Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Functional genetic analysis of the Eucalyptus grandis cellulose synthase 1 (EgCesA1) gene in Arabidopsis thaliana by MARJA M. O’NEILL Submitted in partial fulfilment of the requirements for the degree Magister Scientiae In the Faculty of Natural and Agricultural Sciences Department of Genetics University of Pretoria Pretoria July 2009 Under the supervision of Prof. Alexander A. Myburg and co-supervision of Dr. Sanushka Naidoo © University of Pretoria DECLARATION I, the undersigned, hereby declare that the dissertation submitted herewith for the degree M.Sc. to the University of Pretoria, contains my own independent work and has not been submitted for any degree at any other university. Marja M. O’Neill July 2009 ii PREFACE The multi-billion dollar world-wide forest products industry utilizes wood as raw substrate. Wood is comprised of a complex network of cellulose, hemicellulose and lignin that are mostly contained in secondary cell walls, with cellulose forming the most important component for paper and pulp manufacturers. Cellulose is a cell wall polymer of chains of β1,4-linked glucose molecules that crystallize to form cellulose microfibrils in plant cell walls. Biosynthesis of cellulose in plants occurs at the plasma membrane through the action of rosette-shaped cellulose synthase (CESA) protein complexes. The rosette complexes are embedded in the plasma membrane and utilize UDP-glucose monomers in the cytoplasm to polymerize growing glucan chains in the cell wall. Each rosette is hypothesised to consist of six subunits each containing six CESA proteins. This hypothesis is mostly based on structural features of rosettes observed using freeze-fracture microscopy. CesA genes have been identified in many plant species including Arabidopsis thaliana and Eucalyptus grandis. Arabidopsis thaliana has proven to be especially useful in studying the function of CESA proteins by analysing plant development and cell wall chemistry in plants with mutated CesA genes. Although Arabidopsis does not form large quantities of secondary xylem, it has been shown to undergo secondary growth under certain conditions. Availability of the full genome sequence, ease of transformation and access to mutant plant lines, makes Arabidopsis an attractive model plant in which to study xylogenesis (wood biosynthesis). Arabidopsis has the potential to be used in elucidating the function of heterologous CesA genes from important tree species like Eucalyptus spp. Two general scientific questions were addressed in this study: (1) Is cellulose production regulated at the transcriptional level and (2) can cellulose biosynthesis be increased by over-expression of a single heterologous CESA protein? The aim of this M.Sc study was to functionally characterise the Eucalyptus CesA1 gene, involved in cellulose deposition in secondary cell walls of Eucalyptus xylem tissues, in Arabidopsis thaliana plants. iii Literature pertaining to the biosynthesis of cellulose in plants is reviewed in Chapter 1. The structure of primary and secondary plant cell walls and the genes that affect the synthesis of the various cell wall polymers are discussed and a description of cellulose structure in plant cell walls is provided. Thereafter, the review is focused on cellulose biosynthesis. The CesA gene family is discussed, with special attention to Arabidopsis and Eucalyptus CesA homologues. A model for cellulose synthesis is proposed, highlighting possible functions of other proteins believed to be involved in the process. Finally, support for the use of Arabidopsis to study xylogenesis is presented and potential problems in transgenic gene expression studies are considered. Three different CESA proteins are believed to comprise each rosette involved in primary cell wall cellulose synthesis and three other CESA proteins form rosette complexes for cellulose synthesis during secondary cell wall deposition. Current knowledge on the organization of proteins within rosettes is shortcoming. Modes of transcriptional and posttranscriptional regulation of CesA genes are still unknown. It seems prudent to gain knowledge on these processes in order to increase cellulose biosynthesis in commercially important trees. Because of the difficulties involved with functional analysis of genes in trees, this study aimed to functionally characterise a Eucalyptus CesA gene, EgCesA1, in Arabidopsis. In Chapter 2 of this dissertation, questions regarding the effect of overexpressing EgCesA1 in Arabidopsis plants are addressed. The questions included: How will over-expression of EgCesA1 affect growth and development of Arabidopsis? Will cell wall chemistry be affected in stem tissues? Will expression of endogenous CesA genes be affected? Will other cell wall related biosynthetic pathways be affected? The final question that is addressed asks whether EgCesA1 over-expression is sufficient to affect cellulose synthesis or whether it will be necessary to express all three secondary cell wall CESA proteins. General findings, conclusions and implications of this M.Sc study are summarized in the final section of this dissertation titled Concluding Remarks. iv Outcomes from a study undertaken March 2006 to February 2009 in the Department of Genetics, University of Pretoria, under the supervision of Prof. A.A. Myburg are presented in this dissertation. Cell wall chemistry analysis, described in Chapter 2, was carried out at the University of British Columbia, Vancouver, Canada by Prof. S.D. Mansfield. In order to confirm EgCesA1 as a functional orthologue of the homologous Arabidopsis CesA gene, AtCesA8, the study initially also involved mutant complementation of an Arabidopsis plant containing a mutated AtCesA8 gene (irx1), with EgCesA1. However, difficulties with transformation of cell wall mutant plants of the Landsberg erecta background hampered progress and prevented us from completing this aspect of the study. Therefore, only the overexpression of the EgCesA1 gene in wild-type Arabidopsis plants is reported in this dissertation. The following posters were generated based on the preliminary results obtained in this M.Sc study: O’Neill, M., Ranik, M. and Myburg, A.A. 2007. Functional analysis of the secondary cell wall-associated cellulose synthase (CesA) genes of Eucalyptus grandis. IUFRO Tree Biotechnology Meeting, June 3-8, Ponta Delgada, Azores, Portugal. O’Neill, M. and Myburg, A.A. 2008. Functional analysis of the Eucalyptus grandis secondary cell wall associated cellulose synthase 1 (EgCesA1) gene in Arabidopsis thaliana. SAGS Congress, March 26-29, Pretoria, South Africa. v ACKNOWLEDGEMENTS I would like to convey my gratitude to the following people, organizations and institutes for assisting me in the completion of this study: Prof. A.A. Myburg for his valued supervision and leadership on this project and his patience and guidance in reviewing the dissertation. Dr. S. Naidoo for her advice on statistical analysis and for her contribution to the review of the dissertation. Mr. E. Mizrachi for his motivational guidance and insight on the project and valued review of the dissertation. Prof. S.D. Mansfield for chemical analysis of Arabidopsis inflorescence stems. Mr. M. Mphahlele for much appreciated assistance in microscopy and Arabidopsis transformation. Ms. M.H. de Castro for her advice, friendship and unwavering willingness to assist in this project. Mr. M. Ranik for providing Eucalyptus grandis cDNA and his valued advice. All my Forest Molecular Genetics (FMG) colleagues for support and friendship throughout the project. Sappi and Mondi for funding of the project. The National Research Foundation of South Africa (NRF) for funding of the project and the awarded scholarship. The Human Resources and Technology for Industry Programme (THRIP) for financial contributions to the Wood and Fibre Molecular Genetics Programme (WFMG). The Department of Genetics of the University of Pretoria and the Forestry and Agricultural Biotechnology Institute (FABI) for providing facilities and stimulating an academic environment. vi Finally, my husband and family for their encouragement, patience and support throughout the project. vii THESIS SUMMARY Functional genetic analysis of the Eucalyptus grandis cellulose synthase 1 (EgCesA1) gene in Arabidopsis thaliana Marja M. O’Neill Supervised by Prof. A.A. Myburg Co-supervised by Dr. S. Naidoo Submitted in partial fulfilment of the requirements for the degree Magister Scientiae Department of Genetics University of Pretoria Cellulose is the most important component of paper and pulp products and increased cellulose biosynthesis in commercially important trees like Eucalyptus spp. could greatly benefit paper and pulp industries. Cellulose in plants occurs mostly in the secondary cell walls together with lignin and hemicellulose. It is biosynthesised by membrane-bound rosette-shaped protein complexes. The rosette complexes are believed to be comprised of six sub-units each containing six cellulose synthase (CESA) proteins. The CESA proteins utilise UDP-glucose to polymerize growing glucan chains that coalesce to form cellulose microfibrils. Three distinct CESA proteins form the rosette complexes during primary cell wall formation and three different CESA proteins form complexes during secondary cell wall deposition. The exact means by which the CESA proteins interact within a rosette complex remains unknown. Elucidating rosette protein complex assembly and better characterization of CESA protein activity is required in order to increase cellulose biosynthesis in commercially important trees. Because of the difficulties to characterise genes and proteins in tree species, Arabidopsis viii thaliana has been used to study xylogenesis. Although it is a herbaceous weed, Arabidopsis has been shown to undergo secondary growth under certain conditions. A literature study of cellulose biosynthesis in plants has highlighted several scientific questions: Will over-expression of a heterologous secondary cell wall CESA protein in Arabidopsis lead to increased cellulose biosynthesis? What effect will the over-expression of a heterologous protein have on the growth and development of Arabidopsis? Will it have an effect on cell wall chemistry in stem tissues? What effect will expression of the transgene have on endogenous Arabidopsis gene expression? The aim of this M.Sc study was to functionally characterise the Eucalyptus secondary cell wall associated cellulose synthase gene, EgCesA1, in Arabidopsis. The EgCesA1 coding sequence was constitutively expressed in wild-type Arabidopsis plants. Three transgenic lines expressing EgCesA1 was generated. Hypocotyl and inflorescence vascular cell wall phenotypes were compared between transgenic and wild-type plants. Chemical analysis of inflorescence tissues were performed to detect changes in monosaccharide and lignin content of transgenic plants compared to wild-type plants. Transcript levels of EgCesA1 and endogenous Arabidopsis genes involved in cell wall biogenesis were quantified and compared between wild-type and transgenic lines. No significant changes in cell wall morphology could be detected, despite small alterations in inflorescence cell wall chemical composition in transgenic plants. Expression of EgCesA1 did not appear to have a statistically significant effect on endogenous gene transcript levels. It was concluded that constitutive expression of a single transgenic CesA gene is insufficient to increase cellulose biosynthesis. ix TABLE OF CONTENTS DECLARATION …………………………………………………... ii PREFACE ………………………………………………………….. iii ACKNOWLEDGEMENTS ……………………………………….. vi THESIS SUMMARY …………………………………………..….. viii TABLE OF CONTENTS ………………………………………..… x LIST OF FIGURES …………...…………………………………… xiii LIST OF TABLES ……………………………………………..…... xvi LIST OF ABBREVIATIONS ……………………………............... xvii CHAPTER 1 ………………………………………………………... 1 LITERATURE REVIEW – MOLECULAR BIOLOGY OF CELLULOSE BIOSYNTHESIS IN PLANTS ….……………………………………………….......... 1 1.1 Introduction ………………………………………………………………........... 2 1.2 Plant cell wall structure and the genes that affect it ..……………………........... 5 1.2.1 Primary cell walls ……………..………………………………............... 5 1.2.2 Secondary cell walls ……………………………………..………........... 8 1.3 Cellulose structure …………………………………………………………......... 11 1.4 Cellulose biosynthesis ……………………………………………………........... 12 1.4.1 Cellulose microfibril synthesis ……………………………...……......... 14 1.4.2 The cellulose synthase superfamily ………..………..……………......... 15 1.4.3 Cellulose synthases of the primary cell wall ………………………........ 16 1.4.4 Cellulose synthases of the secondary cell wall ……………………........ 17 1.4.5 Eucalyptus CesA homologues ……….……………………….……....... 17 1.4.6 Other genes involved in cellulose biosynthesis ……..……………......... 18 1.5 Arabidopsis as a model for xylogenesis …………………………………............ 23 x 1.5.1 Positional and silencing effects on transgene expression ….................... 24 1.5.2 Secondary growth in Arabidopsis …………………………………........ 25 1.6 Conclusions ………………………………………………………………........... 27 1.7 References ……………………………………………………………….…........ 28 CHAPTER 2 ..………………………………………………………. 44 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA ……………………………………………………............ 44 2.1 Abstract ……………………………………………………………………......... 45 2.2 Introduction …………………………………………………...…………............ 45 2.3 Materials and Methods …………………………………………...………........... 48 2.3.1 Biological material and growth conditions ..……………………............ 48 2.3.2 Vector construction ………………..……………………………............ 49 2.3.3 Transformation of competent Agrobacterium tumefaciens cells ............. 52 2.3.4 Transformation of Arabidopsis thaliana plants …………………........... 52 2.3.5 Selective screening of transgenic Arabidopsis plants …...………........... 53 2.3.6 PCR analysis of transgenic plants …………………………………....... 54 2.3.7 Reverse transcription PCR analysis ………………………………........ 54 2.3.8 Microscope analysis of cell wall phenotype ….………………….......... 56 2.3.9 Cell wall chemistry analysis of Arabidopsis stems ………………........ 57 2.3.10 Quantitative real-time PCR analysis ……...………………………........ 57 2.4 Results ………………………………………………...…………………........... 59 2.4.1 Vector construction ………………………………………………......... 59 2.4.2 Selective screening and PCR of transgenic plants ……………….......... 62 2.4.3 RT-PCR of transgenic plants …………………………………….......... 63 2.4.4 Microscopy of stem cell walls ……………………………………........ 65 2.4.5 Cell wall chemistry of transgenic plant stems …………………............ 66 xi 2.4.6 Expression analysis of EgCesA1 and other cell wall related genes in wild-type and transgenic Arabidopsis plants ........................................... 67 2.5 Discussion ………………………………………………………………............ 77 2.6 References ………………………………………………………………............ 86 2.7 Supplementary material …………………………………………………........... 92 CONCLUDING REMARKS …………………………...……......... 122 References ………………………………………………………….…………….......... 126 xii LIST OF FIGURES Figure 1.1 β (1-4) glycosidic bond between glucose monomers in cellulose ……......... 11 Figure 1.2 Hydrogen bonds in type Iβ crystalline cellulose …………............................ 12 Figure 1.3 Diagrams of rosette structures ………………………………………... ........ 14 Figure 1.4 Model of cellulose biosynthesis ……...………………………………. ........ 19 Figure 2.1 Schematic representation of the LR cloning reaction …………………….... 51 Figure 2.2 Illustration of tissues sampled for RT-PCR and qRT-PCR …………........... 55 Figure 2.3 1% EtBr/Agarose gel electrophoresis of EgCesA1 CDS PCR products amplified from cDNA ....................................................................................................... 60 Figure 2.4 1% EtBr/Agarose gel electrophoresis of colony PCR products amplified from pTOPO-EgCesA1 and pMDC32-EgCesA1………………………………………........... 61 Figure 2.5 Hygromycin selection of T1 seeds ...…………….......................................... 62 Figure 2.6 1% EtBr/Agarose gel electrophoresis of the amplified EgCesA1 PCR products from leaf genomic DNA ……………………………………........................................... 63 Figure 2.7 1% EtBr/Agarose gel electrophoresis of extracted total RNA and PCR products amplified from cDNA using UBQ10 primers flanking an intron ……….......... 64 Figure 2.8 1% EtBr/Agarose gel electrophoresis of RT-PCR products …………........... 65 Figure 2.9 Images of inflorescence stem and hypocotyl cross sections of wild-type (WT) and transgenic plant lines (MO1, MO2 and MO3) as observed using light microscopy . 66 Figure 2.10 Chemical composition of stems from wild-type (WT) and transgenic insertion lines (MO1, MO2 and MO3) transformed with EgCesA1…...…..........…....................... 68 Figure 2.11 Relative transcript abundance levels of EF1 and UBQ10 in leaves, upper- and lower stems of wild-type (WT) and transgenic (MO1, MO2 and MO3) plants ............... 69 Figure 2.12 Relative transcript abundance of EgCesA1 in wild-type and transgenic plant lines, MO1 and MO3 ....................................................................…………………........ 72 Figure 2.13 Relative transcript abundance levels of Arabidopsis primary cell wall associated CesA genes ……...........................................................................………...…................. xiii 73 Figure 2.14 Relative transcript abundance levels of Arabidopsis secondary cell wall associated CesA genes ………………………………………………………….............. 74 Figure 2.15 Relative transcript abundance levels of CYT1, KOBITO 1, KORRIGAN and COBRA .............................................................................................................................. 75 Figure 2.16 Relative transcript abundance levels of SPP, SPS, SuSy1 and SuSy4…........ 76 Figure 2.17 Relative transcript abundance levels of AtCAD4, AtCAD5 and THESEUS 1 77 Figure S2.1 Vector map of pTOPO-EgCesA1 ……………………………….................. 92 Figure S2.2 Vector maps of the empty and recombinant destination vector, pMDC32 and pMDC32-EgCesA1 …………………………………………………......... 93 Figure S2.3 Alignment of predicted amino acid sequences of four pTOPO-EgCesA1 clones ................................................................................................................................. 94 Figure S2.4 Melting curves of the qRT-PCR products for each gene specific primer pair .................................................................................................................................... 98 Figure S2.5 1% EtBr/Agarose gel electrophoresis of bulked qRT-PCR products for 22 gene-specific primer pairs ……………………………………………………................. 99 Figure S2.6 Relative expression levels of EgCesA1 and Arabidopsis cell wall related genes ……………………………………………………………………………… ......... 100 Figure S2.7 Regression analysis of relative transcript levels of all genes compared between biological replicates across all tissues ………………...……………….... ......... 105 Figure S2.8 Regression analysis of relative transcript levels compared between biological replicates of wild-type plants …………………………………………............................ 106 Figure S2.9 Regression analysis of relative transcript levels compared between biological replicates of MO1 transgenic plants ………………………………….............................. 107 Figure S2.10 Regression analysis of relative transcript levels compared between biological replicates of MO2 transgenic plants ………………………………….............................. 108 Figure S2.11 Regression analysis of relative transcript levels compared between biological replicates of MO3 transgenic plants ………………………………….............................. 109 Figure S2.12 Transcript levels of UBQ10 and EF1 before normalization ………. ......... xiv 110 Figure S2.13 Sequence alignment of AtCesA8 and EgCesA1 cDNA ……………. ......... xv 111 LIST OF TABLES Table 2.1 Oligonucleotide primers used for vector construction, DNA sequencing and RNA analysis ..................................................................................................................... 50 Table 2.2 RNA samples obtained from transgenic and wild-type plants ......................... 56 Table 2.3 R2-values for biological replicates of wild-type, MO1, MO2 and MO3 plants 70 Table 2.4 Slope-values of the regression lines for biological replicates of wild-type, MO1, MO2 and MO3 plants ....................................................................................................... 71 Table S2.1 Oligonucleotide primers used for qRT-PCR analysis of the EgCesA1 transgene and endogenous Arabidopsis genes …………..................................………..……........... 119 Table S2.2 Oligonucleotide primers used for amplification of putative housekeeping genes ……………………………………………………………………...……..…........ 120 Table S2.3 Sequence results of bulked qRT-PCR products analysed using BLAST ….. 121 xvi LIST OF ABBREVIATIONS ACT2 ACTIN 2 AGP Arabinogalactan protein cDNA Complementary deoxyribonucleic acid CAD Cinnamyl alcohol dehydrogenase CDS Coding sequence CesA Cellulose synthase CMV Cauliflower mosaic virus Col-0 Columbia ecotype 0 CYT1 CYTOKINESIS DEFECTIVE 1 D Aspartate dNTP Deoxyribonucleotide-triphosphate EF1 ELONGATION FACTOR 1α EtBr Ethidium bromide GPI Glycosylphosphatidylinositol GX Glucuronoxylan MAP Microtubule associated protein NCBI National Center for Biotechnology Information PCR Polymerase chain reaction PME Pectin methyl esterase PTGS Post-transcriptional gene silencing qRT-PCR Quantitative real-time polymerase chain reaction RISC RNA-induced silencing complex RT-PCR Reverse transcriptase polymerase chain reaction SPP Sucrose-phosphate phosphatase SPS Sucrose-phosphate synthase SuSy Sucrose synthase xvii T-DNA Transferred DNA TGS Transcriptional gene silencing TMH Trans-membrane helix TUB TUBULIN UBQ UBIQUITIN UGPase Uridine diphosphate-glucose pyrophosphorylase YEP Yeast extract peptone XET Xyloglucan endotransglycosylase xviii CHAPTER 1 LITERATURE REVIEW MOLECULAR BIOLOGY OF CELLULOSE BIOSYNTHESIS IN PLANTS LITERATURE REVIEW 1.1 Introduction There is no denying the importance of wood and wood products in the lives of people across the globe. Wood can be utilized for an array of products ranging from toilet paper to mining timber. It is a renewable and vital source of carbon to households and industry where different wood characteristics can be exploited to meet the demands of consumers. Understanding the biological processes underlying wood development is becoming increasingly important as the demand for bio-fuels and other commercial applications of wood increases. The process of xylogenesis (wood formation) occurs in five major steps. First, xylem mother cells originate from dividing fusiform and ray initials in the vascular cambium. Secondly, the xylem mother cells divide and cells that originated from fusiform initials elongate longitudinally. The third step involves the deposition of the secondary cell wall which mainly consists of cellulose and lignin. After the secondary cell wall has been deposited, the now mature xylem cells undergo programmed cell death (PCD, Kozela and Regan, 2003). The final step in xylogenesis is heartwood formation (Plomion et al., 2001). The main difference between heartwood and sapwood, that lies between the vascular cambium and heartwood, is that the vertical and ray parenchyma cells in sapwood are still metabolically active. Rays are parenchyma cells that facilitate horizontal channelling of nutrients and water across the stem. They have also been proposed to be involved in storage of metabolic waste substances secreted from cells. Increased levels of excretory substances could lead to cell death of the vertical and ray parenchyma cells and the formation of heartwood (Stewart, 1966; Mauseth, 1988). Tylose formation involves blocking or sealing of vessel cells by adjacent parenchyma cells that push part of their cytoplasm through pit apertures into the lumen of the vessel cell. The outgrowths of cytoplasm contained within the vessel cell wall are tyloses. Several tyloses can fill the cavity of a vessel cell. Tylose formation is the final step in the conversion of sapwood to heartwood. (Stewart, 1966). Cellulose, the predominant polymer in wood, is made up of β-1,4-linked glucan molecules that crystallize to form cellulose microfibrils. It is synthesised at the cell membrane by protein complexes 2 LITERATURE REVIEW (Brown Jr and Montezinos, 1976). The first cellulose synthase (CESA) protein was discovered in 1982 in Acetobacter xylinum (Aloni et al., 1982) and the gene sequence was determined in 1990 (Saxena et al., 1990). Since then several other CesA genes have been identified in a range of species including plants like cotton (Pear et al., 1996), Arabidopsis thaliana (Arioli et al., 1998), maize (Appenzeller et al., 2004), barley (Burton et al., 2004), rice (Tanaka et al., 2003), poplar (Joshi et al., 2004) and Eucalyptus (Ranik and Myburg, 2006). The CesA gene family forms part of a larger cellulose synthase superfamily consisting of one CesA and eight CesA-like (Csl) sub-families (Richmond and Somerville, 2000; Lerouxel et al., 2006). Cellulose synthase (CESA) proteins are UDP-glycosyltransferases that form terminal complexes in the cell membrane. In plants, the CESA proteins form a membrane-bound terminal complex structure that resembles a rosette that was first observed in Micrasterias denticulata (Kiermayer and Sleytr, 1979) and later observed in higher plants (Mueller and Brown, 1980). It is thought to consist of six subunits that each contains six CESA proteins (Herth, 1983). It has been suggested that homo- and heterodimerization of CESA proteins occur prior to rosette assembly (Doblin et al., 2002; Timmers et al., 2009). The CESA proteins are believed to add UDP-glucose monomers to growing β-1,4-glucan chains. Although more than two decades have passed since the first cellulose synthase gene was discovered, it is still not known how the CESA proteins assemble to form active complexes that synthesise cellulose. Several other proteins involved in cellulose deposition have been identified. They include KORRIGAN (Szyjanowicz et al., 2004), KOBITO 1 (Pagant et al., 2002), COBRA (Wakabayashi et al., 2005) and CYTOKINESIS DEFECTIVE 1 (CYT1, Lukowitz et al., 2001). The precise functions of these proteins remain elusive, but plants mutated for the genes encoding these proteins all show a level of cellulose deficiency. The deficiencies varied between 33% in kobito 1 (Pagant et al., 2002) and cobra (Schindelman et al., 2001) mutant plants, 30% to 60% in korrigan mutants (Sato et al., 2001; Szyjanowicz et al., 2004) and up to a five-fold decrease in cyt1 mutant plants (Lukowitz et al., 2001). Studying the process of xylogenesis and the roles the aforementioned genes play in trees could be problematic due to the long generation times and low efficiency of tree-transformation. This 3 LITERATURE REVIEW creates a need for a model plant in which xylogenesis can be examined. Even though the well established model plant, Arabidopsis thaliana, is a herbaceous weed, it has been proven to be a valuable model for xylogenesis (Lev-Yadun, 1994; Chaffey et al., 2002). Arabidopsis meets the requirements for a good model organism. The full genome sequence is publicly available (The Arabidopsis Genome Initiative 2000). Genome-, proteomic- and metabolomic resources can be accessed through the online Arabidopsis Information Resource, TAIR (www.arabidopsis.org). Results from a large number of microarray studies are obtainable through GENEVESTIGATOR (www.genevestigator.com) to allow comparative gene expression analysis (Zimmermann et al., 2004). Mutant strains of Arabidopsis are easily obtainable for knock-out studies (abrc.arabidopsis.org) and Arabidopsis has high transformability (Nieminen et al., 2004). Because Arabidopsis is widely used as a model for transgenic and promoter activity studies, new and improved methods are continuously being developed to increase transformation efficiency (Davis et al., 2009). Despite these improved techniques, there are aspects that need to be considered when embarking on transgene expression studies. The genomic region where the transgene inserts and the effects of post-transcriptional gene silencing (PTGS) are some of the concerns addressed later in the review. A better understanding of the processes that underlie xylogenesis is necessary to fully utilize the potential of wood and wood products. Many genes have been shown to be involved in wood formation, but many remain to be characterized. In this review, the assembly of plant cell walls and our current knowledge on the interaction of cell wall polymers and the genes underlying their biosynthesis are discussed. Special attention is given to the structure of cellulose and the genes expressing proteins that play a role in cellulose deposition. A revised model for cellulose biosynthesis is proposed highlighting areas where current knowledge on cellulose synthesis is still shortcoming. Finally, the review addresses the use of Arabidopsis to study secondary cell wall formation and aspects that need to be considered when using transgenics to study gene function. 