Academy Rochester, NY