4 LITERATURE REVIEW 1.2 Plant cell wall structure and genes that affect it 1.2.1 Primary cell walls Primary cell walls consist of a framework of cellulose microfibrils with hemicellulose, pectin and proteins assembled in between. Cellulose is synthesised by CESA protein rosette complexes that are embedded in the plasma membrane. (Details of cellulose biosynthesis are discussed in section 1.4) The cellulose microfibrils are connected via single-chain polysaccharides such as xyloglucans which form hydrogen bonds between their neutral backbones and the cellulose microfibril surface (McCann et al., 1990). Non-cellulosic polymers are soluble before they are linked to other molecules and are capable of moving in the cell wall environment to their destinations between the cellulose microfibrils (Reviewed in Somerville et al., 2004). These include three types of pectin, namely homogalacturonan, rhamnogalacturonan I, and rhamnogalacturonan II as well as glucuronoarabinoxylan, callose and xyloglucan, which is the most abundant hemicellulose in the primary cell walls of angiosperms (Richmond and Somerville, 2000; Sterling et al., 2006). The most abundant pectic polysaccharide is homogalacturonan. It is a linear polymer of α-1,4-linked galacturonic acid. Rhamnogalacturonan II is a substituted homogalacturonan and rhamnogalacturonan I is the most variable pectic polysaccharide with a complex backbone composition (Reviewed in Mohnen, 2008). The primary cell wall plays a vital role in cell and organ growth. This is also true for xylogenesis where the formation and expansion of the primary cell wall form part of the early events in wood development. Xyloglucan cross-links cellulose microfibrils and, by doing so, limits cell wall extensibility (Hayashi et al., 1987). Xyloglucan networks can be relaxed by xyloglucan endotransglycosylases (XETs) that cleave and rejoin xyloglucan chains to loosen the cell wall matrix and allow cell expansion (Fry et al., 1992). The primary cell wall can also be loosened by expansins. Expansins are proteins that facilitate wall loosening by weakening non-covalent bonds between the polysaccharides in the wall. Turgor pressure in the cell then pushes the cell wall to expand where the cell wall is loosened (McQueen-Mason, 1995; Cosgrove, 2000). Xylem cell-specific expansins have been identified in maize (Im et al., 2000) and poplar (Gray-Mitsumune et al., 2004). These expansins 5 LITERATURE REVIEW are believed to be involved in intrusive growth of the primary cell walls in differentiating xylem cells. Intrusive growth occurs when one cell outgrows the cells around it by passing between the walls of several adjacent cells (Lev-Yadun, 2001; Chernova and Gorshkova, 2007). The orientation in which cellulose microfibrils are deposited contribute to directing cell and organ growth. Kerstens and Verbelen (2003) observed that elongating cells in Arabidopsis hypocotyls have a mostly transverse mean microfibril orientation. This orientation is believed to enhance longitudinal growth while restricting girth expansion (Kerstens and Verbelen, 2003). Pectin forms a gel with varying mechanical strength between the cellulose-xyloglucan scaffold and can be modified to facilitate cell expansion. Pectin methyl-esterases (PMEs) remove the methyl-esters from pectin galacturonic acid and influence the gelling properties of pectin (Micheli, 2001). The degree of methylesterification has been shown to influence cell elongation in Arabidopsis hypocotyls (Derbyshire et al., 2007). Microtubules have been shown to play a role in the deposition of cellulose microfibrils (Green, 1962; Oda et al., 2005; Paredez et al., 2006; Wasteneys and Fujita, 2006). The interaction of cellulose with microtubules have long been apparent (Green, 1962), but the mechanism by which microtubules direct cellulose deposition still remains unknown. Although microtubule altering drugs have been shown to drastically affect cellulose microfibril orientation (Green, 1962; Quader, 1986; Oda et al., 2005), the most convincing evidence for the interaction of microtubules with microfibrils was provided in a study by Paredez et al. (2006). By means of spinning disk microscopy and a fluorescent protein fusion with Arabidopsis thaliana cellulose synthase 6 (AtCESA6), the authors were able to track CESA protein complexes in living cells and show that these complexes follow a path aligned with cortical microtubules during primary cell wall formation (Paredez et al., 2006). It is not clear whether this model pertains to secondary cell wall formation. The interaction between microtubules and emerging cellulose microfibrils have been proposed to be facilitated by proteoglycans called arabinogalactan proteins (AGPs, Baskin, 2001; Driouich and Baskin, 2008). Baskin (2001) proposed a model for cellulose deposition where a scaffold of proteins 6 LITERATURE REVIEW in the cell wall, connected to the plasma membrane, form a template wherein the nascent cellulose microfibril is orientated. The protein template responds to microtubule orientation and must therefore have some interaction with the cytosol. AGPs are proteins in the cell wall anchored to the plasma membrane. Many AGPs have glycosylphosphatidylinositol (GPI)-anchoring domains (Orlean and Menon, 2007). Driouich and Baskin (2008) suggested that AGPs could form part of this protein scaffold. Another key protein suggested to be involved is COBRA. It is also a GPI-anchored wall protein (Schindelman et al. 2001). The COBRA gene is expressed during rapid organ expansion and is suggested to be involved in the interactions between microtubules and cellulose microfibrils (Wasteneys and Fujita, 2006). The cobra mutant plants exhibit radial swelling in the roots. It has been observed that COBRA has a polar distribution in elongating root cells (Roudier et al. 2005). The means by which COBRA influences cellulose biosynthesis remains to be proven. Driouich and Baskin (2008) suggested that newly synthesised microfibrils interact with AGPs which interacts with COBRA. COBRA is proposed to be the physical link with microtubules to direct the orientation of cellulose deposition. Proteins that affect cellulose synthesis and associate with microtubules have also been identified. A microtubule associated protein (MAP) indentified in poplar, PttMAP20 (Rajangam et al., 2008) was shown to localise to microtubules and bind as a target to 2,6-dichlorobenzonitrile herbicide (a known inhibitor of cellulose synthesis). FRAGILE FIBRE 1 (FRA1) is a kinesin-like putative microtubule binding protein (Zhong et al., 2002). The fra1 mutant plants have normal cellulose content and microtubule organization, but altered cellulose microfibril orientation resulting in weakened fibre cell walls. MAPs, COBRA and AGPs could interact to facilitate the orientation of cellulose microfibrils in relation to microtubule organization, but the exact means by which this occurs remains unknown. In summary, microtubules are hypothesised to contribute to the orientation in which cellulose is deposited. The deposited cellulose microfibril framework is reinforced by cross-linking polymers like xyloglucan and pectins. Cross-links can be loosened through the actions of molecules like XETs, 7 LITERATURE REVIEW expansins and PMEs which enables the primary cell wall to still undergo expansion and allow cellular growth. 1.2.2 Secondary cell walls The secondary cell wall is deposited between the primary cell wall and the plasma membrane. It provides structural support against gravitational forces and is essential to cells involved in water transport. The secondary cell wall consists of three layers, S1, S2 and S3 (Cote Jr et al., 1968). S1 is deposited first and occurs just inside of the primary cell wall, while S3 is deposited last and is the closest to the plasma membrane. S2 occurs between S1 and S3. The angle at which cellulose microfibrils are deposited is different in each layer. S1, which is the thinnest of the three layers, has microfibrils at an angle of 60° to 80° to the cell axis. S2 microfibrils are deposited 5° to 30° relative to the cell axis. S2 is also the thickest of the three layers comprising 75% to 85% of the secondary cell wall. The inner most layer, S3, has cellulose microfibrils deposited in a parallel arrangement at an angle 60° to 90° to the cell axis (Plomion et al., 2001). Because S2 is the thickest, the angle of the cellulose microfibrils in this layer greatly influences the overall strength of the cell wall. The greater the microfibril angle relative to the cell axis, the less rigid the wall becomes as is observed in juvenile wood (Plomion et al., 2001). Another contributing factor involved in secondary cell wall reinforcement is lignification (Reiter, 2002). Lignin accumulates in cell walls of mature xylem and schlerenchyma cells. It is mainly a coniferyl and sinapyl alcohol polymer that causes the cell walls to become impermeable to gas and water. It also strengthens and rigidifies cell walls (Mauseth, 1988). The genes involved in monolignol biosynthesis have been extensively reviewed (Boudet, 2000; Boerjan et al., 2003; Li et al., 2006), but the exact mode of interaction of lignin with other cell wall polymers is not certain. One model proposed suggests that highly condensed lignin polymers interact with xylans that coat the cellulose microfibrils in secondary cell walls (Ruel et al. 2006). Ectopic lignification has been observed in plants with reduced cellulose content (Cano-Delgado et al., 2003). Ectopic lignification 8 LITERATURE REVIEW could be a defence response in plants since lignin is resistant to degradation by microorganisms (Campbell and Sederoff, 1996). The deposition of cell wall carbohydrates involves two groups of genes. The first group is involved in the linkage of mono- and disaccharides to form the backbone of a polymer. These genes encode synthases. The second group encode glycosyltransferases that add specific sugars to the polymer backbone (Carpita et al., 2001). The genes encoding the cellulose synthases (CesAs) form part of a super gene family called the cellulose synthase superfamily, which include one CesA gene family (see section 1.4.2) and eight CesA-like gene sub-families (CslA-H, Richmond and Somerville, 2000; Lerouxel et al., 2006). Genes in the CesA-like (Csl) gene sub-families are believed to encode proteins responsible for hemicellulose biosynthesis. However, it has been difficult to assign a specific gene to the assembly of a particular hemicellulose, because of genetic redundancy and the great complexity of hemicellulose (Richmond and Somerville, 2000; Bonetta et al., 2002). β-mannan synthase was the first member of the CesA-like A (CslA) gene family to have been assigned a function. It was found to encode the protein that synthesises the backbone of the hemicellulose mannan in guar seeds (Dhugga et al., 2004). It was later discovered that a CSLA protein was capable of not only synthesising mannan backbones (made of mannose monomers), but also the backbones of glucomannan (made of mannose and glucose monomers, Liepman et al., 2005). The backbones of mixed-linkage glucans and xyloglucans were later revealed to be synthesised by proteins transcribed by members of the CslF and CslC gene families, respectively (Persson et al., 2005; Burton et al., 2006). Xylan, the most abundant hemicellulose in secondary cell walls, is comprised of backbones of 1,4-linked β-xylosyl residues that are substituted with α–D-glucuronic acid, arabinose or 4-O-methylα-D-glucuronic acid. Xylan is classified under (methyl)glucuronoxylan (GX), arabinoxylan and glucuronoarabinoxylan. The classification of xylan is based on the nature of the side-chains. GX also have a characteristic glycosyl sequence at the reducing end of the polymer (Lee et al., 2007a). Genes involved in the synthesis of GX backbones were identified by the phenotypes of mutant plants. The 9 LITERATURE REVIEW mutants had abnormal xylem cell walls and some were therefore classified as irregular xylem (irx) mutants. These include irx8 (Persson et al., 2005), irx9 (Brown et al., 2005), irx14 (Brown et al., 2007), irx10 and irx10-like (irx10-L) (Brown et al., 2009). FRAGILE FIBRE 8 (FRA8) and PARVUS were also shown to be involved in GX synthesis (Zhong et al., 2005; Lee et al., 2007b). fra8 mutants (irx7) have reduced xylan and cellulose compared to wild-type plants. Mutations in the PARVUS gene lead to reduced GX content. PARVUS, FRA8 and IRX8 have been shown to be required for the synthesis of the characteristic glycosyl sequence on the end of the GX chains, while IRX9, IRX10, IRX10-L and IRX14 are involved in the synthesis of the GX backbone(Brown et al., 2007; Lee et al., 2007a; Pena et al., 2007; Brown et al., 2009). The side-chains of hemicellulose are added by glycosyltransferases. Xyloglucan has, among others, xylose-galactose-fucose sidechains. The addition of fucose is mediated by xyloglucan fucosyltransferase encoded by the MUR2 gene (Vanzin et al., 2002). Pea and Arabidopsis plants mutated for this gene showed a deficiency in fucose. Another mutant, mur3, also exhibited fucose deficiency, but this was due to a mutated gene that encodes xyloglucan galactosyltransferase. Since the galactose is attached before the fucose residue, mur3 mutants are deficient in galactose and fucose (Madson et al., 2003). The secondary cell wall is a complex system of cellulose microfibril frameworks interconnected with hemicellulose and fortifying lignin. Together, the components serve to withstand turgor and gravitational forces imposed on secondary cell walls. Better understanding of the synthesis of the various components may elucidate the exact means of interaction between them. It is clear that all components are essential for correct functioning of the secondary cell wall, since a reduction in any one of the components weakens secondary cell walls and causes the cells to collapse and exhibit the irx phenotype. 10 LITERATURE REVIEW 1.3 Cellulose structure Cellulose consists of glucose monomers which are connected by covalent bonds to form β-1,4-glucan chains. The monomers are joined at a 180° angle to each other (Figure 1.1). The chains are aligned and crystallization (the formation of hydrogen bonds and Van der Waals forces between glucan chains) can occur, resulting in a cellulose microfibril with a diameter of approximately 3 nm (Muhlethaler, 1967; Herth, 1983). These microfibrils can further crystallize to form fibrils. Figure 1.1 β (1-4) glycosidic bond between glucose monomers in cellulose. Cellulose occurs as crystalline and non-crystalline cellulose in plant cell walls. Crystalline cellulose can be further classified as naturally occurring crystalline cellulose type I and processed cellulose type II, III and IV (Davis et al., 1943). Type II cellulose occurs due to chain folding and results in glucan chains that are in anti-parallel configuration (Kolpak and Blackwell, 1976). This is thermodynamically the most stable form of cellulose. Cellulose type I, however, is the most abundant allomorph in nature. It has parallel glucan chains (Jarvis 2003) and is sub-divided into two suballomorphs, type Iα and type Iβ (Atalla and VanderHart, 1984; Nishiyama et al., 2003). Although combinations of the two sub-allomorphs occur in organisms, type Iα make up the bulk of crystalline cellulose in algae and bacteria, whereas wood, cotton and tunicates are type Iβ rich (Sugiyama et al., 1991). Type Iα is meta-stable and can, by means of annealing, be converted to the more stable type Iβ (Atalla and VanderHart, 1984). Crystallization does not occur immediately after the glucan chains are formed. Saxena and Brown (2005) suggested that there are several stages in this process. The first step involves the assembly of glucan chain sheets by Van der Waals forces followed by hydrogen 11 LITERATURE REVIEW bonding to make a cellulose I microfibril (Cousins and Brown, 1997). Proteins that are directly involved in cellulose crystallization in plants have not been identified, but it is believed that the rate of crystallization influences the rate at which cellulose is synthesised (Emons and Mulder, 2000; Mulder et al., 2004). The intra-molecular hydrogen bonds that occur in cellulose are illustrated in Figure 1.2 as blue lines. The hydrogen bonds that occur between two chains in the type Iβ sub-allomorph are shown as red lines. Figure 1.2 Hydrogen bonds in type Iβ crystalline cellulose. Red lines indicate hydrogen bonding between two parallel chains and blue lines indicate intra-molecular bonds (Heiner et al., 1995). 1.4 Cellulose biosynthesis The biosynthesis of cellulose was first studied in Acetobacter xylinum (Glaser, 1958; Ohad et al., 1962). This gram-negative bacterium was used to uncover the biosynthetic enzymes responsible for the production of cellulose. Cellulose was produced in vitro using isolated membranes from Acetobacter in 1982 (Aloni et al., 1982). From this study came the first purified cyclic diguanylic acid (c-di-GMP) dependent cellulose synthase. The gene encoding the catalytic subunit of the synthase was later identified as AcsA (Saxena et al., 1990). This gene formed part of an operon consisting of 12 LITERATURE REVIEW four genes of which the first three were essential for cellulose production in the bacterium (Saxena et al., 1990). Since then several cellulose synthases have been characterized in among others Agrobacterium tumefaciens (Matthysse et al., 1995), Gossypium hirsutum (Pear et al., 1996) and Arabidopsis thaliana (Arioli et al. 1998). The first plant cellulose synthases were discovered in cotton and rice cDNA (Pear et al., 1996). In 1999, Delmer proposed a new nomenclature for the cellulose synthase genes and the name “CesA” originated (Delmer, 1999). Originally the abbreviation CelA was used to describe a gene homologous to the catalytic subunit of the gene first identified to encode the cellulose synthase protein in Acetobacter xylinum. Since Cel was also used to designate cellulases, Delmer proposed using “CeS” for cellulose synthase followed by “A” to show it is homologous to the bacterial catalytic subunit A. The biosynthesis of cellulose in plants occurs at the plasma membrane. Here β-1,4-glucan chains are synthesised by hexameric protein complexes (rosettes) embedded in the plasma membrane using UDP-glucose as substrate (Mueller and Brown, 1980). The rosette complexes are believed to be assembled in the Golgi and transported to the plasma membrane through the vesicle shuttle (Haigler and Brown, 1986). It consists of six sub-units each containing six CESA proteins (Figure 1.3). Three distinct CESA proteins are assembled into a sub-unit of a rosette (see sections 1.4.3 and 1.4.4). The CESA proteins have been hypothesised to interact in a protein specific manner so that each CESA protein occupies one or more specific positions in a sub-unit (Arioli et al., 1998). It has been shown that three distinctive CESA proteins are required to form cellulose in the primary cell wall (Persson et al., 2007) and a different set of CESA proteins are required for secondary cell wall cellulose deposition (Taylor et al., 2003). Different models for rosette complex assembly have been proposed based on the formation of homo- and heterodimers between CESA proteins using yeast-two-hybrid analysis and bimolecular fluorescence complementation (Doblin et al., 2002; Timmers et al., 2009). 13 LITERATURE REVIEW Figure 1.3 Diagrams of rosette structures. Each rosette is believed to consist of six sub-units, each comprised of six CESA proteins. Three different CESA proteins comprise a rosette. Each sub-unit can consist of a single kind of CESA protein (A) or it could be comprised of different CESA proteins (B). The possible compositions of the sub-units are illustrated in C. The sub-unit on the left contains six of the same CESA protein, the sub-unit in the middle contains three different CESA proteins in equal number (Timmers et al., 2009) and the sub-unit on the right contains three different CESA proteins in a 1:2:3 ratio (Doblin et al., 2002). 1.4.1 Cellulose microfibril synthesis From observing microfibril diameters and freeze-fractured images of the cellulose synthesising complexes it is inferred that rosettes in higher plants each synthesise 36 cellulose chains (Herth, 1983). This corresponds with the hypothesis that each rosette is made up of six subunits of six CESA proteins which each synthesise a single glucan chain. These glucan chains subsequently coalesce to form a cellulose microfibril. Williamson et al. (2002) reviewed two hypotheses for the assembly of the glucan chains. The “direct assembly” hypothesis suggests that the glucose residues are attached to the glucan chain directly by the glycosyltransferases. The “indirect assembly” mechanism involves the formation of short glucan chains attached to lipid or protein primers that later become incorporated into a long glucan polymer. Cellulose synthesis in Agrobacterium tumefaciens (Matthysse et al., 1995) is believed to occur by indirect assembly, while Acetobacter xylinum (Kawagoe and Delmer, 1997) uses a direct assembly mechanism. Higher plants appear to be capable of both methods of assembly (Williamson et al., 2002). The fact that the glucose monomers are attached at a 180° angle to each other raises a problem for the direct assembly mechanism. A single enzyme with only one 14 LITERATURE REVIEW active site will most likely be unable to add residues in opposite orientations. The most plausible explanation is that the enzyme has two substrate-binding sites that pre-align the monomers (Williamson et al., 2001). 1.4.2 The cellulose synthase superfamily The cellulose synthase superfamily consists of eight CesA-like (Csl) sub-families and one CesA family (Richmond and Somerville, 2000). All of the genes in this superfamily are believed to be integral membrane proteins. It has been proposed that each Csl sub-family is responsible for the biosynthesis of a different non-cellulosic polysaccharide, while the CESA proteins synthesise cellulose microfibrils in primary and secondary cell walls. The CesA gene family has ten members in Arabidopsis and seven putative expressed orthologues in Eucalyptus (Richmond and Somerville, 2000; Ranik and Myburg, 2006 and unpublished data). Pear et al. (1996) described two main domains that exist in all CESA proteins. The first is the domain around two highly conserved aspartate (D) residues. The second domain includes another highly conserved D residue and a conserved QxxRW motif. These domains are in CESA proteins in plants and bacteria, and in CESA-like proteins. Plant CESA proteins also have plant-specific conserved insertions. These include two trans-membrane helices (TMH) in the Nterminal region and six in the C-terminal region. All of the conserved regions (D,D,D and QxxRW) occur in the cytoplasm and are believed to comprise the catalytic domain. A domain with high homology to the RING-finger domain at the N-terminus of plant CESA proteins is believed to be involved in homo- and hetero-dimerization between CESA proteins (Kurek et al., 2002). There are also two class-specific regions, CSRI and CSRII (Vergara and Carpita, 2001). These regions are highly conserved between CesA homologues of different species but not between CESA proteins within the same species. 15 LITERATURE REVIEW 1.4.3 Cellulose synthases of the primary cell wall As mentioned above, three CesA genes have been confirmed to have specific roles in the formation of primary cell walls in Arabidopsis. AtCesA1, AtCesA3 and AtCesA6 are required for correct primary cell wall assembly (Arioli et al., 1998; Dhugga, 2001; Desprez et al., 2002). The AtCesA1 mutant is known as radial swelling 1 (rsw1), (Arioli et al., 1998). The rsw1 mutants have a reduction in cell and organ length. This is due to cell wall abnormalities throughout the plant. The first mutants of AtCesA3 and AtCesA6 identified were isoxaben resistant 1 (ixr1) and ixr2, respectively. These mutants are isoxaben (a cellulose synthase inhibitor) resistant, have reduced cellulose and exhibit radial swelling of the hypocotyls and roots (Dhugga, 2001; Desprez et al., 2002). Null mutants of AtCesA1 and AtCesA3 are lethal, while AtCesA6 null mutants exhibit a milder phenotype. This is attributed to three other CesA genes that are closely related to AtCesA6. AtCesA2, AtCesA5 and AtCesA9 have been shown to be at least partially redundant to AtCesA6 (Desprez et al., 2007; Persson et al., 2007). It has been proposed that the AtCesA6-related gene products could occupy the same position in the rosette subunit during primary cell wall cellulose biosynthesis. The AtCesA6-related genes have different expression profiles across different plant developmental stages. AtCesA2 gene expression seems to have an influence on inter-node length (Burn et al., 2002), while AtCESA9 protein appears to be specifically required for cell wall deposition during pollen formation (Persson et al., 2007). What these results indicate is that AtCESA6 and related proteins function differently at different developmental stages. This probably contributes to fine-tuning of cellulose production and possibly the characteristics of the cellulose produced and it suggests variable rosette assembly in different tissues or conditions. Unlike the expression profiles observed for AtCesA2, AtCesA5 and AtCesA9, AtCesA1, AtCesA3 and AtCesA6 are expressed in most tissues throughout Arabidopsis (Cousins and Brown, 1997; Hamann et al., 2004). The expression levels of these genes have been proposed to be at a constant ratio to each other. This was discovered when the expression of the barley homologues of the CesA genes were analysed (Burton et al., 2004). The barley homologue of AtCesA3 (HvCesA1) had a higher expression than the homologues for AtCesA1 and AtCesA6 (HvCesA6 and HvCesA2, 16 LITERATURE REVIEW respectively). The homologue of AtCesA1 had the lowest expression in all the tissues analysed. Eventhough the same homologues are involved in primary cell wall formation in different plant species (Burton et al., 2004), it remains to be shown whether this expression ratio is constant in other plants. 1.4.4 Cellulose synthases of the secondary cell wall Just as in the primary cell wall, three different CESA proteins are required for correct assembly of the rosette structures that synthesise cellulose in the secondary cell wall (Taylor et al., 2003). The mutants of these CesA genes were identified to have decreased cellulose in the secondary cell walls that caused the xylem cell walls to collapse, hence the name “irregular xylem” (irx). AtCesA7 (IRX3) and AtCesA8 (IRX1) were the first genes identified to be involved in the deposition of cellulose in the secondary cell wall (Turner and Somerville, 1997). The third, AtCesA4 (IRX5), was only discovered to play a role in the secondary cell wall six years later (Taylor et al., 2003). The expression of the barley homologues of these three genes also exhibited a constant ratio to each other as in the primary cell wall. The AtCesA7 homologue (HvCesA8) showed higher expression, and the AtCesA4 homologue (HvCesA7) showed the lowest expression levels (Burton et al., 2004). This might explain why the function of AtCESA4 in the secondary cell wall had eluded researchers for so long. 1.4.5 Eucalyptus CesA homologues Seven Eucalyptus CesA genes have been isolated to date (Ranik and Myburg, 2006 and unpublished data). Once again, three CesA genes appear to have a specific role in the formation of the primary cell wall, while another three function in the assembly of secondary cell walls. EgCesA1 shows high homology to AtCesA8 (Figure 2 of Ranik and Myburg 2006), EgCesA2 shows homology to AtCesA4 and EgCesA3 shows homology to AtCesA7. As expected, these genes were mostly expressed in stems including xylem and immature xylem as well as in internodes. This correlates with the expected roles of these genes during the deposition of secondary cell walls. The Eucalyptus CesA genes involved in 17 LITERATURE REVIEW primary cell wall cellulose biosynthesis are EgCesA4 (homologous to AtCesA3), EgCesA5 (homologous to AtCesA1) and EgCesA7 (homologous to AtCesA6). These genes showed highest expression in flowers, internodes and young leaves (Burton et al. 2004; Ranik and Myburg 2006 and unpublished data). EgCesA6 was shown to be weakly expressed in all tissues analysed. The EgCESA6 protein had highest homology to monocot CESA proteins (Ranik and Myburg, 2006). 1.4.6 Other genes involved in cellulose biosynthesis Many proteins have been identified to play a role in the biosynthesis of cellulose even though they appear not to be incorporated into the cellulose synthase terminal complexes. Some of these proteins have been proposed to be involved in carbon partitioning towards cellulose synthesis, cellulose chain modification or N-glycosylation of the CESA proteins before they are incorporated into the cell membrane. However, the proposed functions have yet to be confirmed. Most of these proteins have been identified to have an influence on cellulose production based on their mutant phenotypes. Figure 1.4 is a model of cellulose biosynthesis where the different proteins and the proposed roles they play in cellulose deposition are illustrated. 18 LITERATURE REVIEW Figure 1.4 Model of cellulose biosynthesis in plants. The terminal rosette complexes embedded in the membrane incorporate UDP-glucose into the growing cellulose chains. SUSY (SuSy) converts sucrose into UDP-glucose. THESEUS (THESEUS 1) is hypothesised to detect faulty rosette structures and direct carbon flow towards lignification. COBRA is believed to facilitate the interaction of the terminal complexes with microtubules. CYT1 could be involved in two processes, the GPI-anchoring of COBRA and the N-glycosylation of the CESA proteins. KORRIGAN has been proposed to be involved in chain editing of the cellulose microfibrils and removal of the sitosterol primer in the indirect assembly model for cellulose biosynthesis. Sucrose synthase (SUSY) is an enzyme involved in partitioning carbon to cellulose biosynthesis. It is responsible for the conversion of sucrose into UDP-glucose and fructose. Sucrose originates at the leaves and is translocated to sink tissues like xylem fibres via the phloem (Mauseth, 1988). Two forms of SUSY have been described, soluble (S-SUSY) and particulate (P-SUSY, Haigler et al., 2001). S-SUSY occurs abundantly in the cytoplasm whereas P-SUSY is associated with the membrane. It is believed that P-SUSY, specifically, is responsible for channelling UDP-glucose to 19 LITERATURE REVIEW cellulose production (Winter et al., 1997; Haigler et al., 2001; Delmer and Haigler, 2002). The proposed function of SUSY raises an interesting question. Will an increase in SUSY protein result in an increase in cellulose biosynthesis? Up-regulation of SUSY and Acetobacter xylinum UDP-glucose pyrophosphorylase (UGPase) in tobacco resulted in increased total biomass due to increased height, but cellulose content remained unchanged (Coleman et al., 2006). Expressing only Acetobacter xylinum UGPase in transgenic poplar plants resulted in an increase in soluble sugars, cellulose content and starch, but transgenic plants had reduced height and stem diameters (Coleman et al., 2007). Coleman et al. (2007) also observed an increase in defence metabolites and concluded that cellulose content can be altered but at the cost of growth across the whole plant. Although SUSY appears to be a key player in carbon partitioning, it is by far not the only protein involved with carbon cycling in the cell. When sucrose is converted to glucose, fructose is also produced. Sucrose-P synthase (SPS) and sucrose-P phosphatase (SPP) are two enzymes involved in recycling fructose back to sucrose. The complex pathway of carbon allocation to cellulose is reviewed by Delmer and Haigler (2002). KORRIGAN is a β-1,4 glucanase (a cellulase) gene that encodes a protein active in primary and secondary cell walls. The korrigan mutant, irx2 (Sato et al., 2001; Szyjanowicz et al., 2004; Bhandari et al., 2006) in Arabidopsis has a cellulose deficiency. When KORRIGAN expression was compared with secondary cell wall associated CesA gene expression in aspen trees, it was found to be up-regulated in tension wood and down-regulated in opposite wood (tension wood forms at the top side of a bended stem and opposite wood is on the compressed side), similar to the CesA gene expression profiles (Szyjanowicz et al., 2004; Bhandari et al., 2006). Although it is apparent that KORRIGAN plays a role in cellulose synthesis, there is no evidence for a direct interaction of KORRIGAN with the CESA complexes in the cell membrane. Bhandari et al. (2006) hypothesised that KORRIGAN might be necessary for later stages of cellulose production such as editing of the cellulose chains or terminating microfibril synthesis. KORRIGAN has also been implicated in cellulose synthesis in the indirect assembly method discussed in section 1.4.1. When UDP-glucose is first conjugated to a sitosterol primer, KORRIGAN may remove the glucan from the sitosterol-β- 20 LITERATURE REVIEW glucoside allowing the glucan to be incorporated into the glucan chain by cellulose synthases (Peng et al., 2002). KOBITO 1 is a plasma membrane protein associated with cellulose deposition during cell elongation specifically (Pagant et al., 2002). kobito 1 mutants have a dwarfed appearance and randomized microfibrils in elongated cells. The KOBITO 1 gene appears to be only expressed during primary cell wall formation after cell division ceases. The protein has been shown to localise to the cell wall or extracellular matrix (Lertpiriyapong and Sung, 2003). KOBITO 1 was hypothesised to coordinate cellulose synthesis during cell elongation, but the mechanism by which it works has yet to be described (Pagant et al., 2002). CYT1 is an enzyme that catalyzes the production of GDP-mannose required for Nglycosylation and GPI membrane-anchoring. Mutations in the CYT1 gene results in disruption of cytokinesis and failure to synthesise a normal cell wall (Nickle and Meinke, 1998). The cyt1 Arabidopsis mutant plants are five-fold decreased in cellulose content and this is hypothesised to be due to a lack of glycosylation of the CESA proteins, since the mutant phenotype could be mimicked in wild-type plants by tunicamycin, an N-glycosylation inhibitor, treatment (Lukowitz et al., 2001). Considering that CYT 1 is required for GPI membrane-anchoring and that CYT1 could be responsible for the anchoring of COBRA, perhaps some of the reduction in cellulose observed in cyt1 mutants is due to a lack of interaction of cellulose microfibrils and microtubules. THESEUS 1 is a protein described by Hematy et al. (2007). This protein is not directly involved in cellulose biosynthesis, but it appears to play a crucial role when cellulose deposition is altered or inhibited. It is a receptor-like kinase that is only expressed when cellulose synthesis is inhibited. When the THESEUS 1 gene was mutated in a wild-type Arabidopsis background, no phenotypic changes were observed. When THESEUS 1 was mutated in plants already mutated for the AtCesA6 gene, the phenotype of the mutant seemed to be at least partially restored to the wild-type phenotype (Hematy et al. 2007). Over-expression of THESEUS 1 in the Atcesa6 mutant background, resulted in a more severe mutant phenotype. These mutants showed severe ectopic lignification and 21 LITERATURE REVIEW dwarfed phenotypes. The effect of THESEUS 1 was not the same for all cellulose related mutations. Only plants with mutated CesA genes could be partially rescued by mutating THESEUS 1 (Hematy et al., 2007). This raises more interesting questions: Is THESEUS 1 involved in detecting faulty rosette structures? It has been observed that lignin increases when cellulose decreases (Desprez et al., 2002). Is THESEUS 1 responsible for signalling or facilitating an increase in lignin production to compensate for decreased cellulose? Could THESEUS 1 expression be used to evaluate rosette integrity? One way to answer some of these questions would be to study THESEUS 1 expression levels in a CesA mutant that has a mutant CESA protein that still incorporates into the rosette, but does not function correctly. One such mutant is the original irx1 mutant with a point mutation that only affects the catalytic region of the protein (Turner and Somerville, 1997). This mutant has severely reduced cellulose biosynthesis, but the protein is believed to still be incorporated into the cellulose synthase complex. To summarise, three distinctive CESA proteins assemble to form a rosette in the Golgi. The rosettes are transported to the plasma membrane by means of exocytosis. At the plasma membrane the rosettes interact with the microtubules, possibly through the activity of COBRA and AGPs. CYT1 could function in the GPI-anchoring of COBRA or the N-glucosylation of the CESA proteins before the rosette is embedded in the membrane. SUSY converts sucrose to UDP-glucose that is then utilised by the CESA proteins and added to the growing cellulose molecules. KORRIGAN could be involved in subsequent editing of the glucose chains while THESEUS 1 may detect faulty rosette complexes or be involved in signalling that induces lignifications when cellulose deficiencies are detected. The function of KOBITO 1 remains elusive, but as in the case of the CESA proteins, KORRIGAN, COBRA and CYT1, it is necessary for normal deposition of cellulose in Arabidopsis. 22 LITERATURE REVIEW 1.5 Arabidopsis as model for xylogenesis and cellulose biosynthesis Arabidopsis thaliana has proven to be a valuable model for plant biology research. The full genome sequence is available (The Arabidopsis Genome Initiative 2000) (Kaul et al., 2000), over 27 000 annotated genes have been identified as protein coding (Rhee et al., 2003; Swarbreck et al., 2008), complete transcriptome microarray chips are available for gene expression studies and mutant lines are obtainable from several seed stock centres for reverse genetics purposes (Feng and Mundy, 2006). These tools are easily accessible via the on-line Arabidopsis Information Resource, TAIR (TAIR; http://www.arabidopsis.com). Arabidopsis has been extensively used for functional analysis of genes discovered in other plant species. Once a specific gene of interest has been identified in one species, the on-line Arabidopsis sequence resources can be used to identify an Arabidopsis orthologue of the gene. The various seed databases can then be explored to find a plant line with a mutation of the Arabidopsis gene. The mutant phenotype could reveal possible functions of the gene. Mutant complementation can then be used to confirm that the two orthologous genes are functionally identical. For example, the fab1 Arabidopsis mutant (containing a single missense mutation) was functionally complemented by the constitutive expression of KAS2 cDNA from Brassica napus revealing the underlying cause of the mutant phenotype and providing support for the proposed function of KAS2 (Carlsson et al., 2002). This strategy has also been used to identify the function of a gene involved in nitrate uptake. The Nrt2 gene from Nicotiana plumbaginifolia, under the expression control of a double 35S cauliflower mosaic virus (CMV) promoter, was used to complement the corresponding mutant in Arabidopsis (Filleur et al., 2001). The same approach was employed to compare gymnosperm and angiosperm transcription factors involved in ABA responsive gene regulation. The gymnosperm CnAB13 gene was used to transform Arabidopsis abi3-6 mutant plants. Again, the CnABI3 gene was under the expression control of the constitutive 35S CMV promoter. In this study, the gymnosperm gene could restore most of the wild-type phenotypic characteristics in the mutant. The mutant complementation also revealed functional distinctions between the gymnosperm and angiosperm orthologues (Zeng and Kermode, 23 LITERATURE REVIEW 2004). Observed differences in the functions of orthologues can be used to characterise the functions of domains that differ between the orthologues. 1.5.1 Positional and silencing effects on transgene expression Two aspects that need to be considered when studying the effects of a transgene in a model system such as Arabidopsis are positional effects and silencing. Positional effects concern the physical place where the transgene inserts into the genome of the transgenic plant (Francis and Spiker, 2005). It is usually independent of sequence identity. Silencing, on the other hand, is sequence dependent and occurs due to sequence homology between the transgene and endogenous genes or between multiple copies of the transgene (Que et al., 1997). The position within the genome of a transgenic plant where the transgene inserts could affect the expression of the transgene in at least two ways. Firstly, the transgene could insert into a region of heterochromatin. Because of the conformation of chromatin in these regions, the transgene is likely to be inaccessible to transcription factors and other enzymes necessary for transcription. However, the reporter gene within the transgenic construct will also fall within heterochromatin. The reporter gene would not be expressed and could not confer the selectable marker trait for selection of positive transformants. A transgenic plant line that has the transgene inserted into a region of heterochromatin would, therefore, not be identified as transgenic (Francis and Spiker, 2005). The second positional effect concerns positioning of the transgene in cis near a strong enhancer or suppressor thus affecting the level of expression (So et al., 2005). Silencing of transgene expression is triggered by interaction between homologous sequences that are either in cis or trans orientation to the transgene. The interaction could be between the transgene and endogenous gene sequences, between multiple copies of the transgene or between transcripts of the same copy of the transgene (Que et al., 1997). Silencing can occur post- transcriptionally in the cytoplasm, known as post-transcriptional gene silencing (PTGS), when short 24 LITERATURE REVIEW double stranded RNA incorporates into the RNA-induced silencing complex (RISC) and lead to the degradation of homologous transgene mRNA (Baulcombe, 1996; Hammond et al., 2000). Transcriptional gene silencing (TGS) can also affect the expression levels of transgenes. TGS involves a similar process to that of PTGS. Short double stranded RNA can be incorporated into the RNA-induced transcriptional gene-silencing complex (RITS). RITS is hypothesised to attract histones and other DNA modifying enzymes to the site of silencing, which leads to a more condensed form of DNA (Schramke and Allshire, 2003). This form of silencing inhibits mRNA accumulation and transcription of the transgene. The effects of silencing and the position of the transgene within the transgenic plant genome support the use of more than one transgenic plant line during analysis of transgene expression. By examining multiple transgenic lines, it becomes possible to discern between effects attributed to position and silencing and effects observed due to the expression of the transgene. 1.5.2 Secondary growth in Arabidopsis Though there is no denying that Arabidopsis is a useful tool for studying basic plant cell biology, biochemistry and physiology, the question remains whether Arabidopsis, a weed, can function as a model for xylogenesis in woody plants? A comparative genomics study found that 90% of expressed sequence tags obtained from loblolly pine wood forming tissues, have homologues in the Arabidopsis genome (Kirst et al., 2003). This suggests that the processes underlying xylogenesis are conserved in herbaceous and woody plants (Nieminen et al., 2004). Lev-Yadun (1994) first demonstrated that Arabidopsis can be induced to form increased amounts of secondary xylem by enhancing cambial activity. Secondary growth of the Arabidopsis hypocotyl resembles that of woody angiosperms (Chaffey et al., 2002). Induction of secondary growth was accomplished by continuously removing the primary inflorescence (Lev-Yadun, 1997). Other methods to induce secondary growth in Arabidopsis include growing the plants under short-day conditions or under hypergravity stimulus (Lev-Yadun and Flaishman, 2001). It takes Arabidopsis three to four months to develop secondary 25 LITERATURE REVIEW growth tissue under short-day conditions (8 hours light, 16 hours dark). The resulting cell types are similar to that of woody angiosperms, but lack the characteristic radial files of parenchyma cells (rays) found in angiosperm wood (Chaffey et al., 2002). One obvious disadvantage of this induction of secondary growth is that it takes a long time to develop. Ko et al. (2004) proposed a solution to avoid the wound responses from continuous inflorescence removal, but still induce secondary growth in less time than under short-day conditions. This was accomplished by increasing the weight of the stem. It was found that the weight of the plant triggers secondary growth. Hypergravity has the same effect as increased weight and has also been used to induce secondary growth. When Arabidopsis plants were centrifuged at 300 x g, tubulin genes were activated in the hypocotyls. The activation of these genes led to increased amounts of cortical microtubules (Yoshioka et al., 2003). As mentioned in section 1.2.1, these microtubules are involved in cellulose deposition in plant cell walls. Arabidopsis callus cultures were also analysed under 10 x g hypergravity. The result was that starch was no longer synthesised, instead it was degraded. At the same time cell wall modification pathways were switched on (Martzivanou and Hampp, 2003). Mechanoreceptors seem to be important for hypergravity perception. The inhibition of mechanosensitive ion channels by gadolinium ions resulted in the effects of hypergravity being suppressed (Nakabayashi et al., 2006). Arabidopsis can, therefore, be used to study certain aspects of wood development, but its shortcomings include that it cannot be used to investigate perennial growth and seasonal effects. For this scientists will have to rely on studies from the model tree, Populus. Resources like the annotated genome sequence (Tuskan et al., 2006) and a whole genome oligonucleotide microarray are available for poplar and can be accessed via an online resource (http://www.jgi.doe.gov/poplar). 26 LITERATURE REVIEW 1.6 Conclusion Three CESA proteins are believed to incorporate into cellulose synthase rosette complexes. This observation is conserved across plant species including Arabidopsis, Populus and Eucalyptus. One hypothesis that could be proposed in light of this conserved observation is that CesA genes that are homologous based on sequence similarity are also functional homologues. This implies that a CesA gene from one species can functionally complement the orthologue in another. The availability of Arabidopsis irx mutants for all three secondary cell wall associated CesA genes, creates an opportunity to test this hypothesis. Complementation of an irx mutant (E.g. irx1) with the corresponding Eucalyptus CesA gene (EgCesA1) and failure to complement with non-homologous Eucalyptus secondary cell wall CesA genes (EgCesA2 and EgCesA3) would provide strong support for the hypothesis that CesA gene orthologues are functionally conserved across species and co-assemble into heterospecific rosette complexes. Considering that mutations in genes involved in hemicellulose biosynthesis (E.g. IRX8, IRX9, FRA8 and others) and other cell wall molecules (AGPs) result in a change in cellulose content, it is evident that some form of signalling is involved in the regulation of polymer synthesis in cell walls. The trigger for such signalling and which molecules serve as detectors for deviations in normal cell wall biogenesis remain to be identified. A hypothesis can be formulated stating that the constitutive expression of a secondary cell wall associated Eucalyptus CesA gene will affect the expression levels of endogenous cell wall associated genes in wild-type Arabidopsis plants. The presence of high levels of transcripts of one CesA gene could result in increased expression of endogenous CesA genes. Alternatively, the abnormal levels of a CesA gene transcript could lead to reduced transcription of endogenous CesA genes and a reduction in cellulose biosynthesis. If the expression of a transgenic CesA gene increases or decreases endogenous CesA gene expression, it could also affect the expression levels of other genes with cell wall-related functions. By addressing the above mentioned hypotheses, insight could be obtained on the conservation of CesA genes across species. This is an important step in establishing Arabidopsis as a model 27 LITERATURE REVIEW organism in which to study xylogenesis, a complex process that is still poorly understood. By using Arabidopsis, elucidation could be obtained on issues regarding the synthesis and assembly of cell wall polymers and the functions of proteins like KOBITO 1 and THESEUS 1 that play important, but not clearly identified, roles in cell wall biogenesis. It could provide clarity on the exact means by which cell wall polymers interact and how the interactions influence the deposition of cellulose. Clarifying these issues is necessary to find a means to increase and optimise cellulose biosynthesis without disrupting normal plant development. Coleman et al. (2007) have shown that increased carbon allocated to cellulose biosynthesis can increase cellulose content, but it resulted in altered plant growth. This could indicate that multiple pathways involved in cell wall biogenesis need to be altered in order to effectively increase cellulose without impacting general plant growth. Arabidopsis could prove to be an ideal candidate to study the alteration of cell wall biogenesis. The aim of this M.Sc study is to functionally characterize a Eucalyptus CesA gene in Arabidopsis by constitutively expressing EgCesA1 in wild-type Arabidopsis plants, analysing putative changes in cell wall morphology and comparing the gene expression levels of endogenous Arabidopsis genes involved in cell wall biogenesis between wild-type and transgenic plants. This is part of a wider effort to evaluate strategies to alter cellulose biosynthesis in fast growing plantation trees such as Eucalyptus. 1.7 References Aloni, Y., Delmer, D.P., and Benziman, M. (1982). Achievement of high-rates of in vitro synthesis of 1,4-beta-D-glucan - Activation by cooperative interaction of the Acetobacter xylinum enzymesystem with GTP, polyethylene-glycol, and a protein factor. Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 79, 6448-6452. 28 LITERATURE REVIEW Appenzeller, L., Doblin, M., Barreiro, R., Wang, H.Y., Niu, X.M., Kollipara, K., Carrigan, L., Tomes, D., Chapman, M., and Dhugga, K.S. (2004). Cellulose synthesis in maize: Isolation and expression analysis of the cellulose synthase (CesA) gene family. Cellulose 11, 287-299. Arioli, T., Peng, L.C., Betzner, A.S., Burn, J., Wittke, W., Herth, W., Camilleri, C., Hofte, H., Plazinski, J., Birch, R., Cork, A., Glover, J., Redmond, J., and Williamson, R.E. (1998). Molecular analysis of cellulose biosynthesis in Arabidopsis. Science 279, 717-720. Atalla, R.H., and VanderHart, D.L. (1984). Native cellulose: A composite of two distinct crystalline forms. Science 223, 283-285. Baskin, T.I. (2001). On the alignment of cellulose microfibrils by cortical microtubules: A review and a model. Protoplasma 215, 150-171. Baulcombe, D.C. (1996). RNA as a target and an initiator of post-transcriptional gene silencing in trangenic plants. Plant Molecular Biology 32, 79-88. Bhandari, S., Fujino, T., Thammanagowda, S., Zhang, D.Y., Xu, F.Y., and Joshi, C.P. (2006). Xylem-specific and tension stress-responsive co-expression of KORRIGAN endoglucanase and three secondary wall-associated cellulose synthase genes in aspen trees. Planta 224, 828-837. Boerjan, W., Ralph, J., and Baucher, M. (2003). Lignin biosynthesis. In Annual Review of Plant Biology, pp. 519-546. Bonetta, D.T., Facette, M., Raab, T.K., and Somerville, C.R. (2002). Genetic dissection of plant cell-wall biosynthesis. Biochemical Society Transactions 30, 298-301. Boudet, A.M. (2000). Lignins and lignification: Selected issues. Plant Physiology and Biochemistry 38, 81-96. Brown, D.M., Zeef, L.A.H., Ellis, J., Goodacre, R., and Turner, S.R. (2005). Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17, 2281-2295. Brown, D.M., Zhang, Z., Stephens, E., Dupree, P., and Turner, S.R. (2009). Characterization of IRX10 and IRX10-like reveals an essential role in glucuronoxylan biosynthesis in Arabidopsis. Plant Journal 57, 732-746. 29 LITERATURE REVIEW Brown, D.M., Goubet, F., Wong, V.W., Goodacre, R., Stephens, E., Dupree, P., and Turner, S.R. (2007). Comparison of five xylan synthesis mutants reveals new insight into the mechanisms of xylan synthesis. Plant Journal 52, 1154-1168. Brown Jr, R.M., and Montezinos, D. (1976). Cellulose microfibrils: Visualization of biosynthetic and orienting complexes in association with the plasma membrane. Proceedings of the National Academy of Sciences of the United States of America 73, 143-147. Burn, J.E., Hocart, C.H., Birch, R.J., Cork, A.C., and Williamson, R.E. (2002). Functional analysis of the cellulose synthase genes CesA1, CesA2, and CesA3 in Arabidopsis. Plant Physiology 129, 797-807. Burton, R.A., Shirley, N.J., King, B.J., Harvey, A.J., and Fincher, G.B. (2004). The CesA gene family of barley. Quantitative analysis of transcripts reveals two groups of co-expressed genes. Plant Physiology 134, 224-236. Burton, R.A., Wilson, S.M., Hrmova, M., Harvey, A.J., Shirley, N.J., Stone, B.A., Newbigin, E.J., Bacic, A., and Fincher, G.B. (2006). Cellulose synthase-like CslF genes mediate the synthesis of cell wall (1,3;1,4)-beta-D-glucans. Science 311, 1940-1942. Campbell, M.M., and Sederoff, R.R. (1996). Variation in lignin content and composition Mechanism of control and implications for the genetic improvement of plants. Plant Physiology 110, 3-13. Cano-Delgado, A., Penfield, S., Smith, C., Catley, M., and Bevan, M. (2003). Reduced cellulose synthesis invokes lignification and defence responses in Arabidopsis thaliana. Plant Journal 34, 351-362. Carlsson, A.S., LaBrie, S.T., Kinney, A.J., von Wettstein-Knowles, P., and Browse, J. (2002). A KAS2 cDNA complements the phenotypes of the Arabidopsis fab1 mutant that differs in a single residue bordering the substrate binding pocket. Plant Journal 29, 761-770. Carpita, N., Tierney, M., and Campbell, M. (2001). Molecular biology of the plant cell wall: Searching for the genes that define structure, architecture and dynamics. Plant Molecular Biology 47, 1-5. 30 LITERATURE REVIEW Chaffey, N., Cholewa, E., Regan, S., and Sundberg, B. (2002). Secondary xylem development in Arabidopsis: A model for wood formation. Physiologia Plantarum 114, 594-600. Chernova, T.E., and Gorshkova, T.A. (2007). Biogenesis of plant fibers. Russian Journal of Developmental Biology 38, 221-232. Coleman, H.D., Ellis, D.D., Gilbert, M., and Mansfield, S.D. (2006). Up-regulation of sucrose synthase and UDP-glucose pyrophosphorylase impacts plant growth and metabolism. Plant Biotechnology Journal 4, 87-101. Coleman, H.D., Canam, T., Kang, K.Y., Ellis, D.D., and Mansfield, S.D. (2007). Over-expression of UDP-glucose pyrophosphorylase in hybrid poplar affects carbon allocation. Journal of Experimental Botany 58, 4257-4268. Cosgrove, D.J. (2000). Loosening of plant cell walls by expansins. Nature 407, 321-326. Cote Jr, W.A., Day, A.C., and Timell, T.E. (1968). Studies on compression wood - Part VII: Distribution of lignin in normal and compression wood of tamarack. Wood Science and Technology 2, 13-37. Cousins, S.K., and Brown, R.M. (1997). X-ray diffraction and ultrastructural analyses of dye-altered celluloses support van der Waals forces as the initial step in cellulose crystallization. Polymer 38, 897-902. Davis, A.M., Hall, A., Millar, A.J., Darrah, C., and Davis, S.J. (2009). Protocol: Streamlined subprotocols for floral-dip transformation and selection of transformants in Arabidopsis thaliana. Plant Methods 5. Davis, W.E., Barry, A.J., Peterson, F.C., and King, A.J. (1943). X-ray studies of reactions of cellulose in non-aqueous systems II. Interaction of cellulose and primary amines. Journal of the American Chemical Society 65, 1294-1299. Delmer, D.P. (1999). Cellulose biosynthesis: Exciting times for a difficult field of study. Annual Review of Plant Physiology and Plant Molecular Biology 50, 245-276. Delmer, D.P., and Haigler, C.H. (2002). The regulation of metabolic flux to cellulose, a major sink for carbon in plants. Metabolic Engineering 4, 22-28. 31 LITERATURE REVIEW Derbyshire, P., McCann, M.C., and Roberts, K. (2007). Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level. BMC Plant Biology 7. Desprez, T., Vernhettes, S., Fagard, M., Refregier, G., Desnos, T., Aletti, E., Py, N., Pelletier, S., and Hofte, H. (2002). Resistance against herbicide isoxaben and cellulose deficiency caused by distinct mutations in same cellulose synthase isoform CesA6. Plant Physiology 128, 482-490. Desprez, T., Juraniec, M., Crowell, E.F., Jouy, H., Pochylova, Z., Parcy, F., Hofte, H., Gonneau, M., and Vernhettes, S. (2007). Organization of cellulose synthase complexes involved in primary cell wall synthesis in Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America 104, 15572-15577. Dhugga, K.S. (2001). Building the wall: Genes and enzyme complexes for polysaccharide synthases. Current Opinion in Plant Biology 4, 488-493. Dhugga, K.S., Barreiro, R., Whitten, B., Stecca, K., Hazebroek, J., Randhawa, G.S., Dolan, M., Kinney, A.J., Tomes, D., Nichols, S., and Anderson, P. (2004). Guar seed beta-mannan synthase is a member of the cellulose synthase super gene family. Science 303, 363-366. Doblin, M.S., Kurek, I., Jacob-Wilk, D., and Delmer, D.P. (2002). Cellulose biosynthesis in plants: From genes to rosettes. Plant and Cell Physiology 43, 1407-1420. Driouich, A., and Baskin, T.I. (2008). Intercourse between cell wall and cytoplasm exemplified by arabinogalactan proteins and cortical microtubules. American Journal of Botany 95, 1491-1497. Emons, A.M.C., and Mulder, B.M. (2000). How the deposition of cellulose microfibrils builds cell wall architecture. Trends in Plant Science 5, 35-40. Feng, C.P., and Mundy, J. (2006). Gene discovery and functional analyses in the model plant Arabidopsis. Journal of Integrative Plant Biology 48, 5-14. Filleur, S., Dorbe, M.F., Cerezo, M., Orsel, M., Granier, F., Gojon, A., and Daniel-Vedele, F. (2001). An Arabidopsis T-DNA mutant affected in Nrt2 genes is impaired in nitrate uptake. Febs Letters 489, 220-224. Francis, K.E., and Spiker, S. (2005). Identification of Arabidopsis thaliana transformants without selection reveals a high occurrence of silenced T-DNA integrations. Plant Journal 41, 464-477. 32 LITERATURE REVIEW Fry, S., Smith, R., Renwick, K., Martin, D., Hodge, S., and Matthews, K. (1992). Xyloglucan endotransglycosylase, a new wall-loosening enzyme activity from plants. Biochem J 282 ( Pt 3), 821-828. Glaser, L. (1958). Synthesis of cellulose in cell-free extracts of Acetobacter xylinum. Journal of Biological Chemistry 232, 627-636. Gray-Mitsumune, M., Mellerowicz, E.J., Abe, H., Schrader, J., Winzell, A., Sterky, F., Blomqvist, K., McQueen-Mason, S., Teeri, T.T., and Sundberg, B. (2004). Expansins abundant in secondary xylem belong to sub-group a of the alpha-expansin gene family. Plant Physiology 135, 1552-1564. Green, P.B. (1962). Mechanism for plant cellular morphogenesis. Science 138, 1404-&. Haigler, C.H., and Brown, R.M. (1986). Transport of rosettes from the Golgi-apparatus to the plasma membrane in isolated mesophyll cells of Zinnia elegans during differentiation to tracheary elements in suspension-culture. Protoplasma 134, 111-120. Haigler, C.H., Ivanova-Datcheva, M., Hogan, P.S., Salnikov, V.V., Hwang, S., Martin, K., and Delmer, D.P. (2001). Carbon partitioning to cellulose synthesis. Plant Molecular Biology 47, 2951. Hamann, T., Osborne, E., Youngs, H.L., Misson, J., Nussaume, L., and Somerville, C. (2004). Global expression analysis of CesA and Csl genes in Arabidopsis. Cellulose 11, 279-286. Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293-296. Hayashi, T., Marsden, M.P.F., and Delmer, D.P. (1987). Pea xyloglucan and cellulose 5. Xyloglucan-cellulose interactions in vitro and in vivo. Plant Physiology 83, 384-389. Heiner, A.P., Sugiyama, J., and Teleman, O. (1995). Crystalline cellulose I-alpha and I-beta studied by molecular-dynamics simulation. Carbohydrate Research 273, 207-223. Hematy, K., Sado, P.E., Van Tuinen, A., Rochange, S., Desnos, T., Balzergue, S., Pelletier, S., Renou, J.P., and Hofte, H. (2007). A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis. Current Biology 17, 922-931. 33 LITERATURE REVIEW Herth, W. (1983). Arrays of plasma-membrane "rosettes" involved in cellulose microfibril formation of Spirogyra. Planta 159, 347-356. Im, K.H., Cosgrove, D.J., and Jones, A.M. (2000). Subcellular localization of expansin mRNA in xylem cells. Plant Physiol 123, 463-470. Joshi, C.P., Bhandari, S., Ranjan, P., Kalluri, U.C., Liang, X., Fujino, T., and Samuga, A. (2004). Genomics of cellulose biosynthesis in poplars. New Phytologist 164, 53-61. Kaul, S., Koo, H.L., Jenkins, J., Rizzo, M., Rooney, T., Tallon, L.J., Feldblyum, T., Nierman, W., Benito, M.I., Lin, X.Y., Town, C.D., Venter, J.C., Fraser, C.M., Tabata, S., Nakamura, Y., Kaneko, T., Sato, S., Asamizu, E., Kato, T., Kotani, H., Sasamoto, S., Ecker, J.R., Theologis, A., Federspiel, N.A., Palm, C.J., Osborne, B.I., Shinn, P., Conway, A.B., Vysotskaia, V.S., Dewar, K., Conn, L., Lenz, C.A., Kim, C.J., Hansen, N.F., Liu, S.X., Buehler, E., Altafi, H., Sakano, H., Dunn, P., Lam, B., Pham, P.K., Chao, Q.M., Nguyen, M., Yu, G.X., Chen, H.M., Southwick, A., Lee, J.M., Miranda, M., Toriumi, M.J., Davis, R.W., Wambutt, R., Murphy, G., Dusterhoft, A., Stiekema, W., Pohl, T., Entian, K.D., Terryn, N., Volckaert, G., Choisne, N., Rieger, M., Ansorge, W., Unseld, M., Fartmann, B., Valle, G., Artiguenave, F., Weissenbach, J., Quetier, F., Wilson, R.K., De La Bastide, M., Sekhon, M., Huang, E., Spiegel, L., Gnoj, L., Pepin, K., Murray, J., Johnson, D., Habermann, K., Dedhia, N., Parnell, L., Preston, R., Hillier, L., Chen, E., Marra, M., Martienssen, R., Mccombie, W.R., Mayer, K., White, O., Bevan, M., Lemcke, K., Creasy, T.H., Bielke, C., Haas, B., Haase, D., Maiti, R., Rudd, S., Peterson, J., Schoof, H., Frishman, D., Morgenstern, B., Zaccaria, P., Ermolaeva, M., Pertea, M., Quackenbush, J., Volfovsky, N., Wu, D.Y., Lowe, T.M., Salzberg, S.L., Mewes, H.W., Rounsley, S., Bush, D., Subramaniam, S., Levin, I., Norris, S., Schmidt, R., Acarkan, A., Bancroft, I., Quetier, F., Brennicke, A., Eisen, J.A., Bureau, T., Legault, B.A., Le, Q.H., Agrawal, N., Yu, Z., Martienssen, R., Copenhaver, G.P., Luo, S., Pikaard, C.S., Preuss, D., Paulsen, I.T., Sussman, M., Britt, A.B., Eisen, J.A., Selinger, D.A., Pandey, R., Mount, D.W., Chandler, V.L., Jorgensen, R.A., Pikaard, C., Juergens, G., Meyerowitz, E.M., Ecker, J.R., Theologis, A., Dangl, J., Jones, J.D.G., Chen, M., Chory, J., and Somerville, C. 34 LITERATURE REVIEW (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796-815. Kawagoe, Y., and Delmer, D.P. (1997). Pathways and genes involved in cellulose biosynthesis. Genetic engineering 19, 63-87. Kerstens, S., and Verbelen, J.P. (2003). Cellulose orientation at the surface of the Arabidopsis seedling. Implications for the biomechanics in plant development. Journal of Structural Biology 144, 262-270. Kiermayer, O., and Sleytr, U.B. (1979). Hexagonally ordered "rosettes" of particles in the plasma membrane of Micrasterias denticulata BreÌ• b. andtheir significance for microfibril formation and orientation. Protoplasma 101, 133-138. Kirst, M., Johnson, A.F., Baucom, C., Ulrich, E., Hubbard, K., Staggs, R., Paule, C., Retzel, E., Whetten, R., and Sederoff, R. (2003). Apparent homology of expressed genes from woodforming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America 100, 7383-7388. Kolpak, F.J., and Blackwell, J. (1976). Determination of the structure of cellulose II. Macromolecules 9, 273-278. Kozela, C., and Regan, S. (2003). How plants make tubes. Trends in Plant Science 8, 159-164. Kurek, I., Kawagoe, Y., Jacob-Wilk, D., Doblin, M., and Delmer, D. (2002). Dimerization of cotton fiber cellulose synthase catalytic subunits occurs via oxidation of the zinc-binding domains. Proceedings of the National Academy of Sciences of the United States of America 99, 1110911114. Lee, C., O'Neill, M.A., Tsumuraya, Y., Darvill, A.G., and Ye, Z.H. (2007a). The irregular xylem 9 mutant is deficient in xylan xylosyltransferase activity. Plant and Cell Physiology 48, 1624-1634. Lee, C., Zhong, R., Richardson, E.A., Himmelsbach, D.S., McPhail, B.T., and Ye, Z.H. (2007b). The PARVUS gene is expressed in cells undergoing secondary wall thickening and is essential for glucuronoxylan biosynthesis. Plant and Cell Physiology 48, 1659-1672. Lerouxel, O., Cavalier, D.M., Liepman, A.H., and Keegstra, K. (2006). Biosynthesis of plant cell wall polysaccharides - A complex process. Current Opinion in Plant Biology 9, 621-630. 35 LITERATURE REVIEW Lertpiriyapong, K., and Sung, Z.R. (2003). The elongation defective 1 mutant of Arabidopsis is impaired in the gene encoding a serine-rich secreted protein. Plant Molecular Biology 53, 581-595. Lev-Yadun, S. (1994). Induction of sclereid differentiation in the pith of Arabidopsis thaliana (L.) Heynh. Journal of Experimental Botany 45, 1845-1849. Lev-Yadun, S. (1997). Fibres and fibre-sclereids in wild-type Arabidopsis thaliana. Annals of Botany 80, 125-129. Lev-Yadun, S. (2001). Intrusive growth - The plant analog of dendrite and axon growth in animals. New Phytologist 150, 508-512. Lev-Yadun, S., and Flaishman, M.A. (2001). The effect of submergence on ontogeny of cambium and secondary xylem and on fiber lignification in inflorescence stems of Arabidopsis. Iawa Journal 22, 159-169. Li, L.G., Lu, S.F., and Chiang, V. (2006). A genomic and molecular view of wood formation. Critical Reviews in Plant Sciences 25, 215-233. Liepman, A.H., Wilkerson, C.G., and Keegstra, K. (2005). Expression of cellulose synthase-like (Csl) genes in insect cells reveals that CslA family members encode mannan synthases. Proceedings of the National Academy of Sciences of the United States of America 102, 2221-2226. Lukowitz, W., Nickle, T.C., Meinke, D.W., Last, R.L., Conklin, P.L., and Somerville, C.R. (2001). Arabidopsis cyt1 mutants are deficient in a mannose-1-phosphate guanylyltransferase and point to a requirement of N-linked glycosylation for cellulose biosynthesis. Proceedings of the National Academy of Sciences of the United States of America 98, 2262-2267. Madson, M., Dunand, C., Li, X.M., Verma, R., Vanzin, G.F., Calplan, J., Shoue, D.A., Carpita, N.C., and Reiter, W.D. (2003). The MUR3 gene of Arabidopsis encodes a xyloglucan galactosyltransferase that is evolutionarily related to animal exostosins. Plant Cell 15, 1662-1670. Martzivanou, M., and Hampp, R. (2003). Hyper-gravity effects on the Arabidopsis transcriptome. Physiologia Plantarum 118, 221-231. Matthysse, A.G., White, S., and Lightfoot, R. (1995). Genes required for cellulose synthesis in Agrobacterium tumefaciens. Journal of Bacteriology 177, 1069-1075. 36 LITERATURE REVIEW Mauseth, J.D. (1988). Plant Anatomy. (Menlo Park, California: The Benjamin/Cummings Publishing Company, Inc.). McCann, M.C., Wells, B., and Roberts, K. (1990). Direct visualization of cross-links in the primary plant cell wall. Journal of Cell Science 96, 323-334. McQueen-Mason, S.J. (1995). Expansins and cell wall expansion. Journal of Experimental Botany 46, 1639-1650. Micheli, F. (2001). Pectin methylesterases: Cell wall enzymes with important roles in plant physiology. Trends in Plant Science 6, 414-419. Mohnen, D. (2008). Pectin structure and biosynthesis. Current Opinion in Plant Biology 11, 266-277. Mueller, S.C., and Brown, R.M. (1980). Evidence for an intramembrane component associated with a cellulose microfibril-synthesizing complex in higher-plants. Journal of Cell Biology 84, 315-326. Muhlethaler, K. (1967). Ultrastructure and formation of plant cell walls. Annual Review of Plant Physiology 18, 1-24. Mulder, B., Schel, J., and Emons, A.M. (2004). How the geometrical model for plant cell wall formation enables the production of a random texture. Cellulose 11, 395-401. Nakabayashi, I., Karahara, I., Tamaoki, D., Masuda, K., Wakasugi, T., Yamada, K., Soga, K., Hoson, T., and Kamisaka, S. (2006). Hypergravity stimulus enhances primary xylem development and decreases mechanical properties of secondary cell walls in inflorescence stems of Arabidopsis thaliana. Annals of Botany 97, 1083-1090. Nickle, T.C., and Meinke, D.W. (1998). A cytokinesis-defective mutant of Arabidopsis (cyt1) characterized by embryonic lethality, incomplete cell walls, and excessive callose accumulation. Plant Journal 15, 321-332. Nieminen, K.M., Kauppinen, L., and Helariutta, Y. (2004). A weed for wood? Arabidopsis as a genetic model for xylem development. Plant Physiol. 135, 653-659. Nishiyama, Y., Sugiyama, J., Chanzy, H., and Langan, P. (2003). Crystal structure and hydrogen bonding system in cellulose 1 (alpha), from synchrotron X-ray and neutron fiber diffraction. Journal of the American Chemical Society 125, 14300-14306. 37 LITERATURE REVIEW Oda, Y., Mimura, T., and Hasezawa, S. (2005). Regulation of secondary cell wall development by cortical microtubules during tracheary element differentiation in Arabidopsis cell suspensions. Plant Physiology 137, 1027-1036. Ohad, I., Danon, D., and Hestrin, S. (1962). Synthesis of cellulose by Acetobacter xylinum: V. Ultrastructure of polymer. J. Cell Biol. 12, 31-46. Orlean, P., and Menon, A.K. (2007). GPI-anchoring of protein in yeast and mammalian cells, or: How we learned to stop worrying and love glycophospholipids. Journal of Lipid Research 48, 9931011. Pagant, S., Bichet, A., Sugimoto, K., Lerouxel, O., Desprez, T., McCann, M., Lerouge, P., Vernhettes, S., and Hofte, H. (2002). KOBITO 1 encodes a novel plasma membrane protein necessary for normal synthesis of cellulose during cell expansion in Arabidopsis. Plant Cell 14, 2001-2013. Paredez, A.R., Somerville, C.R., and Ehrhardt, D.W. (2006). Visualization of cellulose synthase demonstrates functional association with microtubules. Science 312, 1491-1495. Pear, J.R., Kawagoe, Y., Schreckengost, W.E., Delmer, D.P., and Stalker, D.M. (1996). Higher plants contain homologs of the bacterial celA genes encoding the catalytic subunit of cellulose synthase. Proceedings of the National Academy of Sciences of the United States of America 93, 12637-12642. Pena, M.J., Zhong, R.Q., Zhou, G.K., Richardson, E.A., O'Neill, M.A., Darvill, A.G., York, W.S., and Ye, Z.H. (2007). Arabidopsis irregular xylem 8 and irregular xylem 9: Implications for the complexity of glucuronoxylan biosynthesis. Plant Cell 19, 549-563. Peng, L., Kawagoe, Y., Hogan, P., and Delmer, D. (2002). Sitosterol-β-glucoside as primer for cellulose synthesis in plants. Science 295, 147-150. Persson, S., Wei, H., Milne, J., Page, G.P., and Somerville, C.R. (2005). Identification of genes required for cellulose synthesis by regression analysis of public microarray data sets. Proceedings of the National Academy of Sciences of the United States of America 102, 8633-8638. Persson, S., Paredez, A., Carroll, A., Palsdottir, H., Doblin, M., Poindexter, P., Khitrov, N., Auer, M., and Somerville, C.R. (2007). Genetic evidence for three unique components in primary 38 LITERATURE REVIEW cell-wall cellulose synthase complexes in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 104, 15566-15571. Plomion, C., Leprovost, G., and Stokes, A. (2001). Wood formation in trees. Plant Physiology 127, 1513-1523. Quader, H. (1986). Cellulose microfibril orientation in Oocystis solitaria: Proof that microtubules control the alignment of the terminal complexes. Journal of Cell Science 83, 223-234. Que, Q., Wang, H.Y., English, J.J., and Jorgensen, R.A. (1997). The frequency and degree of cosuppression by sense chalcone synthase transgenes are dependent on transgene promoter strength and are reduced by premature nonsense codons in the transgene coding sequence. Plant Cell 9, 1357-1368. Rajangam, A.S., Kumar, M., Aspeborg, H., Guerriero, G., Arvestad, L., Pansri, P., Brown, C.J.L., Hober, S., Blomqvist, K., Divne, C., Ezcurra, I., Mellerowicz, E., Sundberg, B., Bulone, V., and Teeri, T.T. (2008). MAP20, a microtubule-associated protein in the secondary cell walls of hybrid aspen, is a target of the cellulose synthesis inhibitor 2,6-dichlorobenzonitrile. Plant Physiology 148, 1283-1294. Ranik, M., and Myburg, A.A. (2006). Six new cellulose synthase genes from Eucalyptus are associated with primary and secondary cell wall biosynthesis. Tree Physiology 26, 545–556. Reiter, W.D. (2002). Biosynthesis and properties of the plant cell wall. Current Opinion in Plant Biology 5, 536-542. Rhee, S.Y., Beavis, W., Berardini, T.Z., Chen, G.H., Dixon, D., Doyle, A., Garcia-Hernandez, M., Huala, E., Lander, G., Montoya, M., Miller, N., Mueller, L.A., Mundodi, S., Reiser, L., Tacklind, J., Weems, D.C., Wu, Y.H., Xu, I., Yoo, D., Yoon, J., and Zhang, P.F. (2003). The Arabidopsis Information Resource (TAIR): A model organism database providing a centralized, curated gateway to Arabidopsis biology, research materials and community. Nucleic Acids Research 31, 224-228. Richmond, T.A., and Somerville, C.R. (2000). The cellulose synthase superfamily. Plant Physiology 124, 495-498. 39 LITERATURE REVIEW Sato, S., Kato, T., Kakegawa, K., Ishii, T., Liu, Y.G., Awano, T., Takabe, K., Nishiyama, Y., Kuga, S., Sato, S., Nakamura, Y., Tabata, S., and Shibata, D. (2001). Role of the putative membrane-bound endo-1,4-β-glucanase KORRIGAN in cell elongation and cellulose synthesis in Arabidopsis thaliana. Plant and Cell Physiology 42, 251-263. Saxena, I.M., Lin, F.C., and Brown Jr, R.M. (1990). Cloning and sequencing of the cellulose synthase catalytic subunit gene of Acetobacter xylinum. Plant Molecular Biology 15, 673-683. Schindelman, G., Morikami, A., Jung, J., Baskin, T.I., Carpita, N.C., Derbyshire, P., McCann, M.C., and Benfey, P.N. (2001). COBRA encodes a putative GPI-anchored protein, which is polarly localized and necessary for oriented cell expansion in Arabidopsis. Genes and Development 15, 1115-1127. Schramke, V., and Allshire, R. (2003). Hairpin RNAs and retrotransposon LTRs effect RNAi and chromatin-based gene silencing. Science 301, 1069-1074. So, Y.Y., Bomblies, K., Seung, K.Y., Jung, W.Y., Mi, S.C., Jong, S.L., Weigel, D., and Ji, H.A. (2005). The 35S promoter used in a selectable marker gene of a plant transformation vector affects the expression of the transgene. Planta 221, 523-530. Somerville, C., Bauer, S., Brininstool, G., Facette, M., Hamann, T., Milne, J., Osborne, E., Paredez, A., Persson, S., Raab, T., Vorwerk, S., and Youngs, H. (2004). Toward a systems approach to understanding plant-cell walls. Science 306, 2206-2211. Sterling, J.D., Atmodjo, M.A., Inwood, S.E., Kolli, V.S.K., Quigley, H.F., Hahn, M.G., and Mohnen, D. (2006). Functional identification of an Arabidopsis pectin biosynthetic homogalacturonan galacturonosyltransferase. Proceedings of the National Academy of Sciences of the United States of America 103, 5236-5241. Stewart, C.M. (1966). Excretion and heartwood formation in living trees. Science 153, 1068-1074. Sugiyama, J., Persson, J., and Chanzy, H. (1991). Combined infrared and electron-diffraction study of the polymorphism of native celluloses. Macromolecules 24, 2461-2466. Swarbreck, D., Wilks, C., Lamesch, P., Berardini, T.Z., Garcia-Hernandez, M., Foerster, H., Li, D., Meyer, T., Muller, R., Ploetz, L., Radenbaugh, A., Singh, S., Swing, V., Tissier, C., Zhang, 40 LITERATURE REVIEW P., and Huala, E. (2008). The Arabidopsis Information Resource (TAIR): Gene structure and function annotation. Nucleic Acids Research 36, D1009-D1014. Szyjanowicz, P.M.J., McKinnon, I., Taylor, N.G., Gardiner, J., Jarvis, M.C., and Turner, S.R. (2004). The irregular xylem 2 mutant is an allele of korrigan that affects the secondary cell wall of Arabidopsis thaliana. Plant Journal 37, 730-740. Tanaka, K., Murata, K., Yamazaki, M., Onosato, K., Miyao, A., and Hirochika, H. (2003). Three distinct rice cellulose synthase catalytic subunit genes required for cellulose synthesis in the secondary wall. Plant Physiology 133, 73-83. Taylor, N.G., Howells, R.M., Huttly, A.K., Vickers, K., and Turner, S.R. (2003). Interactions among three distinct CESA proteins essential for cellulose synthesis. Proceedings of the National Academy of Sciences of the United States of America 100, 1450-1455. Timmers, J., Vernhettes, S., Desprez, T., Vincken, J.P., Visser, R.G.F., and Trindade, L.M. (2009). Interactions between membrane-bound cellulose synthases involved in the synthesis of the secondary cell wall. FEBS Letters 583, 978-982. Turner, S.R., and Somerville, C.R. (1997). Collapsed xylem phenotype of Arabidopsis identifies mutants deficient in cellulose deposition in the secondary cell wall. Plant Cell 9, 689-701. Tuskan, G.A., DiFazio, S., Jansson, S., Bohlmann, J., Grigoriev, I., Hellsten, U., Putnam, N., Ralph, S., Rombauts, S., Salamov, A., Schein, J., Sterck, L., Aerts, A., Bhalerao, R.R., Bhalerao, R.P., Blaudez, D., Boerjan, W., Brun, A., Brunner, A., Busov, V., Campbell, M., Carlson, J., Chalot, M., Chapman, J., Chen, G.L., Cooper, D., Coutinho, P.M., Couturier, J., Covert, S., Cronk, Q., Cunningham, R., Davis, J., Degroeve, S., Dejardin, A., Depamphilis, C., Detter, J., Dirks, B., Dubchak, I., Duplessis, S., Ehlting, J., Ellis, B., Gendler, K., Goodstein, D., Gribskov, M., Grimwood, J., Groover, A., Gunter, L., Hamberger, B., Heinze, B., Helariutta, Y., Henrissat, B., Holligan, D., Holt, R., Huang, W., Islam-Faridi, N., Jones, S., Jones-Rhoades, M., Jorgensen, R., Joshi, C., Kangasjarvi, J., Karlsson, J., Kelleher, C., Kirkpatrick, R., Kirst, M., Kohler, A., Kalluri, U., Larimer, F., Leebens-Mack, J., Leple, J.C., Locascio, P., Lou, Y., Lucas, S., Martin, F., Montanini, B., Napoli, C., Nelson, D.R., Nelson, C., Nieminen, K., Nilsson, O., Pereda, V., Peter, G., Philippe, R., Pilate, G., Poliakov, 41 LITERATURE REVIEW A., Razumovskaya, J., Richardson, P., Rinaldi, C., Ritland, K., Rouze, P., Ryaboy, D., Schmutz, J., Schrader, J., Segerman, B., Shin, H., Siddiqui, A., Sterky, F., Terry, A., Tsai, C.J., Uberbacher, E., Unneberg, P., Vahala, J., Wall, K., Wessler, S., Yang, G., Yin, T., Douglas, C., Marra, M., Sandberg, G., Van de Peer, Y., and Rokhsar, D. (2006). The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313, 1596-1604. Vanzin, G.F., Madson, M., Carpita, N.C., Raikhel, N.V., Keegstra, K., and Reiter, W.D. (2002). The mur2 mutant of Arabidopsis thaliana lacks fucosylated xyloglucan because of a lesion in fucosyltransferase AtFUT1. Proceedings of the National Academy of Sciences of the United States of America 99, 3340-3345. Vergara, C.E., and Carpita, N.C. (2001). Beta-D-glycan synthases and the CesA gene family: Lessons to be learned from the mixed-linkage (1-3),(1-4) beta-D-glucan synthase. Plant Molecular Biology 47, 145-160. Wakabayashi, K., Soga, K., Kamisaka, S., and Hoson, T. (2005). Increase in the level of arabinoxylan-hydroxycinnamate network in cell walls of wheat coleoptiles grown under continuous hypergravity conditions. Physiologia Plantarum 125, 127-134. Wasteneys, G.O., and Fujita, M. (2006). Establishing and maintaining axial growth: Wall mechanical properties and the cytoskeleton. Journal of Plant Research 119, 5-10. Williamson, R.E., Burn, J.E., and Hocart, C.H. (2001). Cellulose synthesis: Mutational analysis and genomic perspectives using Arabidopsis thaliana. Cellular and Molecular Life Sciences 58, 14751490. Williamson, R.E., Burn, J.E., and Hocart, C.H. (2002). Towards the mechanism of cellulose synthesis. Trends in Plant Science 7, 461-467. Winter, H., Huber, J.L., and Huber, S.C. (1997). Membrane association of sucrose synthase: Changes during the graviresponse and possible control by protein phosphorylation. Febs Letters 420, 151-155. Yoshioka, R., Soga, K., Wakabayashi, K., Takeba, G., and Hoson, T. (2003). Hypergravityinduced changes in gene expression in Arabidopsis hypocotyls. In Space Life Sciences: GravityRelated Processes in Plants, pp. 2187-2193. 42 LITERATURE REVIEW Zeng, Y., and Kermode, A. (2004). A gymnosperm ABI3 gene functions in a severe abscisic acidinsensitive mutant of Arabidopsis (abi3-6) to restore the wild-type phenotype and demonstrates a strong synergistic effect with sugar in the inhibition of post-germinative growth. Plant Molecular Biology 56, 731-746. Zhong, R., Burk, D.H., Morrison Iii, W.H., and Ye, Z.H. (2002). A kinesin-like protein is essential for oriented deposition of cellulose microfibrils and cell wall strength. Plant Cell 14, 3101-3117. Zhong, R., Peña, M.J., Zhou, G.K., Nairn, C.J., Wood-Jones, A., Richardson, E.A., Morrison Iii, W.H., Darvill, A.G., York, W.S., and Ye, Z.H. (2005). Arabidopsis FRAGILE FIBRE 8, which encodes a putative glucuronyltransferase, is essential for normal secondary wall synthesis. Plant Cell 17, 3390-3406. Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology 136, 2621-2632. 43 CHAPTER 2 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Marja M. O’Neill1, Shawn D. Mansfield2, Sanushka Naidoo1 and Alexander A. Myburg1 1 Department of Genetics, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria, 0002, South Africa 2 Department of Wood Science, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada This chapter has been prepared in the format of a manuscript for a peer-reviewed research journal, as is the standard procedure of our research group. Cell wall chemistry was determined at the University of British Columbia, Vancouver, Canada by Prof. S.D. Mansfield. I performed all other laboratory work and all analyses. Prof. A.A. Myburg provided funding, facilities and infrastructure at the University of Pretoria, Pretoria, South Africa. I wrote the manuscript with extensive suggestions on organization and content from Dr. S. Naidoo and Prof. A.A. Myburg. CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA 2.1 Abstract Cellulose biosynthesis occurs through the activity of membrane-embedded cellulose synthase (CESA) protein complexes in plants. Cellulose synthase (CesA) genes encode the proteins that interact to form these rosette-shaped complexes. CesA genes have been discovered in many plant species, including Arabidopsis thaliana, Populus trichocarpa and Eucalyptus grandis. However, the organization and means of interactions of CESA proteins in rosette complexes are still unknown. Better understanding of the assembly of CESA protein complexes is required to enable manipulation of cellulose biosynthesis in commercially important crops like Eucalyptus tree species. Difficulty with functional genetic analysis of genes in trees has lead to the use of Arabidopsis as a model to study gene expression in fibre cells. The aim of this study was to functionally characterise the Eucalyptus CesA gene, EgCesA1, in wild-type Arabidopsis plants. Constitutive expression of EgCesA1 was achieved through a Gateway®-enabled vector transformed into wild-type Arabidopsis Col-0 plants using the floral dip method. Phenotypic comparisons were made between plant cell walls of transgenic and wild-type plants. Chemical composition of the plant cell walls were also compared between wild-type and transgenic plants. Quantitative comparisons between expression levels of endogenous genes involved in cellulose biosynthesis in wild-type and transgenic lines were performed, based on quantitative real-time PCR analysis. EgCesA1 expression did not have a significant effect on cell wall morphology, despite some changes observed in the chemistry of cell walls. No consistent parallel could be drawn between EgCesA1 expression levels and relative expression levels of endogenous Arabidopsis genes. This research suggests that it may not be sufficient or possible to alter cellulose biosynthesis in Arabidopsis by heterologous expression of a single CesA gene of Eucalyptus. 2.2 Introduction Cellulose is the most important polymer in the paper and pulp industry. Manipulation of cellulose biosynthesis in commercially important trees like Eucalyptus spp., holds lucrative rewards for the 45 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA industry. This, however, requires a more comprehensive understanding of the biosynthesis of cellulose and the genes that underlie it. Most of the cellulose in wood occurs in fibre secondary cell walls together with lignin and hemicellulose. In plants it is biosynthesised by plasma membraneembedded rosette-shaped cellulose synthase (CESA) protein complexes proposed to consist of six subunits, each in turn, comprised of six CESA proteins (Mueller and Brown, 1980). Phenotypic analysis of Arabidopsis plants with mutated CesA genes (Turner and Somerville, 1997; Arioli et al., 1998; Dhugga, 2001; Burn et al., 2002; Desprez et al., 2002; Taylor et al., 2003) revealed that three different CESA proteins assemble to form rosette complexes involved in primary cell wall deposition and three other CESA proteins are required for secondary cell wall formation. It was recently suggested that the secondary cell wall associated CESA proteins form homodimers before rosette complexes assemble (Atanassov et al., 2009), but a subsequent study revealed that only one of the CESA proteins form homodimers in vitro (Timmers et al., 2009). The organization of CESA proteins within rosettes therefore remains unknown. The rosette complexes utilize UDP-glucose monomers from the cytoplasm to polymerize growing β-1,4-glucan chains that coalesce and crystallize to form cellulose microfibrils (Perrin, 2001). Other factors that influence cellulose biosynthesis include the availability of glucose monomers in the cytoplasm and interaction of rosette complexes or cellulose microfibrils with cortical microtubules that orientate cellulose deposition (Quader, 1986). Sucrose synthase (SUSY) is an enzyme that allocates carbon resources within the cell towards cellulose production by converting sucrose to UDP-glucose and fructose (Winter et al., 1997; Haigler et al., 2001). Manipulation of SuSy gene expression has been shown to influence plant growth (Coleman et al., 2006) possibly through increased availability of glucose for cell wall polymer synthesis. Sucrose-phosphate phosphatase (SPP) and Sucrose-phosphate synthase (SPS) are enzymes involved in recycling glucose from fructose and may also influence the availability of glucose monomers for cell wall polymer biosynthesis (Delmer and Haigler, 2002). Cortical microtubules are believed to guide the orientation of cellulose deposition (Green, 1962; Quader, 1986; Oda et al., 2005; Paredez et al., 2008). It has been proposed that cell wall anchored arabinogalactan proteins (AGPs) are involved in the interaction 46 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA between microtubules and cellulose microfibrils (Driouich and Baskin, 2008) through the activity of another protein, COBRA (Wakabayashi et al., 2005; Driouich and Baskin, 2008). The molecular action of COBRA has yet to be characterized. Many other proteins have been shown to influence cellulose biosynthesis based on the phenotypes of mutant plants. KORRIGAN is a β-1,4 glucanase that is possibly involved in editing of the glucan chains before crystallization of the cellulose microfibril (Szyjanowicz et al., 2004; Bhandari et al., 2006). KOBITO 1 is a plasma membrane protein involved in cellulose deposition during cell elongation, with an unknown functional mechanism (Pagant et al., 2002) and CYTOKINESIS DEFECTIVE 1 (CYT1) is believed to be required for N-glycosylation of CESA proteins before rosette complexes assemble in the Golgi-apparatus (Nickle and Meinke, 1998; Lukowitz et al., 2001). There remains much to be learned about cellulose biosynthesis, including the means of interaction of CESA proteins within rosettes, involvement of non-cellulose synthase proteins in cellulose deposition, factors that influence carbon availability for cellulose biosynthesis and the effect of increased cellulose biosynthesis on other cell wall polymers like lignin and hemicellulose. Clarifying these issues in commercially important tree species can prove to be problematic due to the long generation times of trees and difficulty to transform trees. Although Arabidopsis is a herbaceous plant, it has been shown to undergo secondary growth under certain conditions (Lev-Yadun, 1997). The availability of Arabidopsis plants with mutated CesA genes, access to the full genome sequence (The Arabidopsis Genome Initiative 2000) and ease of transformation makes Arabidopsis a good model system in which to study the biosynthesis of cellulose. Transgenic studies in Arabidopsis is further simplified by the availability of Gateway®-compatible vectors for transgene expression analysis in plants (Curtis and Grossniklaus, 2003). Gateway® technology (Invitrogen, Carisbad, California, USA) eliminates the time-consuming processes of restriction enzyme digestion and ligation during vector construction (Walhout et al., 2000; Hartley, 2003). 47 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA The aim of this study was to functionally characterise a Eucalyptus CesA gene, EgCesA1, in wild-type Arabidopsis plants. EgCESA1 is one of the three CESA proteins that synthesise cellulose in secondary cell walls of xylem tissues in Eucalyptus trees (Ranik and Myburg, 2006). To determine if expression of EgCesA1 in Arabidopsis influences cellulose biosynthesis, secondary cell wall morphology is analysed and inflorescence cell wall chemical composition is determined. Quantitative real-time PCR is performed to assess putative effects of EgCesA1 expression on relative expression levels of endogenous genes involved in cell wall related biosynthetic pathways. 2.3 Materials and Methods 2.3.1 Biological material and growth conditions Arabidopsis thaliana L. Heynh. ecotype Columbia (Col-0, Nottingham Arabidopsis Stock Centre) seeds were surface sterilized in 70% ethanol for five minutes followed by incubation in 10% (v/v) bleach solution containing 0.1% (v/v) TritonX for 15 minutes. The seeds were washed with sterile distilled water before being re-suspended in 0.1% (w/v) agar and spread out on a 90 mm Petri dish containing 0.8% (w/v) agar and 1 mM KNO3. The seeds were incubated at 4°C for two days to break dormancy before the seeds were germinated at 22°C under a 16/8 hour day/night cycle of 16 hour light (1000 lum/sqf) and 8 hour dark (2 lum/sqf) with relative humidity of 25 % in the light and 45 % in the dark period for one to two weeks. Thereafter, the seedlings were transferred to soil medium (Jiffy® Products International AS, Stange, Norway) and grown at 22°C and a 16 hour photoperiod to induce flowering. Plants were grown in a controlled environment under the same conditions mentioned above for six weeks for stem harvesting. Two Escherichia coli cell lines were used during vector construction. DB3.1 was used to propagate the empty destination vector, pMDC32 (Curtis and Grossniklaus, 2003), while recombinant entry and destination vectors were transferred into One Shot® chemically competent E.coli TOP10 cells (Invitrogen, Carisbad, California, USA). E.coli cell lines were cultured at 37°C for 16 hours in 48 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA yeast extract peptone (YEP) medium consisting of 1% yeast extract, 1% bacto-peptone and 0.5% (w/v) sodium chloride (Sigma, St. Louis, Missouri, USA). For propagation of pMDC32 in DB3.1 cells, 20 μg/ml chloramphenicol and 50 μg/ml kanamycin were added to the YEP medium. Propagation of the recombinant entry vector in TOP10 cells (Invitrogen) required the addition of 100 μg/ml spectinomycin to the YEP medium. 50 μg/ml kanamycin was added to the medium for propagation of the recombinant destination vector. Agrobacterium tumefaciens strain LBA4404 was cultured at 28°C in YEP medium, containing 50 μg/ml rifampicin and 30 μg/ml streptomycin for two days in preparation for transformation with the recombinant destination vector. For Arabidopsis transformation, clones containing the recombinant destination vector were propagated in the same medium with 50 μg/ml kanamycin added. 2.3.2 Vector construction Cloning of the EgCesA1 coding sequence into the entry vector Gateway® enabled vectors (Curtis and Grossniklaus, 2003) were used to construct the binary vector containing the EgCesA1 gene. RNA was extracted and used to synthesise cDNA from Eucalyptus grandis xylem (Ranik and Myburg, 2006). The full-length EgCesA1 coding sequence (CDS), (Ranik and Myburg, 2006) was amplified from the xylem cDNA using EgCesA_gb_5'UTR+28 and EgCesA_3'UTR-120 as forward and reverse PCR primers, respectively (Table 2.1). The primers flank the CDS of EgCesA1 (Figure S2.1). PCR conditions were: one cycle of denaturation for one minute at 94°C, 25 cycles of denaturation for 30 seconds at 94°C, annealing for 30 seconds at 55°C and elongation for three minutes at 72°C and a final cycle of elongation for 15 minutes at 72°C. All PCR and RT-PCR were carried out in a BioRad iCycler thermocycler (Bio-Rad, Hercules, California, USA). The EgCesA1 CDS PCR product was purified using the PCR Purification Kit (Qiagen, Hilden, Germany) and cloned into the pCR®8/GW/TOPO® TA Cloning® (Invitrogen) entry vector according to the manufacturer’s instructions. The resulting pTOPO-EgCesA1 vector (Figure S2.1) was 49 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA transformed into One Shot® chemically competent E.coli TOP10 cells (Invitrogen), according to manufacturer’s guidelines. Positive colonies were picked for colony PCR to confirm that the EgCesA1 CDS was cloned and to determine the orientation of the cloned fragment. A vector-specific M13-29-F primer (Figure S2.1) in combination with the gene-specific EgCesA_3'UTR-120 primer was used to determine the fragment’s orientation. PCR conditions were: denaturation at 94°C for two minutes followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds and elongation at 72°C for three minutes. A final elongation step at 72°C for five minutes was also included. Both fragments of the full-length EgCesA1 CDS fragments were then sequenced from four clones to determine if any base pair changes occurred during PCR amplification and cloning. Primers used for the sequencing reaction are listed in Table 2.1. Recombinant pTOPO-EgCesA1 plasmid DNA was extracted from One Shot® cells using the GeneJET™ Plasmid Miniprep Kit (Fermentas, Ontario, Canada) as described by the manufacturer. The purified plasmid DNA was used as template for DNA sequencing (Macrogen, Rockville, Maryland, USA). All DNA sequences were analysed using Vector NTI Advance™ 9.1 software (Invitrogen). Table 2.1 Oligonucleotide primers used for vector construction, DNA sequencing and RNA analysis Primer name Primer sequence (5’→3’) EgCesA_gb_5’UTR+281,2 CTCATTGGGTCGCGAGAAGAT 1,2 EgCesA_3'UTR-120 CAACACTGGCGCAATTCAAC 1,2 M13-29-F CACGACGTTGTAAAACGAC M13-narrow-R1,2 GGAAACAGCTATGACCATG 1 M13-40-F GTTTTCCCAGTCACGAC M13-wide-R1 GGATAACAATTTCACACAGG 1,2 EgCesA1_seq_F GGTGCTGCGATGCTCTCATT EgCesA1_seq_R1,2 GTGTGGCTGCTGCTCTTGTT UBQ10-F ATTCTCAAAATCTTAAAAACTT UBQ10-R TGATAGTTTTCCCAGTCAAC DNA-QC-F GTCAATCTTGGCCATGGACT DNA-QC-R GGTGGTCCTTGGTGTTGTTC 1. Primer positions are given in Figure S2.1 and Figure S2.2. 2. Primers used for sequencing. 50 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Transferring EgCesA1 to the destination vector The EgCesA1 CDS was transferred into the pMDC32 (Curtis and Grossniklaus, 2003) destination vector (Figure S2.2) using the Gateway® LR Clonase™ II Enzyme Mix (Invitrogen). The LR cloning reaction is illustrated in Figure 2.1. The LR Clonase™ II reaction was transformed into chemically competent TOP10 One Shot® cells (Invitrogen). Orientation of the EgCesA1 CDS in pMDC32 was determined by colony PCR (PCR cycle and conditions as described previously) using a vectorspecific M13-40-F primer and gene-specific EgCesA_3'UTR-120 primer. The entire cloned coding sequence was analysed in four clones as described above to confirm that no base pair changes occurred during cloning (results not shown). The pMDC32-EgCesA1 recombinant plasmid DNA was extracted from E.coli as described above and transformed into competent Agrobacterium tumefaciens cells. Figure 2.1 Schematic representation of the LR cloning reaction. The diagram illustrates the expression cassette of pMDC32 before and after LR recombination and the region between the attL and attP sites of the pTOPO-EgCesA1 vector (Figure S2.1). Positive recombinants were selected based on resistance to kanamycin, since cells transformed with non-recombinant pMDC32 plasmid DNA would die due to the expression of the ccdB gene and cells that do not contain recombinant or non-recombinant pMDC32 plasmid DNA would not be resistant to kanamycin (Figure S2.2). 51 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA 2.3.3 Transformation of competent Agrobacterium tumefaciens cells Competent Agrobacterium tumefaciens LBA4404 cells were prepared by first inoculating 5 ml YEP medium containing 50 μg/ml rifampicin and 30 μg/ml streptomycin with LBA4404 cells. This was incubated until the mid-log phase at 28°C for two days. A larger volume (50 ml) YEP containing the same antibiotics was inoculated with 2 ml of the 5 ml culture and incubated at 28°C for two to three days with shaking at 200 rpm. The culture was then centrifuged for 15 minutes at 3000 x g and the pellet resuspended in 1 ml ice-cold CaCl2. The solution was aliquoted in 100 μl volumes and rapidly frozen in liquid nitrogen. To transform Agrobacterium tumefaciens with the recombinant pMDC32-EgCesA1 vector, 3 μg of vector DNA was pipetted onto 100 μl of frozen competent LBA4404 cells. The mixture was exposed to a heat shock at 37°C for five minutes and transferred back to ice before 900 μl of YEP (containing 50 μg/ml rifampicin and 30 μg/ml streptomycin) was added. The culture was incubated at 28°C with shaking at 200 rpm for four hours. Thereafter the culture was centrifuged at 12 000 x g for one minute and the resulting pellet was resuspended in 50 μl YEP medium. The resuspended cells were streaked out on 0.8% (w/v) agar-YEP plates containing 50 μg/ml rifampicin, 30 μg/ml streptomycin and 50 μg/ml kanamycin. The plates were incubated at 28°C for three days. Colony PCR (cycles and conditions described in section 2.3.2) with gene and vector-specific primers, EgCesA_3'UTR-120 and M13-40-F, was used to confirm that positive Agrobacterium colonies were transformed with pMDC32-EgCesA1. 2.3.4 Transformation of Arabidopsis thaliana plants To prepare the transformation culture, one colony of Agrobacterium containing pMDC32-EgCesA1 was used to inoculate 5 ml of YEP medium containing rifampicin (50 μg/ml), streptomycin (30 μg/ml) and kanamycin (50 μg/ml). The medium was incubated at 28°C for two days until mid-log phase was reached. Two millilitres of the culture was used to inoculate a larger volume of 200 ml 52 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA YEP containing the same antibiotics and the larger volume was incubated for two days before it was centrifuged at 2 300 g for five minutes. The resulting pellet was resuspended in 5 ml 5% (w/v) sucrose solution. The resuspended culture was then adjusted to OD600 of 0.8 to 1.0 with 5% (w/v) sucrose. The surfactant, Silwett L-77 (LETHEL, Round Rock, Texas, USA), was added to the transformation culture to a concentration of 0.5% (v/v). The floral dip method described by Clough and Bent (1998) was used to transform wild-type Arabidopsis thaliana Col-0 plants. Primary inflorescence stems of two-week-old plants were cut at the base to induce the development of secondary inflorescence stems. The plants were ready for transformation when several immature flowers were visible and few fertilized siliques could be seen. The Jiffy® peat soil pots in which the plants were growing were thoroughly hydrated one day before transformation. The transformation medium described above was prepared on the day of transformation. As described in the floral dip method, the inflorescence stems of the plants were immersed in the transformation medium for approximately 30 seconds with gentle agitation. The excess medium was shaken off the stems, the plants were laid horizontally and the tray containing the plants was covered overnight. The following day the plants were placed upright again. The floral dip procedure was repeated after one week. The plants were grown until T1 seeds could be harvested. 2.3.5 Selective screening of transgenic Arabidopsis plants T1 seed harvested and dried for one week at room temperature were selected on 0.8% (w/v) agar plates containing 1 mM KNO3 and 20 µg/ml hygromycin B. The seed were surface sterilized and dispersed on the agar plates as described in section 2.3.1. Hygromycin B resistant seedlings (all viable seeds germinated, but only resistant plants rooted and grew taller than the non-resistant germinated plants) were transferred to hydrated Jiffy® pots after five days. The seedlings were allowed to self-pollinate and T2 seed were collected and selected in the same way as T1 seed. 53 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA 2.3.6 PCR analysis of transgenic plants Genomic DNA was extracted from antibiotic resistant T1 plants using the NucleoSpin III Plant DNA Extraction Kit (Machery-Nagel, Düren, Germany) following the manufacturer’s instructions. PCR was performed using the EgCesA_gb_5’UTR+28 (1 μM) and EgCesA_3'UTR-120 (1 μM) primers, 1 x PCR buffer, 0.20 mM dNTPs and 0.2 U Excel Taq DNA polymerase. The PCR had an initial denaturation step of 94°C for one minute followed by 35 cycles of denaturation for 20 seconds at 94°C, annealing for 20 seconds at 55°C and elongation for three minutes at 72°C. A final elongation step of 10 minutes at 72°C was performed. 2.3.7 Reverse transcription PCR analysis Four six-week-old plants of wild-type Arabidopsis Col-0 and four of each of the three transgenic T3 lines were used to prepare samples for RT-PCR (Figure 2.2 B). Total RNA was isolated from upper stems, lower stems and leaves (Figure 2.2 A) using the Concert™ Plant RNA Reagent (Invitrogen) following the manufacturer’s guidelines. All isolations were done in duplicate to generate two biological replicates (Table 2.2). Tissues were collected and immediately ground to a powder in liquid nitrogen using a cold pestle and mortar before cold Plant RNA Reagent was added. The total RNA samples were treated with RNase-free DNaseI (Roche, Basel, Switzerland) to remove genomic DNA. One to two units of DNaseI, 20 U of RNasin RNase inhibitor (Promega, Madison, Wisconsin, USA), 5 μl reaction buffer (Promega) and 5 μg of RNA sample were mixed and incubated at 37°C for 30 minutes. The DNaseI digested samples were further purified using the RNeasy Plant Mini Kit (Qiagen) according to the instructions of the manufacturer. First-strand cDNA was synthesised from each total RNA sample using Improm-II™ Reverse Transcriptase (Invitrogen) according to the manufacturer’s instructions. The samples were tested for genomic DNA contamination using the primer pair, UBQ10-F and UBQ10-R (Table 2.1), that flanks the first intron of the UBIQUITIN 10 (UBQ10) gene. PCR amplification of an 850 bp fragment indicated the presence of genomic DNA 54 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA and amplification of a 545 bp fragment indicated the presence of cDNA. The PCR reaction conditions included an initial denaturation step at 94°C for one minute followed by 30 cycles of denaturation for 30 seconds at 94°C, primer annealing for 30 seconds at 55°C and elongation for one minute at 72°C. A final elongation step of five minutes at 72°C was also performed. If any genomic DNA was detected, digestion with DNaseI was repeated followed by first-strand cDNA synthesis. The cDNA was diluted 1:10 before RT-PCR and qRT-PCR was carried out. RT-PCR was carried out in a BioRad iCycler thermocycler (Bio-Rad) using EgCesA_gb_5'UTR+28 and EgCesA_3'UTR-120 primers (Table 2.1) to amplify the full-length EgCesA1 gene transcript from cDNA. The PCR conditions included a two-minute denaturation step at 94°C followed by 30 cycles of denaturation for 30 seconds at 94°C, annealing for 30 seconds at 55°C and elongation for three minutes at 72°C. This was followed by a final elongation step of five minutes at 72°C. Figure 2.2 Illustration of tissues sampled for RT-PCR and qRT-PCR. A. The upper stem tissues were taken from above the lowest leaf on the inflorescence stem to just below the first flower. Lower stem tissues were from below the first leaf on the inflorescence stem to just above the rosette. Leaves were taken from the rosettes. A diagram illustrating the biological repeats of the transgenic and wild-type lines are given in B. MO1, MO2 and MO3 are T3 transgenic lines. Tissues (leaves, upper stems and lower stems, respectively) from four plants were combined to form one biological repeat. Two biological repeats were prepared per line. 55 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Table 2.2 RNA samples obtained from transgenic and wild-type plants Sample number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Biological replicate name MO1 A MO1 A MO1 A MO1 B MO1 B MO1 B MO2 A MO2 A MO2 A MO2 B MO2 B MO2 B MO3 A MO3 A MO3 A MO3 B MO3 B MO3 B WT A WT A WT A WT B WT B WT B Tissue Upper stem Lower stem Leaves Upper stem Lower stem Leaves Upper stem Lower stem Leaves Upper stem Lower stem Leaves Upper stem Lower stem Leaves Upper stem Lower stem Leaves Upper stem Lower stem Leaves Upper stem Lower stem Leaves 2.3.8 Microscope analysis of cell wall phenotype The cell wall phenotype of transgenic and wild-type Arabidopsis Col-0 plant stems were compared using a light microscope (Axon, Sunnyvale, California, USA). The inflorescence stems of the plants were removed repeatedly to induce the development of more stems until the plants were five weeks old. New inflorescence stems were then collected and sectioned transversely to 11 μm thickness using a Leica micro-cryotome (model CM1100, Leica, Nussloch, Germany). The sections were then stained to visualise lignified cell walls using phloroglucinol-HCl (Speer, 1987), or to visualise cellulose and lignin using toluidine blue (Turner and Somerville, 1997). For phloroglucinol-HCl staining, the sections were immersed in 1% phloroglucinol (Sigma) (w/v) in 92% ethanol solution followed by immediate immersion in 25% hydrochloric acid. A cover slide was placed over the 56 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA section and the section was viewed directly after staining. For toluidine blue staining, the sections were immersed in a drop of toluidine blue (Sigma) followed by a brief wash step with a drop of distilled water before a cover slide was placed over it. 2.3.9 Cell wall chemistry analysis of Arabidopsis stems A modified micro-Klason analysis (Huntley et al., 2003) was used to analyse the chemical composition of the stems from transformed and wild-type Arabidopsis plants. Stems from six-weekold T3 plants were bulked and dried. Approximately 0.1 gram dry stems were ground to pass a 40mesh screen using a Wiley mill. The tissue was soxhlet-extracted with acetone for six hours and digested with 72% H2SO4 for two hours. The extracted tissue was further hydrolysed in 4% H2SO4 for one hour at 121°C in an autoclave. The total weight of non-hydrolysed, extracted components was gravimetrically determined (this represented the acid-insoluble lignin component), while the filtrate was analysed for acid-soluble lignin by measuring absorbance at 205 nm according to TAPPI Useful Method UM 250 (TAPPI, South Norcross, Georgia, USA). The composition of the carbohydrates in the filtrates, expressed in the anhydro-form, was determined by high performance anion-exchange chromatography on a CarboPac PA-1 column using a Dionex High Pressure Liquid Chromatography (HPLC) system (Dionex, Sunnyvale, CA, USA) equipped with a pulsed amperometric detector. Carbohydrates were expressed as a percentage of the dry weight of the sample. Volumes were scaled to accommodate 20 mg of starting material. The analysis were performed twice for each bulked sample to give an indication of technical variation. 2.3.10 Quantitative real-time PCR analysis Sample preparation for quantitative real-time PCR was performed as described previously (Section 2.3.7). The optimal cDNA concentration was determined for each sample by performing a PCR using a serial dilution of each cDNA sample. All samples were subsequently diluted 1:10. 57 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA qRT-PCR was performed using the LightCycler® 480 Real-Time PCR System (Roche Diagnostics, GmbH, Basel, Switzerland). One microlitre of 1:10 diluted cDNA was used in each 11μl PCR reaction with 5 μl of 2 x LightCycler® SYBR Green I PCR master mix (Roche) and 0.5 μM each of the forward and reverse primers (Table S2.1 for qRT-PCR). Thermal cycling conditions included an enzyme activation step at 95°C for five minutes and a quantification step with 45 cycles of 95°C for ten seconds, 60°C for ten seconds and 72°C for 15 seconds with single quantification at the end of each cycle. This was followed by a melting curve generating step with one cycle of 95°C for five seconds, 65°C for one minute and 95°C continuously. All reactions were performed in triplicate. Tubulin 6 (Table S2.2) amplification of cDNA bulked from all samples was used as an inter-plate calibrator. Primers used for qRT-PCR were designed using Primer Designer 4 v4.20 (Sci Ed Central, Cary, North Carolina, USA) and synthesised by Inqaba Biotech (Pretoria, South Africa). Internal standard curves were generated for each of the primers used. This was done by performing PCR reactions using serial dilutions of cDNA bulked from the different samples for each of the primer pairs. Crossing point data was exported and analysed using the qBASEplus v1.0 (Biogazelle, Ghent, Belgium) software. Seven putative housekeeping genes, Actin 2 (ACT2), Ubiquitin 5 (UBQ5), UBQ10, 18S rRNA (18S), Elongation factor 1α (EF1), Tubulin 4 (TUB4) and Tubulin 6 (TUB6), were tested to determine which were best suited as endogenous reference genes for normalisation of the relative expression levels of EgCesA1 and other genes tested in this experiment. Standard curves were generated for each primer pair (Table S2.2) by using a serial dilution of bulked cDNA of the different samples. The crossing point data was exported to qBASEplus v1.0 software to generate standard curves. Transcript levels of the housekeeping genes were determined in all of the samples and compared using qBASEplus v1.0. The relative transcript abundance levels of EgCesA1, the endogenous Arabidopsis CesA genes and other cell wall related genes were determined using the above mentioned protocol. 58 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Crossing point data was exported to qBASEplus v1.0 and normalised to the expression levels of UBQ10 and EF1. The normalised data was exported to Microsoft® Office Excel 2007 for further analysis. A type two (two-sample equal variance) double-tail Student’s t-test was performed to determine whether the variation observed could be attributed to variation among the biological and technical repeats of the same line or whether the variation was due to the expression of EgCesA1 in the transgenic lines compared to the wild-type line. Conclusions were drawn at a significance level of α = 0.05. The null hypothesis was that the expression of the tested gene was the same in the wild-type and transgenic plants. Where the null hypothesis was not rejected, it was assumed that variance observed was due to technical and/or biological variance within a sample or line. 2.4 Results 2.4.1 Vector construction Cloning EgCesA1 into the entry vector The EgCesA1 CDS was amplified from xylem cDNA and the PCR products were analysed using agarose gel electrophoresis (Figure 2.3). After purification, EgCesA1 was cloned into the pCR®8/GW/TOPO® (Invitrogen) entry vector and TOP10 E.coli cells (Invitrogen) were transformed with the recombinant vector. Seven colonies containing pTOPO-EgCesA1 recombinant vector were analysed to determine the orientation of the EgCesA1 CDS in the vector by performing a colony PCR. Agarose gel electrophoresis was performed to analyse the PCR products (Figure 2.4 A). A 3086 bp sized PCR product was expected if the EgCesA1 gene was in the sense orientation and 105 bp product if in the antisense orientation. All the selected colonies contained vectors with the EgCesA1 CDS in sense orientation, except for samples 4 and 5 that contained vectors with EgCesA1 CDS in antisense orientation (vector map not shown). Sequencing of the full-length EgCesA1 CDS in pTOPO-EgCesA1 vectors from four colonies revealed several base-pair changes caused by PCR amplification of the EgCesA1 CDS before cloning. Not all changes resulted in altered amino acid sequences. One clone, 59 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA EgCesA1 D, had only one PCR-induced base-pair change that resulted in a change from a glutamate to a lysine residue. This clone was used for subsequent procedures (Figure S2.3). Figure 2.3 1% (w/v) EtBr/Agarose gel electrophoresis of EgCesA1 CDS PCR products amplified from cDNA using EgCesA_gb_5'UTR+28 and EgCesA_3'UTR-120 primers (Figure S2.1). The expected fragment size was 2.98 kb. Lane M is a 1 kb DNA size standard (GeneRuler™ 1 kb DNA Ladder, Fermentas), lanes 1, 2 and 3 contain amplified EgCesA1 CDS PCR products. Transferring EgCesA1 to the destination vector The pTOPO-EgCesA1 plasmid (Figure S2.1) contained attL recombination sites on either side of the EgCesA1 gene and a gene that confers resistance to spectinomycin, aadA1 (Liebert et al 1999). (A schematic outline of the pMDC32 destination vector before and after recombination with the pTOPOEgCesA1 vector is provided in Figure 2.1.) The pMDC32 vector contained the ccdB gene and a chloramphenicol resistance gene flanked by attR sites for recombination. The T-DNA region of the vector also contained a gene that provides resistance to the herbicide hygromycin (HYGROMYCIN PHOSPHOTRANSFERASE), a double 35S CMV promoter and a Nos terminator. NEOMYCIN PHOSPHOTRANSFERASE II, a gene that confers resistance to kanamycin in bacteria, was located outside the T-DNA region. The recombinant pMDC32-EgCesA1 vector was transformed into 60 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Agrobacterium LBA4404 cells for use in plant transformation and confirmed by colony PCR (Figure 2.4 B). Figure 2.4 1% (w/v) EtBr/Agarose gel electrophoresis of colony PCR products amplified from pTOPOEgCesA1 and pMDC32-EgCesA1. Gene-specific EgCesA_3'UTR-120 and vector-specific M13-29-F primers (Figure S2.1) were used to determine the orientation of the EgCesA1 CDS in the pTOPO-EgCesA1 vector isolated from TOP10 E.coli cells (A). Amplification of the fragment in sense orientation yielded a 3086 bp PCR product. PCR products 105 bp in size were obtained from amplification of fragments in antisense orientation. Lane M is a 1 kb DNA size standard (GeneRuler™ 1 kb DNA Ladder, Fermentas) and lanes 1 to 7 contain amplified colony PCR products. Colony PCR products amplified from pMDC32-EgCesA1 in Agrobacterium LBA4404 cells using EgCesA_gb_5’UTR+28 and EgCesA_3'UTR-120 primers are shown in B. Lane M is a 1 kb DNA size standard (GeneRuler™ 1 kb DNA Ladder, Fermentas) and lanes 1 to 3 contain amplified colony PCR products. 61 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA 2.4.2 Selective screening and PCR of transgenic plants After hygromycin selection (Figure 2.5), resistant T1 plants were transferred to Jiffy® pots and allowed to self-pollinate. Three T2 lines derived from three different T1 plants, MO1, MO2 and MO3, each containing a single pMDC32-EgCesA1 T-DNA insert were identified using segregation analysis. The ratio of hygromycin-resistant to non-resistant germinated T2 plants were 3:1, indicating that the T1 plants were hemizygous for the hygromycin resistance gene and that the gene occurred as a single copy in the genome. T3 seed from individual T2 plants were germinated separately and nonsegregating (all germinated seeds resistant to hygromycin) lines were advanced as T3 homozygous lines. Figure 2.5 Hygromycin selection of T1 seeds. Seeds obtained from plants that were dipped in Agrobacterium dip medium were sown on agar-plates containing hygromycin B. All of the seeds germinated, but only transgenic T1 plants (indicated by arrows) survived after five days of incubation and were taller than the untransformed germinated plants. Genomic DNA was extracted from the leaves of the T1 plants and PCR was performed using EgCesA1-specific primers to confirm that the transgenic plants contained the EgCesA1 gene. The PCR products were analysed using EtBr/agarose gel electrophoresis (Figure 2.6). Correctly sized 62 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA PCR products were obtained for each of the T1 lines (lanes 4, 5 and 6) and no product was present in the DNA sample from the wild-type Col-0 control plant (lane 3). Figure 2.6 1% (w/v) EtBr/Agarose gel electrophoresis of the amplified EgCesA1 PCR products from leaf genomic DNA. Lane M1 is a 1 kb DNA size standard (GeneRuler™ 1 kb DNA Ladder, Fermentas), lane M2 contains a 100 bp DNA size standard (GeneRuler™ 100 bp Ladder Plus, Fermentas), lane 1 contains PCR product amplified from non-recombinant pMDC32 vector (negative control), lane 2 contains PCR products amplified from pMDC32-EgCesA1 plasmid (positive control), lane 3 contains PCR products from wild-type Arabidopsis genomic DNA (negative control) and lanes 4 to 6 contain PCR products amplified from genomic DNA of the three transgenic lines (MO1, MO2 and MO3, respectively). EtBr/Agarose gel A contains PCR products obtained using EgCesA_gb_5'UTR+28 forward and EgCesA_3'UTR-120 (Table 2.1) reverse primers and the expected fragment length was 2981 bp. EtBr/Agarose gel B contains PCR products amplified using primers that target a 452 bp segment of the endogenous AtCesA7 gene (DNA-QC-F and DNA-QC-R). 2.4.3 RT-PCR Total RNA was extracted from T3 plants of the three transgenic lines (MO1, MO2 and MO3) and wild-type plants and analysed using EtBr/agarose gel electrophoresis (Figure 2.7 A). Concentrations of the isolated RNA ranged between 0.7 μg/μl and 1.2 μg/μl. The RNA samples were retreated with 63 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA RNase-free DNaseI (Roche). After treatment with DNaseI, first strand cDNA was synthesised from total RNA. cDNA samples were tested for the presence of an intron in the UBQ10 gene to detect the presence of residual genomic DNA. EtBr/agarose gel electrophoresis of the PCR products revealed that three samples (sample 7, 8 and 10) still contained traces of genomic DNA (Figure 2.7 B). Total RNA of these samples were again treated with DNaseI and first strand cDNA was synthesised, after which no genomic DNA was detected (results not shown). Figure 2.7 1% (w/v) EtBr/Agarose gel electrophoresis of extracted total RNA and PCR products amplified from cDNA using UBQ10 primers flanking an intron. Lane M is a 100 bp DNA size standard (GeneRuler™ 100 bp Ladder Plus, Fermentas). Total RNA was extracted from MO1, MO2, MO3 and wild-type Col-0 (A). Lanes 1 to 24 are RNA samples corresponding to the cDNA samples in Table 2.4. Sample 19 was negative and RNA was successfully re-extracted (results not shown). B: 1% (w/v) EtBr/Agarose gel electrophoresis of PCR products amplified using UBQ10 primers flanking an intron. Samples seven, eight and ten had genomic DNA contamination evidenced by the presence of an 850 bp band along with the expected 545 bp band amplified from cDNA. RT-PCR using EgCesA1-specific primers (EgCesA_gb_5'_UTR+28 forward and EgCesA_3'_UTR-120 reverse) was performed to establish whether EgCesA1 was transcribed in the three transgenic Arabidopsis lines. The full-length EgCesA1 RT-PCR products were analysed using EtBr/agarose gel electrophoresis (Figure 2.8). EgCesA1 transcripts were detected in the upper stem tissue cDNA from all three transgenic lines, but not in wild-type Col-0 control plant cDNA. 64 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.8 1% (w/v) EtBr/Agarose gel electrophoresis of RT-PCR products. Lane M1 is a 1 kb DNA size standard (GeneRuler™ 1 kb DNA Ladder, Fermentas), lane 1 contains PCR product amplified from empty pMDC32 vector (negative control), lane 2 contains PCR products amplified from pMDC32-EgCesA1 plasmid (positive control), lane 3 have PCR products from wild-type Arabidopsis upper stem cDNA (negative control), lanes 4 to 6 contain PCR products amplified from upper stem cDNA of the three transgenic lines (MO1, MO2 and MO3, respectively) and lane M2 contains a 100 bp DNA size standard (GeneRuler™ 100 bp DNA Ladder Plus, Fermentas). PCR was performed using EgCesA_gb_5'_UTR+28 forward and EgCesA_3'_UTR-120 reverse primers and the expected band size was 2.98 kb (A). EtBr/Agarose gel B contains PCR products amplified using primers that target a 452 bp segment of the endogenous AtCesA7 gene (DNA-QC-F and DNAQC-R). 2.4.4 Microscopy of stem cell walls Light microscopy analysis was done to observe any changes in cell wall morphology in the transgenic lines compared to the wild-type plants. Two sections, lower inflorescence stem and hypocotyls, were taken from each line and stained with phloroglucinol-HCl to observe the morphology of secondary cell walls. Sections were also stained with toluidine blue to observe cellulose content of the cell walls. The morphological features that were focused on were cell shape, cell wall thickness and cellulose content in vascular bundles. No obvious differences were observed between the transgenic and wild-type lines (Figure 2.9). 65 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.9 Images of inflorescence stem and hypocotyl cross sections of wild-type (WT) and transgenic plant lines (MO1, MO2 and MO3) as observed using light microscopy. Sections were stained for lignin using phloroglucinol-HCl to detect changes in cell wall shape and cell shape and cell wall thickness (A). Toluidine blue staining was used to detect cellulose (B). Scale bars indicate 100 μm. 2.4.5 Cell wall chemistry of transgenic plant stems Inflorescence cell wall chemistry was analysed to determine if the heterologous expression of the EgCesA1 CDS had an influence on the chemical composition of Arabidopsis cell walls. The procedure was repeated once to determine technical variability. A Student’s t-test was used to test for significant changes in cell wall chemistry between wild-type and transgenic plants (Figure 2.10). The percentage total and insoluble lignin fractions were decreased by 2-18% and 15-31%, respectively, in the transgenic lines when compared to that of the wild-type, with MO3 having the most significant 66 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA decrease. However, the percentage soluble lignin was increased in the transgenic lines. Wild-type plants had 15-21% less soluble lignin than transgenic lines. Levels of glucose and xylose were also decreased in the transgenic lines when compared to that of the wild-type (glucose levels were 24% less in MO1, 14% less in MO2 and 8% less in MO3, while xylose levels were 28% less in MO1, 17% less in MO2 and 8% less in MO3). Arabinose was observed at decreased levels in transgenic line MO1 and MO2 (18% decreased), but not in MO3 as compared to the wild-type plant line. 2.4.6 Expression analysis of EgCesA1 and other cell wall related genes in wild-type and transgenic Arabidopsis plants Transcript abundance levels of several selected cell wall related Arabidopsis genes were analysed to determine if they were influenced by the heterologous expression of EgCesA1. Quantitative real-time PCR (qRT-PCR) analysis of gene transcripts in the leaves and upper- and lower inflorescence stems of the three transgenic lines were compared to that in the wild-type Col-0 control plants. The gene expression levels of EgCesA1 and Arabidopsis cell wall related genes were normalised to the relative expression levels of the control genes, UBQ10 and EF1 (Figure 2.11). Raw crossing-point data for potential normalization genes were analysed using qBASEplus v1.0. Normalization factors were calculated based on the expression levels of the control genes (Table S2.2) with the most constant expression, EF1 and UBQ10. A melting curve analysis was performed to confirm that each gene-specific primer pair only amplified a single product (Figure S2.4). The qRT-PCR products for each individual primer pair were bulked and analysed using agarose gel electrophoresis to ensure that single fragments of the expected size were produced (Figure S2.5). Each primer pair tested yielded a single melting peak. To confirm the identities of the qRT-PCR products for each gene-specific primer pair, PCR purified amplification products were sequenced and analysed using BLAST (NCBI, Table S2.3). 67 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.10 Chemical composition of stems from wild-type (WT) and transgenic insertion lines (MO1, MO2 and MO3) transformed with EgCesA1. The y-axis indicates the amount of monomers observed as a percentage of the total dry weight analysed. Error bars indicate technical variability based on two technical replicates. The * indicates that the difference observed between the transgenic line and the wild-type stem composition is statistically significant (α = 0.05). 68 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.11 Relative transcript abundance levels of EF1 and UBQ10 in leaves, upper- and lower stems of wild-type (WT) and transgenic (MO1, MO2 and MO3) plants. The graphs were derived from qBASEplus v1.0. The y-axis indicates the relative expression levels in arbitrary units (A.U.) of the genes. The x-axis indicates samples analysed. Bulk cDNA was obtained from all samples and used to generate internal standard curves for the primer pairs. The green segments of the bars indicate technical variability among three technical replicates (Figure S2.12) 69 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA The expression levels of EgCesA1 and Arabidopsis cell wall related genes were normalized using qBASEplus v1.0 software and the results were exported to Microsoft® Excel 2007 for further analysis. The expression levels of biological replicates of transgenic lines were compared to biological replicates of the wild-type using a Student’s t-test. Comparisons were made between the same tissue in wild-type and transgenic plants. The relative expression levels of the genes analysed are illustrated in Figure S2.6. Variation among biological replicates of the same plant and tissue were evaluated by regression analysis (Table 2.3, Table 2.4, Figures S2.7 to S2.11). Slope-values of regression trends were analysed to determine the level of similarity between biological replicates (Table 2.4), while R2-values were analysed to determine the level of correlation between the data points and the regression trend (Table 2.3). Transgenic line MO2 showed the highest degree of variation between biological replicates when all tissues were analysed (Figure S2.7) and was subsequently excluded from further analysis. Wild-type plants also had a high degree of variation, which was mostly observed in lower stem tissues (Figure S2.8). Upon closer examination it was observed that variation between biological replicates of wild-type plant lower stem tissues were mostly observed for gene transcript levels of AtCesA3, secondary cell wall CesA genes, KORRIGAN and COBRA (Figure S2.6). Table 2.3 R2-values for biological replicates of wild-type, MO1, MO2 and MO3 plants1 Wild-type MO1 MO2 MO3 All tissues 0.19 0.58 0.17 0.83 Upper stem 0.86 0.63 0.49 0.72 Lower stem 0.03 0.11 0.49 0.94 Leaves 0.46 0.95 0.93 Regression lines indicated in Figures S2.7 to S2.11. 0.99 1 70 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Table 2.4 Slope-values of the regression lines for biological replicates of wild-type, MO1, MO2 and MO3 plants1 Wild-type MO1 MO2 MO3 All tissues 0.32 0.74 0.20 0.84 Upper stem 0.89 0.72 0.42 0.52 Lower stem -0.06 0.36 0.14 1.06 Leaves 0.53 1.28 1.48 Regression lines indicated in Figures S2.7 to S2.11. 1.08 1 As expected for 35S promoted expression, EgCesA1 transcripts were observed in all three tissues of all three transgenic lines, but not in wild-type plants (Figure 2.12). Of the three transgenic lines, relative expression of EgCesA1 was highest in MO3. Relative transcript levels of the endogenous primary cell wall associated CesA genes, AtCesA1, AtCesA2 (partially redundant to AtCesA6) and AtCesA3, in the transgenic plant lines did not differ significantly from that observed in the wild-type plants (Figure 2.13). The only difference between wild-type and transgenic lines that could not be attributed to technical and biological variation only, was that observed for AtCesA3 in the upper stems of transgenic line MO1. The transcript abundance levels of primary cell wall associated genes, CYT1 and KOBITO 1, also appeared the same in the transgenic lines as in wild-type plants (Figure 2.15). The upper stem tissues of MO1 showed significantly higher transcript levels for the secondary cell wall associated CesA genes, AtCesA4 and AtCesA8, however, the expression levels of AtCesA7 showed significant biological variation (Figure 2.14). In contrast, the relative expression levels of AtCesA4 and AtCesA7 were significantly lower in MO3 upper stems compared to that observed in wild-type plants. The lower stem tissues in wild-type plants showed high variation between biological replicates (Table 2.3 and Table 2.4) when relative expression levels of the three secondary cell wall associated CesA genes were analysed (Figure 2.14). This was also observed for the relative expression levels of AtCesA3 (Figure 2.13), KORRIGAN and COBRA (Figure 2.15). 71 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.12 Relative transcript abundance of EgCesA1 in wild-type and transgenic plant lines, MO1 and MO3. Error bars indicate technical variation. The y-axis and x-axis indicate relative transcript abundance and tissues analysed, respectively. A and B designate biological replicates. All the genes involved in carbon allocation and the lignin biosynthetic pathway (Figure 2.16 and Figure 2.17) analysed appeared unaffected by the expression of EgCesA1, as no significant differences were observed when transcript levels of the genes were compared between wild-type and MO1 and MO3 plants, respectively. Of the genes involved in carbon allocation analysed, SPP had the most unvaried transcript abundance levels (Figure 2.16). SuSy1, SuSy4 and SPS had similar transcript abundance profiles. 72 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.13 Relative transcript abundance levels of Arabidopsis primary cell wall associated CesA genes. Error bars indicate technical variation of three replicates. * indicates that the expression level difference observed between wild-type and the transgenic plants could not be attributed to technical and biological variation alone at a significance of α = 0.05. The y-axis and x-axis indicate relative transcript abundance and tissues analysed, respectively. A and B designate biological replicates. 73 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.14 Relative transcript abundance levels of Arabidopsis secondary cell wall associated CesA genes. Error bars indicate technical variation of three replicates. * indicates that the expression level difference observed between wild-type and the transgenic plants could not be attributed to technical and biological variation alone at a significance of α = 0.05. The y-axis and x-axis indicate relative transcript abundance and tissues analysed, respectively. A and B designate biological replicates. 74 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.15 Relative transcript abundance levels of CYT1, KOBITO 1, KORRIGAN and COBRA. Error bars indicate technical variation of three replicates. The y-axis and x-axis indicate relative transcript abundance and tissues analysed, respectively. A and B designate biological replicates. 75 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.16 Relative transcript abundance levels of SPP, SPS, SuSy1 and SuSy4. Error bars indicate technical variation of three replicates. The y-axis and x-axis indicate relative transcript abundance and tissues analysed, respectively. A and B designate biological replicates. 76 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure 2.17 Relative transcript abundance levels of AtCAD4, AtCAD5 and THESEUS 1. Error bars indicate technical variation of three replicates. The y-axis and x-axis indicate relative transcript abundance and tissues analysed, respectively. A and B designate biological replicates. 2.5 Discussion The effect of constitutively expressing the Eucalyptus secondary cell wall associated CesA gene, EgCesA1 (Ranik and Myburg, 2006), in wild-type Arabidopsis was assessed by transforming Col-0 plants with a vector containing the EgCesA1 CDS under expression control of a double 35S CMV promoter (Kay et al., 1987). Using the Gateway® (Invitrogen) system for constructing plant 77 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA expression vectors (Curtis and Grossniklaus, 2003) and the floral dip method (Clough and Bent, 1998) for Agrobacterium mediated Arabidopsis transformation, three transgenic lines were generated (MO1, MO2 and MO3). Cell wall phenotypes of the three transgenic lines were compared with that of wildtype Col-0 plants using light microscopy and modified micro-Klason (Huntley et al., 2003) chemical analysis. The relative transcript abundance levels of endogenous Arabidopsis CesA and other cell wall related genes were also compared between transgenic and wild-type lines. Constitutive expression of EgCesA1 and its effect on cell wall morphology and chemistry The EgCesA1 transgene was shown to be expressed in all three transgenic plant lines (Figure 2.8). Relative transcript levels varied between the three lines (Figure S2.6), with MO3 showing the highest relative expression in all three tissues (upper stem, lower stem and leaves) analysed. This could be due to the position within the genome where the transgene construct inserted (Francis and Spiker, 2005). These results provide evidence that EgCesA1 was transcribed in the transgenic lines, but EgCESA1 protein levels still need to be analysed to establish if translation of EgCesA1 mRNA occurred. This could be achieved using Western blot analysis. No antibody for the EgCESA1 protein was available; therefore, Western blot analysis could not be performed for this study. Predicting the fate of the EgCESA1 protein, if it is translated in Arabidopsis, could prove to be a challenge. Over-expression of a mutated AtCesA7 gene, fragile fibre 5 (fra5) that had a missense mutation in the second cytoplasmic domain in wild-type Arabidopsis plants had a dominant negative effect on cellulose biosynthesis in secondary and primary cell walls causing xylem cell walls to collapse and affecting cell elongation. Incorporation of the mutated CESA protein into the rosette subunits was hypothesised to interfere with endogenous CESA protein activity. In contrast, overexpression of a missense mutated AtCesA8 gene in wild-type Arabidopsis apparently did not alter cellulose biosynthesis. However, it should be noted that data to support this observation was not presented (Zhong et al., 2003). Protein levels of AtCESA7 in transgenic lines over-expressing wildtype AtCesA7 were regulated through phosphorylation. When transgene protein levels exceeded wildtype levels, excess protein was phosphorylated and degraded. Phosphorylation was hypothesised to 78 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA be a key process for regulating relative CESA protein levels (Taylor, 2007). If translated, EgCesA1 expressed in Arabidopsis could result in the incorporation of EgCESA1 proteins into Arabidopsis cellulose synthase complexes. If the protein does not function correctly, it could affect the activity of endogenous CESA proteins resulting in reduced cellulose and collapsed xylem cell walls, or it could have no affect as observed for mutated AtCesA8 over-expression (Zhong et al., 2003). Alternatively, over-expression of EgCesA1 could result in phosphorylation and subsequent degradation of proteins in excess of wild-type levels of the endogenous orthologue, AtCESA8. Analysis of AtCESA8 protein levels could reveal if phosphorylation and degradation occurs. Light microscopy was performed to determine if over-expression of EgCesA1 altered the phenotype of cell walls in stems and hypocotyls. Phloroglucinol-HCl stains lignin red and was useful to analyse secondary cell wall morphology. Because phloroglucinol-HCl does not stain cellulose, toluidine blue, which stains cellulose blue and lignin blue-green, was also used. These stains enabled visualisation of vascular cell walls and comparisons could be made between cell walls of the three transgenic lines and wild-type Arabidopsis plants (Figure 2.9). No distinguishable differences were observed in any of the analysed tissues. Cell shape and cell wall thickness appeared similar among the transgenic and wild-type plants. The amount of cellulose and lignin stained with toluidine blue also did not appear to differ between transgenic and wild-type sections. Therefore, the expression of EgCesA1 did not visibly affect cell wall morphology in transgenic plants. Altered cellulose biosynthesis and cell wall morphology have been shown to be accompanied by drastic changes in the chemical composition of cell walls (Lane et al., 2001; Taylor et al., 2003; Zhong et al., 2003; Brown et al., 2005; Coleman et al., 2007). Analysis of the sugar composition of cell walls enables detection of changes due to altered cellulose biosynthesis and changes in hemicellulose content. However, not all changes in cell wall associated chemistry lead to visibly altered cell wall morphology (Coleman et al., 2006). Cell wall chemistry was analysed in inflorescence stems of transgenic and wild-type lines (Figure 2.10). Although some differences between transgenic and wild-type plants that could not be attributed to technical variability were observed (lignin, glucose, xylose and arabinose), the differences in polysaccharide content were not as 79 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA severe as those observed in other studies (Taylor et al., 2003; Zhong et al., 2003; Brown et al., 2005). There was also greater variation among the three transgenic lines than between transgenic and wildtype plants. This could explain why no phenotypic changes were detected when xylem cell walls were examined under light microscopy. Relative expression analysis of Arabidopsis cell wall related genes The plant cell wall is a complex network of cellulose intertwined with hemicellulose, pectin (in primary cell walls), lignin (in secondary cell walls) and cell wall proteins. Some genes involved in the biosynthesis and deposition of the various components of cell walls have been shown to be coexpressed and possibly co-regulated (Brown et al., 2005; Persson et al., 2005). Changes in cellulose biosynthesis can influence monosaccharide levels in cell walls (Zhong et al., 2003; Brown et al., 2005) indicating that changes in cellulose deposition can influence hemicellulose content. Defects in cellulose biosynthesis have also been shown to cause ectopic lignification (His et al., 2001; Desprez et al., 2002; Cano-Delgado et al., 2003). It has been proposed that some form of cell wall integrity sensing leads to alterations in non-cellulose components of the cell wall in reaction to altered cellulose content (Hematy et al., 2007). A question that was posed in this study is; would constitutive expression of EgCesA1 in wild-type Arabidopsis plants influence the expression of endogenous genes involved in cellulose, lignin or hemicellulose biosynthesis? qRT-PCR was used to quantify the relative expression levels of EgCesA1, endogenous CesA genes and other Arabidopsis genes known to be involved in cell wall deposition. qRT-PCR provides an accurate means to study transcript abundance levels, as it is sensitive enough to detect small changes in mRNA abundance (Rockett and Hellmann, 2004; Steibel et al., 2009). To correct for technical variability three technical replicates of each reaction was done, inter-run calibrators were included and gene expression levels were normalised to the relative expression levels of two control genes, EF1 and UBQ10 (Figure 2.11). cDNA quality was assessed by PCR amplification of a segment of the UBQ10 gene (Figure 2.7) and ideal concentrations of cDNA to be used for qRT-PCR was determined by testing the amplification efficiencies of a serial dilution of each cDNA sample. 80 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Plant material from four plants in each line was combined to represent one biological replicate (Figure 2.2 B). Despite this bulking of tissues, considerable variation in gene expression levels was observed between some biological replicates. MO2 had the highest biological variation across all tissues (Table 2.3 and Table 2.4). Normalization of transcript levels to the transcript abundance of the control genes UBQ10 and EF1 aimed to correct for variations in cDNA concentration. There appeared to be no correlation between the transcript abundance levels of control genes and biological variation observed among MO2 biological replicates (Figure S2.12). The variation could rather be attributed to cDNA quality and concentration. High biological variation was also observed in wild-type lower stem tissues (Table 2.3 and Table 2.4). The variation was not observed for all genes analysed. Expression levels of AtCesA3 (Figure 2.13), secondary cell wall associated CesA genes (Figure 2.14), KORRIGAN and COBRA (Figure 2.15) varied between lower stem tissues of the two wild-type biological replicates. Replicate A had higher transcript abundance for these genes than replicate B. SuSy4 and SPS transcript levels also showed high biological variation among lower stem tissues of wild-type plants with replicate B having higher transcript levels than replicate A (Figure 2.16). Such inherent biological variability in an experiment could influence data to appear statistically non-significant, resulting in a Type II error (Willems et al., 2008). A method for standardizing qRT-PCR data from independent biological replicates have been proposed by Willems et al. (2008). It involves three steps; log transformation of normalized relative expression levels to limit the effect of outliers, mean-centring to correct for differences between control levels in biological replicates and autoscaling that corrects differences in fold change between experimental conditions. The authors show that standardizing the data with these three steps does not increase the rate of false positives. This method can be used when expression levels of three or more biological replicates are quantified. These considerations should be kept in mind for future studies of this nature. Arabidopsis primary cell wall associated CesA genes (AtCesA1, AtCesA3, AtCesA6 and AtCesA6-related genes, AtCesA2 and AtCesA5) are involved in cellulose deposition in primary cell walls (Arioli et al., 1998; Burn et al., 2002; Desprez et al., 2002). Expression analysis of AtCesA1, 81 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA AtCesA2 and AtCesA3 revealed that all three genes were expressed at constant levels in leaves, upper and lower stems of MO1, MO3 and wild-type plants (Figure 2.13). When transcript levels were compared between transgenic and wild-type plant lines, the only difference that could not be attributed to biological and technical variation alone was the increased transcript abundance of AtCesA3 in upper stems of MO1 (Figure 2.13). The difference was small and relative transcript abundance of AtCesA3 did not differ significantly in upper stems of MO3 compared to that in the wild-type. The difference in relative expression levels of AtCesA3 in upper stems of MO1 was likely not a response to EgCesA1 transgene expression. To correct for multiple testing, the single testing significance should also be considered at α = 0.05/n where n is the number of independent tests analysed. The relative transcript abundance of each gene was independently tested in two transgenic lines. At a significance of α = 0.025 the difference between AtCesA3 transcript levels in MO1 and wild-type upper stems is no longer statistically significant. Two other genes with proposed functions in cellulose deposition in primary cell walls are CYT1 (Nickle and Meinke, 1998) and KOBITO 1 (Pagant et al., 2002). CYT1 is believed to be required for N-glycosylation of CESA proteins. The cyt1 mutant plants exhibit severe changes in primary cell wall morphology due to decreased cellulose content (Lukowitz et al., 2001). KOBITO 1 occurs in the extracellular matrix and is required for normal cellulose biosynthesis during cell elongation (Lertpiriyapong and Sung, 2003). Like the relative expression levels of AtCesA1, AtCesA2 and AtCesA3, expression levels of CYT1 and KOBITO 1 appeared unaffected by the expression of EgCesA1 in transgenic plant lines (Figure 2.15). The genes were expressed in constant levels across the three tissues analysed corresponding with their proposed function in primary cell wall deposition (Figure 2.15). Relative transcript abundance of the secondary cell wall associated Arabidopsis CesA genes, KORRIGAN and COBRA showed similar profiles (Figures 2.14 and 2.15). These genes have previously been shown to be co-expressed (Brown et al., 2005; Persson et al., 2005). Transcript levels of these genes were on average at least three-fold higher in stems than in leaves of wild-type and MO1 plants. High variation in expression levels of these genes in the lower stem tissues of wildtype biological replicates was observed, as mentioned previously. 82 Because of this, statistical CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA significance could not be given to differences observed between lower stem tissues of wild-type and transgenic plants. Transcripts of secondary cell wall genes were on average more abundant in stem tissues than in leaves. This agrees with their functions during secondary cell wall deposition (Taylor et al., 2003). AtCesA4 and AtCesA8 expression levels in upper stem tissues of MO1 were significantly higher than the wild-type. AtCesA7 also appeared to be expressed at higher levels in upper stems of MO1, but biological variation was too high to give statistical significance to the observation. Interestingly, secondary cell wall associated CesA genes had lower relative expression in transgenic line MO3 than in the wild-type and MO1, in contrast to the higher relative expression of EgCesA1 in MO3 (Figure 2.12). Expression of EgCesA1 could have a negative effect when transcript levels exceed a certain threshold. High levels of EgCesA1 could cause post-transcriptional gene silencing (PTGS) of endogenous genes that have homologous gene sequences to EgCesA1 (Hammond et al., 2000). PTGS could occur if gene sequences share a 21 bp uninterrupted homologous cDNA sequence. When AtCesA8 and EgCesA1 cDNA sequences were aligned one uninterrupted segment of 23 bp of homologous sequence was observed (Figure S2.14). Down-regulation of the endogenous genes could subsequently cause changes in expression levels of co-expressed genes. Down-regulation of the secondary cell wall genes was not enough to cause changes in the cell wall morphology of MO3 plants (Figure 2.9) or chemistry of the cell walls (Figure 2.10). Since changes in transcript levels of secondary cell wall associated genes were not consistent between MO1 and MO3, it could not be positively correlated with the expression levels of the EgCesA1 transgene. Nevertheless, it would be interesting to probe for the presence of a small interfering RNA molecule corresponding to the 23 bp conserved region in transgenic plants. Genes involved in carbon partitioning and cycling, SuSy1, SuSy4, SPP and SPS, have been suggested to control the flux of UDP-glucose towards cellulose biosynthesis (Delmer and Haigler, 2002). An increase in SPS protein activity has been correlated with increased cellulose biosynthesis (Babb and Haigler, 2001). Relative transcript abundance observed for SPS appeared unaffected by EgCesA1 expression (Figure 2.16). Gene expression levels of SuSy1, SuSy4 and SPP were also unaffected by the expression of EgCesA1 (Figure 2.16). A recent study by Barratt et al. (2009) 83 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA suggested that cytosolic invertase was required for normal carbon partitioning in Arabidopsis plants rather than SuSy. It therefore seems prudent to characterise transcript abundance levels of CYTOSOLIC INVERTASE genes, CINV1 and CINV2, in future studies of this nature. As mentioned previously, ectopic lignification has been observed in plants with decreased cellulose biosynthesis (Desprez et al., 2002; Cano-Delgado et al., 2003). Cinnamyl alcohol dehydrogenase (CAD) is an enzyme involved in monolignol biosynthesis. CAD enzymes catalyse the conversion of cinnamyl aldehydes to coniferyl and sinapyl alcohols (Walter et al., 1988). In Arabidopsis two CAD genes, AtCAD4 and AtCAD5, were found to be expressed in, among others, the vascular tissues of stems and leaves (Kim et al., 2007). The relative expression levels of AtCAD4 and AtCAD5 were quantified to determine if constitutive expression of EgCesA1 had an effect on endogenous CAD gene expression. Again, no significant changes in gene transcript abundance levels could be detected when transgenic and wild-type plants were compared (Figure 2.17) despite variation observed in lignin content (Figure 2.10). Ectopic lignification is believed to be a defence response to a decrease in cellulose (CanoDelgado et al., 2003) and THESEUS 1 has been proposed to be involved in signalling the response. THESEUS 1 is a membrane-bound receptor-like kinase. THESEUS 1 expression has been shown to be increased in plants with mutated CesA genes (Hematy et al., 2007). A mutation of THESEUS 1 in the CesA gene mutant background, results in a decrease in ectopic lignification possibly through the production of reactive oxygen species (Hematy and Hofte, 2008). Conversely, over-expression of THESEUS 1 in plants with a mutated CesA gene results in increased amounts of ectopic lignin (Hematy et al., 2007). Microscopy and chemical analysis did not reveal any evidence for ectopic lignification (Figure 2.9 and Figure 2.10) and relative transcript abundance levels of THESEUS 1 did not differ significantly between wild-type and transgenic lines (Figure 2.17). Constitutive expression of the EgCesA1 gene in wild-type Arabidopsis was successfully achieved (Figure 2.12). The presence of high levels of secondary cell wall associated CesA gene transcripts did not have any noticeable effect on cell wall morphology (Figure 2.9). Despite changes 84 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA in cell wall chemistry (Figure 2.10) and significant changes in endogenous secondary cell wall CesA gene transcript abundance in MO1 (Figure 2.14), significant correlations could not be drawn between EgCesA1 expression and relative expression levels of endogenous cell wall related genes (Figures 2.13 to 2.17). Transgenic line MO2 had especially high variation between biological replicates for gene expression in stem tissues. cDNA concentration and quality of MO2 upper and lower stem samples could have been insufficient for the experiment. Because no significant differences in cell wall chemistry and morphology could be detected in MO2 compared to MO1 and MO3, MO2 was excluded from analysis of relative gene expression levels. In order to increase statistical power, at least three biological replicates should in future be analysed when quantifying relative expression levels of genes using qRT-PCR. The variation in gene expression observed between transgenic lines provides support for the use of multiple transgenic events when analysing the effects of transgene expression. It enables one to discern between effects that are caused by expression of the transgene and those that occur due to positional effects. Manipulation of cellulose biosynthesis will greatly benefit the wood products industry. Better understanding of the assembly of rosette protein complexes and the interaction of cellulose microfibrils and other cell wall polymers will facilitate attempts to increase cellulose biosynthesis in commercially important tree species. Constitutive expression of the EgCesA1 transgene did not have a noticeable effect on cellulose biosynthesis. This study does not provide support for the hypothesis that expression of a single secondary cell wall associated Eucalyptus CesA gene will lead to increased cellulose production and affect the expression levels of endogenous cell wall associated genes in wildtype Arabidopsis. However, it does not provide support against the alternative hypothesis that expression of all three secondary cell wall CesA genes need to be increased to increase cellulose biosynthesis. Hypotheses that could explain the observations made in this study are proposed in the Concluding Remarks section of the dissertation. 85 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA 2.6 References Arioli, T., Peng, L.C., Betzner, A.S., Burn, J., Wittke, W., Herth, W., Camilleri, C., Hofte, H., Plazinski, J., Birch, R., Cork, A., Glover, J., Redmond, J., and Williamson, R.E. (1998). Molecular analysis of cellulose biosynthesis in Arabidopsis. Science 279, 717-720. Atanassov, I.I., Pittman, J.K., and Turner, S.R. (2009). Elucidating the mechanisms of assembly and subunit interaction of the cellulose synthase complex of Arabidopsis secondary cell walls. The Journal of biological chemistry 284, 3833-3841. Babb, V.M., and Haigler, C.H. (2001). Sucrose phosphate synthase activity rises in correlation with high-rate cellulose synthesis in three heterotrophic systems. Plant Physiology 127, 1234-1242. Barratt, D.H.P., Derbyshire, P., Findlay, K., Pike, M., Wellner, N., Lunn, J., Feil, R., Simpson, C., Maule, A.J., and Smith, A.M. (2009). Normal growth of Arabidopsis requires cytosolic invertase but not sucrose synthase. Proceedings of the National Academy of Sciences of the United States of America 106, 13124-13129. Bhandari, S., Fujino, T., Thammanagowda, S., Zhang, D.Y., Xu, F.Y., and Joshi, C.P. (2006). Xylem-specific and tension stress-responsive co-expression of KORRIGAN endoglucanase and three secondary wall-associated cellulose synthase genes in aspen trees. Planta 224, 828-837. Brown, D.M., Zeef, L.A.H., Ellis, J., Goodacre, R., and Turner, S.R. (2005). Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17, 2281-2295. Burn, J.E., Hocart, C.H., Birch, R.J., Cork, A.C., and Williamson, R.E. (2002). Functional analysis of the cellulose synthase genes CesA1, CesA2, and CesA3 in Arabidopsis. Plant Physiology 129, 797-807. Cano-Delgado, A., Penfield, S., Smith, C., Catley, M., and Bevan, M. (2003). Reduced cellulose synthesis invokes lignification and defence responses in Arabidopsis thaliana. Plant Journal 34, 351-362. Clough, S.J., and Bent, A.F. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal 16, 735-743. 86 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Coleman, H.D., Ellis, D.D., Gilbert, M., and Mansfield, S.D. (2006). Up-regulation of sucrose synthase and UDP-glucose pyrophosphorylase impacts plant growth and metabolism. Plant Biotechnology Journal 4, 87-101. Coleman, H.D., Canam, T., Kang, K.Y., Ellis, D.D., and Mansfield, S.D. (2007). Over-expression of UDP-glucose pyrophosphorylase in hybrid poplar affects carbon allocation. Journal of Experimental Botany 58, 4257-4268. Curtis, M.D., and Grossniklaus, U. (2003). A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiology 133, 462-469. Delmer, D.P., and Haigler, C.H. (2002). The regulation of metabolic flux to cellulose, a major sink for carbon in plants. Metabolic Engineering 4, 22-28. Desprez, T., Vernhettes, S., Fagard, M., Refregier, G., Desnos, T., Aletti, E., Py, N., Pelletier, S., and Hofte, H. (2002). Resistance against herbicide isoxaben and cellulose deficiency caused by distinct mutations in same cellulose synthase isoform CesA6. Plant Physiology 128, 482-490. Dhugga, K.S. (2001). Building the wall: Genes and enzyme complexes for polysaccharide synthases. Current Opinion in Plant Biology 4, 488-493. Driouich, A., and Baskin, T.I. (2008). Intercourse between cell wall and cytoplasm exemplified by arabinogalactan proteins and cortical microtubules. American Journal of Botany 95, 1491-1497. Francis, K.E., and Spiker, S. (2005). Identification of Arabidopsis thaliana transformants without selection reveals a high occurrence of silenced T-DNA integrations. Plant Journal 41, 464-477. Green, P.B. (1962). Mechanism for plant cellular morphogenesis. Science 138, 1404-&. Haigler, C.H., Ivanova-Datcheva, M., Hogan, P.S., Salnikov, V.V., Hwang, S., Martin, K., and Delmer, D.P. (2001). Carbon partitioning to cellulose synthesis. Plant Molecular Biology 47, 2951. Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293-296. Hartley, J.L. (2003). Use of the gateway system for protein expression in multiple hosts. Current protocols in protein science / editorial board, John E. Coligan ... [et al.] Chapter 5. 87 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Hematy, K., and Hofte, H. (2008). Novel receptor kinases involved in growth regulation. Current Opinion in Plant Biology 11, 321-328. Hematy, K., Sado, P.E., Van Tuinen, A., Rochange, S., Desnos, T., Balzergue, S., Pelletier, S., Renou, J.P., and Hofte, H. (2007). A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis. Current Biology 17, 922-931. His, I., Driouich, A., Nicol, F., Jauneau, A., and Höfte, H. (2001). Altered pectin composition in primary cell walls of korrigan, a dwarf mutant of Arabidopsis deficient in a membrane-bound endo-1,4-β-glucanase. Planta 212, 348-358. Huntley, S.K., Ellis, D., Gilbert, M., Chapple, C., and Mansfield, S.D. (2003). Significant increases in pulping efficiency in C4H-F5H-transformed poplars: Improved chemical savings and reduced environmental toxins. Journal of Agricultural and Food Chemistry 51, 6178-6183. Kay, R., Chan, A., Daly, M., and McPherson, J. (1987). Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236, 1299-1302. Kim, S.J., Kim, K.W., Cho, M.H., Franceschi, V.R., Davin, L.B., and Lewis, N.G. (2007). Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: Lessons for database annotations? Phytochemistry 68, 19571974. Lane, D.R., Wiedemeier, A., Peng, L.C., Hofte, H., Vernhettes, S., Desprez, T., Hocart, C.H., Birch, R.J., Baskin, T.I., Burn, J.E., Arioli, T., Betzner, A.S., and Williamson, R.E. (2001). Temperature-sensitive alleles of RSW2 link the KORRIGAN endo-1,4-beta-glucanase to cellulose synthesis and cytokinesis in Arabidopsis. Plant Physiology 126, 278-288. Lertpiriyapong, K., and Sung, Z.R. (2003). The elongation defective 1 mutant of Arabidopsis is impaired in the gene encoding a serine-rich secreted protein. Plant Molecular Biology 53, 581-595. Lev-Yadun, S. (1997). Fibres and fibre-sclereids in wild-type Arabidopsis thaliana. Annals of Botany 80, 125-129. Lukowitz, W., Nickle, T.C., Meinke, D.W., Last, R.L., Conklin, P.L., and Somerville, C.R. (2001). Arabidopsis cyt1 mutants are deficient in a mannose-1-phosphate guanylyltransferase and 88 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA point to a requirement of N-linked glycosylation for cellulose biosynthesis. Proceedings of the National Academy of Sciences of the United States of America 98, 2262-2267. Mueller, S.C., and Brown, R.M. (1980). Evidence for an intramembrane component associated with a cellulose microfibril-synthesizing complex in higher-plants. Journal of Cell Biology 84, 315-326. Nickle, T.C., and Meinke, D.W. (1998). A cytokinesis-defective mutant of Arabidopsis (cyt1) characterized by embryonic lethality, incomplete cell walls, and excessive callose accumulation. Plant Journal 15, 321-332. Oda, Y., Mimura, T., and Hasezawa, S. (2005). Regulation of secondary cell wall development by cortical microtubules during tracheary element differentiation in Arabidopsis cell suspensions. Plant Physiology 137, 1027-1036. Pagant, S., Bichet, A., Sugimoto, K., Lerouxel, O., Desprez, T., McCann, M., Lerouge, P., Vernhettes, S., and Hofte, H. (2002). KOBITO 1 encodes a novel plasma membrane protein necessary for normal synthesis of cellulose during cell expansion in Arabidopsis. Plant Cell 14, 2001-2013. Paredez, A.R., Persson, S., Ehrhardt, D.W., and Somerville, C.R. (2008). Genetic evidence that cellulose synthase activity influences microtubule cortical array organization. Plant Physiology 147, 1723-1734. Perrin, R.M. (2001). Cellulose: How many cellulose synthases to make a plant? Current Biology 11, R213-R216. Persson, S., Wei, H., Milne, J., Page, G.P., and Somerville, C.R. (2005). Identification of genes required for cellulose synthesis by regression analysis of public microarray data sets. Proceedings of the National Academy of Sciences of the United States of America 102, 8633-8638. Quader, H. (1986). Cellulose microfibril orientation in Oocystis solitaria: Proof that microtubules control the alignment of the terminal complexes. Journal of Cell Science 83, 223-234. Ranik, M., and Myburg, A.A. (2006). Six new cellulose synthase genes from Eucalyptus are associated with primary and secondary cell wall biosynthesis. Tree Physiology 26, 545–556. Rockett, J.C., and Hellmann, G.M. (2004). Confirming microarray data - Is it really necessary? Genomics 83, 541-549. 89 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Speer, E.O. (1987). A method of retaining phloroglucinol proof of lignin. Stain Technology 62, 279280. Steibel, J.P., Rosa, G.J.M., and Tempelman, R.J. (2009). Optimizing design of two-stage experiments for transcriptional profiling. Computational Statistics and Data Analysis 53, 16391649. Szyjanowicz, P.M.J., McKinnon, I., Taylor, N.G., Gardiner, J., Jarvis, M.C., and Turner, S.R. (2004). The irregular xylem 2 mutant is an allele of korrigan that affects the secondary cell wall of Arabidopsis thaliana. Plant Journal 37, 730-740. Taylor, N.G. (2007). Identification of cellulose synthase AtCESA7 (IRX3) in vivo phosphorylation sites - A potential role in regulating protein degradation. Plant Molecular Biology 64, 161-171. Taylor, N.G., Howells, R.M., Huttly, A.K., Vickers, K., and Turner, S.R. (2003). Interactions among three distinct CESA proteins essential for cellulose synthesis. Proceedings of the National Academy of Sciences of the United States of America 100, 1450-1455. Timmers, J., Vernhettes, S., Desprez, T., Vincken, J.P., Visser, R.G.F., and Trindade, L.M. (2009). Interactions between membrane-bound cellulose synthases involved in the synthesis of the secondary cell wall. FEBS Letters 583, 978-982. Turner, S.R., and Somerville, C.R. (1997). Collapsed xylem phenotype of Arabidopsis identifies mutants deficient in cellulose deposition in the secondary cell wall. Plant Cell 9, 689-701. Wakabayashi, K., Soga, K., Kamisaka, S., and Hoson, T. (2005). Increase in the level of arabinoxylan-hydroxycinnamate network in cell walls of wheat coleoptiles grown under continuous hypergravity conditions. Physiologia Plantarum 125, 127-134. Walhout, A.J.M., Temple, G.F., Brasch, M.A., Hartley, J.L., Lorson, M.A., Van den Heuvel, S., and Vidal, M. (2000). GATEWAY recombinational cloning: Application to the cloning of large numbers of open reading frames or ORFeomes. In Methods in Enzymology, pp. 575-592. Walter, M.H., Grima-Pettenati, J., Grand, C., Boudet, A.M., and Lamb, C.J. (1988). Cinnamylalcohol dehydrogenase, a molecular marker specific for lignin synthesis: cDNA cloning and mRNA induction by fungal elicitor. Proceedings of the National Academy of Sciences of the United States of America 85, 5546-5550. 90 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Willems, E., Leyns, L., and Vandesompele, J. (2008). Standardization of real-time PCR gene expression data from independent biological replicates. Analytical Biochemistry 379, 127-129. Winter, H., Huber, J.L., and Huber, S.C. (1997). Membrane association of sucrose synthase: Changes during the graviresponse and possible control by protein phosphorylation. Febs Letters 420, 151-155. Zhong, R., Morrison Iii, W.H., Freshour, G.D., Hahn, M.G., and Ye, Z.H. (2003). Expression of a mutant form of cellulose synthase AtCesA7 causes dominant negative effect on cellulose biosynthesis. Plant Physiology 132, 786-795. 91 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA 2.7 Supplementary material Figure S2.1 Vector map of pTOPO-EgCesA1. The EgCesA1 CDS (EgCesA1) was inserted between the attL1 and attL2 Gateway® recombination sites in sense orientation. The vector had a pUC origin of replication (pUC ori) and a gene that conferred resistance to spectinomycin. Primer binding sites for vector-specific primers (M13-29-F and M13-narrow-R), gene-specific primers (EgCesA_gb_5’UTR+28 and EgCesA_3’UTR-120) and internal sequencing primers (EgCesA1_seq_F and EgCesA1_seq_R) are indicated by black arrows. 92 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.2 Vector maps of the empty and recombinant destination vectors, pMDC32 and pMDC32-EgCesA1. pMDC32 has a pBR322 origin of replication and a gene that conferred bacterial resistance to kanamycin. The vector also contained a gene that conferred resistance to hygromycin as plant selectable marker, a double 35S CMV promoter and Nos terminator between the left and right borders (LB and RB, respectively) of the expression cassette that would incorporate into the genome of transgenic plants. Vector-specific primer binding sites, M13-40-F and M13-wide-R, are indicated as black arrows. The EgCesA1 CDS was transferred to pMDC32 from pTOPO-EgCesA1 by recombination between the attR1 and attR2 sites of pMDC32 (A) and the attL1 and attL2 sites of pTOPO-EgCesA1 (Figure S2.1) resulting in the formation of attB1 and attB2 sites in the recombinant vector (B). Gene-specific primer binding sites for EgCesA_gb_5’UTR+28 and EgCesA_3’UTR120 primers are indicated as black arrows in B. 93 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA EgCESA1 A, B, C and D predicted proteins Figure S2.3 Alignment of predicted amino acid sequences of four pTOPO-EgCesA1clones. Positions 1 to 301. The full-length EgCesA1 CDS was sequenced. EgCesA1D was used for subsequent procedures. Darker gray shading indicates similarity between two or more of the sequences analysed. Light grey shading indicates complete consensus. 94 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA EgCESA1 A, B, C and D predicted proteins Figure S2.3 (Cont.) Alignment of predicted amino acid sequences of four pTOPO-EgCesA1clones. Positions 302 to 602. The full-length EgCesA1 CDS was sequenced. EgCesA1D was used for subsequent procedures. Darker gray shading indicates similarity between two or more of the sequences analysed. Light grey shading indicates complete consensus. 95 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA EgCESA1 A, B, C and D predicted proteins Figure S2.3 (Cont.) Alignment of predicted amino acid sequences of four pTOPO-EgCesA1clones. Positions 603 to 903. The full-length EgCesA1 CDS was sequenced. EgCesA1D was used for subsequent procedures. Darker gray shading indicates similarity between two or more of the sequences analysed. Light grey shading indicates complete consensus. 96 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA EgCESA1 A, B, C and D predicted proteins Figure S2.3 (Cont.) Alignment of predicted amino acid sequences of four pTOPO-EgCesA1clones. Positions 904 to 978. The full-length EgCesA1 CDS was sequenced. EgCesA1D was used for subsequent procedures. Darker gray shading indicates similarity between two or more of the sequences analysed. Light grey shading indicates complete consensus. 97 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.4 Melting curves of the qRT-PCR products for each gene-specific primer pair. The y-axis indicates (d/dT) fluorescence (483-533) and the x-axis indicates temperature (°C). 98 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.5 1% (w/v) EtBr/Agarose gel electrophoresis of bulked qRT-PCR products for 22 gene-specific primer pairs. Lane M contains a 100 bp DNA size standard (GeneRuler™ 100 bp DNA Ladder Plus, Fermentas) and lanes 1 to 22 contain 5 μl of bulked qRT-PCR products including the products from the amplification of the control genes EF1 and UBQ10 in lanes 19 to 22. 99 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.6 Relative transcript levels of EgCesA1 and endogenous genes involved in cell wall biosynthesis pathways. The y-axis indicates relative transcripts levels. The x-axis indicates tissues from wild-type (WT) and transgenic lines (MO1, MO2 and MO3) for two biological replicates, A and B. Error bars indicate technical variation among three technical replicates. 100 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.6 (Cont.) Relative transcript levels of EgCesA1 and endogenous genes involved in cell wall biosynthesis pathways. The y-axis indicates relative transcripts levels. The x-axis indicates tissues from wildtype (WT) and transgenic lines (MO1, MO2 and MO3) for two biological replicates, A and B. Error bars indicate technical variation among three technical replicates. 101 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.6 (cont.) Relative transcript levels of EgCesA1 and genes involved in carbon flux in plant cell walls. The y-axis indicates relative transcripts levels. The x-axis indicates tissues from wild-type (WT) and transgenic lines (MO1, MO2 and MO3) for two biological replicates, A and B. Error bars indicate technical variation among three technical replicates. 102 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.6 (Cont.) Relative transcript levels of EgCesA1 and endogenous genes involved in cell wall biosynthesis pathways. The y-axis indicates relative transcripts levels. The x-axis indicates tissues from wildtype (WT) and transgenic lines (MO1, MO2 and MO3) for two biological replicates, A and B. Error bars indicate technical variation among three technical replicates. 103 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.6 (Cont.) Relative transcript levels of EgCesA1 and endogenous genes involved in cell wall biosynthesis pathways. The y-axis indicates relative transcripts levels. The x-axis indicates tissues from wildtype (WT) and transgenic lines (MO1, MO2 and MO3) for two biological replicates, A and B. Error bars indicate technical variation among three technical replicates. 104 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.7 Regression analysis of relative transcript levels of all genes compared between biological replicates across all tissues. The x-axis indicates transcript levels in replicate A and the y-axis indicates transcript levels in replicate B. Wild-type (WT) and transgenic lines, MO1, MO2 and MO3. 105 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.8 Regression analysis of relative transcript levels compared between biological replicates of wildtype plants. The x-axis indicates transcript levels in replicate A and the y-axis indicates transcript levels in replicate B. ALL, all tissues; US, upper stem tissues; LS, lower stem tissues; L, leaf tissues. 106 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.9 Regression analysis of relative transcript levels compared between biological replicates of MO1 transgenic plants. The x-axis indicates transcript levels in replicate A and the y-axis indicates transcript levels in replicate B. ALL, all tissues; US, upper stem tissues; LS, lower stem tissues; L, leaf tissues. 107 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.10 Regression analysis of relative transcript levels compared between biological replicates of MO2 transgenic plants. The x-axis indicates transcript levels in replicate A and the y-axis indicates transcript levels in replicate B. ALL, all tissues; US, upper stem tissues; LS, lower stem tissues; L, leaf tissues. 108 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.11 Regression analysis of relative transcript levels compared between biological replicates of MO3 transgenic plants. The x-axis indicates transcript levels in replicate A and the y-axis indicates transcript levels in replicate B. ALL, all tissues; US, upper stem tissues; LS, lower stem tissues; L, leaf tissues. 109 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.12 Transcript levels of UBQ10 and EF1 before normalization. The y-axis indicates transcript levels and the x-axis indicates the plant lines, wild-type (WT), MO1, MO2 and MO3, biological replicates A and B and three replicates analysed in each tissue, upper stem, lower stem and leaves. 110 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 1 to 432. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 111 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 (Cont.) DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 433 to 864. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 112 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 (Cont.) DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 865 to 1296. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 113 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 (Cont.) DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 1297 to 1728. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 114 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 (Cont.) DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 1729 to 2160. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 115 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 (Cont.) DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 2161 to 2592. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 116 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 (Cont.) DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 2593 to 3024. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 117 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Figure S2.13 (Cont.) DNA sequence alignment of AtCesA8 and EgCesA1 cDNA. Position 3025 to 3391. Dark grey shading indicates complete consensus between sequences. Light grey shading indicates similarity between two of the sequences. EgCesA1D is the sequence of the EgCesA1 CDS used in this study. One segment of 23 bp homologous sequence was observed from position 1087 to 1109. 118 CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Table S2.1 Oligonucleotide primers used for qRT-PCR analysis of the EgCesA1 transgene and endogenous Arabidopsis genes Primer name EgCesA1_qRT-PCR_B_Forward EgCesA1_qRT-PCR_B_Reverse AtCesA1_qRT-PCR_Forward AtCesA1_qRT-PCR_Reverse AtCesA2_qRT-PCR_B_Forward AtCesA2_qRT-PCR_B_Reverse AtCesA3_qRT-PCR_Forward AtCesA3_qRT-PCR_Reverse AtCesA4_qRT-PCR_Forward AtCesA4_qRT-PCR_Reverse AtCesA7_qRT-PCR_Forward AtCesA7_qRT-PCR_Reverse AtCesA8_qRT-PCR_ Forward AtCesA8_qRT-PCR_Reverse CYT1_qRT-PCR_Forward CYT1_qRT-PCR_Reverse KORRIGAN_qRT-PCR_Forward KORRIGAN_qRT-PCR_Reverse COBRA_qRT-PCR_Forward COBRA_qRT-PCR_Reverse KOBITO_qRT-PCR_Forward KOBITO_qRT-PCR_Reverse THESEUS_qRT-PCR_Forward THESEUS_qRT-PCR_Reverse AtCAD4_qRT-PCR_Forward AtCAD4_qRT-PCR_Reverse AtCAD5_qRT-PCR_Forward AtCAD5_qRT-PCR_Reverse FRA8_qRT-PCR_Forward FRA8_qRT-PCR_Reverse SUS1_qRT-PCR_Forward SUS1_qRT-PCR_Reverse SUS4_qRT-PCR_Forward SUS4_qRT-PCR_Reverse SPS_qRT-PCR_Forward SPS_qRT-PCR_Reverse SPP_qRT-PCR_Forward SPP_qRT-PCR_Reverse At. number AT4G32410 AT4G32410 AT4G39350 AT4G39350 AT5G05170 AT5G05170 AT5G44030 AT5G44030 AT5G17420 AT5G17420 AT4G18780 AT4G18780 AT2G39770 AT2G39770 AT5G49720 AT5G49720 AT5G60920 AT5G60920 AT3G08550 AT3G08550 AT5G54380 AT5G54380 AT3G19450 AT3G19450 AT4G34230 AT4G34230 AT2G28110 AT2G28110 AT5G20830 AT5G20830 AT3G43190.1 AT3G43190.1 AT1G04920.1 AT1G04920.1 AT2G35840.1 AT2G35840.1 119 Primer sequence (5’→3’) CTGCGATCTGCCTCCTTACT TGGTGTCTAGGCCAGCTAAC GTTCTTCTCGCCTCCATCTT TTCACCTTCTCTGGCTACTC CGTTGCCTCTGCTGTTCTAC TGCACGCTTAGGCATACAGT GAGTTGTTGCAGGAGTCTCT CAGTGACTCGGCTAGTGAAG TTGGTGTTGTTGCCGGAGTT AACAGTCGACGCCACATTGC CGTTGTTGCAGGCATCTCAG AGCAGTTGATGCCACACTTG TGGAGGTGTCTCAGCTCATC CGACGACTCCGACCAAGTTA TTGGACCAGACGTTGCCATT TCCTCACCGAGGATCGTCAT ACCGACTCTTGCAGGCAATG TTGGCAGCAGCGACAGAATC TAGAGTCCACTGGCACGTTA CCTGAAGGTCCAGCTTCCAT AGCAACTCATCCAGGTCTAC ATGCATCAGCTCCGTGCTAA TGGAGTACGCGTTACAGCTA TCTACCTTCCACGAGGATGA ATTGACACCGTACCGGTGTT ATCGTTCTTGCGAAGCCTCT AATTGACACGGTGCCTGTTC AACGCACATCGTTCTTCTCG GGTGGCTCTTGGCTGTGTTC CCGCCTAACAGACGGATCCT GGTGATCAGGCTGCTGATAC CCTCAAGACGGTCAAGGTTC ATGGTGACAAGGCAGCTGAG AGCAAGAGGAACAGCTTGAG ATGTGGCGAACATGTACGTG ACCGGTGAATCAACCTTGAG GATCAAGTCCTGGCAACAGA CTCAGATGATCCAGCTGCTA CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Table S2.2 Oligonucleotide primers used for amplification of putative housekeeping genes Primer name ACT2_qRT-PCR_Forward ACT2_qRT-PCR_Reverse UBQ5_qRT-PCR_Forward UBQ5_qRT-PCR_Reverse UBQ10_qRT-PCR_Forward UBQ10_qRT-PCR_Reverse UBQ10_qRT-PCR_B_Forward UBQ10_qRT-PCR_B_Reverse 18S_qRT-PCR_Forward 18S_qRT-PCR_Reverse EF1_qRT-PCR_Forward EF1_qRT-PCR_Reverse EF1_qRT-PCR_B_Forward EF1_qRT-PCR_B_Reverse TUB4_qRT-PCR_Forward TUB4_qRT-PCR_Reverse TUB6_qRT-PCR_Forward TUB6_qRT-PCR_Reverse At. number AT3G18780 AT3G18780 AT3G62250.1 AT3G62250.1 AT4G05320 AT4G05320 AT4G05320 AT4G05320 18S RRNA 18S RRNA AT1G07920.1 AT1G07920.1 AT1G07920.1 AT1G07920.1 AT5G44340.1 AT5G44340.1 AT5G12250 AT5G12250 120 Primer sequence (5’→3’) TGGAATCCACGAGACAACCT TGGACCTGCCTCATCATACT GGTGGTGCTAAGAAGAGGAA TCGATCTACCGCTACAACAG CTGCGTGGAGGTATGCAGAT CGCAGGACCAAGTGAAGAGT GACCAGCAGAGGTTGATCTT CCGGAGGAATACCTTCCTTG AGTAAGCGCGAGTCATCAGC TCCTTCCGCAGGTTCACCTA ACAGGCGTTCTGGTAAGGAG CCTTCTTGACGGCAGCCTTG GTTGAGATGCACCACGAGTC TCCTTACCAGAACGCCTGTC GAGCGAACAGTTCACAGCTA GCTGCTTGCTTACACAGCTT GTCAAGCGTCTGTGACATAG TCATACTCGCCTTCGTCATC CONSTITUTIVE EXPRESSION OF EUCALYPTUS GRANDIS EgCesA1 IN ARABIDOPSIS THALIANA Table S2.3 Sequence results of bulked qRT-PCR products analysed using BLAST PCR product BLAST hit Score (Bits) E value AtCesA1 AtCesA1 324 4.00E-88 AtCesA2 AtCesA2 250 1.00E-61 AtCesA3 AtCesA3 350 8.00E-96 AtCesA4 AtCesA4 414 4.00E-115 AtCesA7 AtCesA7 172 4.00E-42 AtCesA8 AtCesA8 268 2.00E-71 CYT1 CYT1 267 1.00E-70 KORRIGAN KORRIGAN 283 7.00E-76 COBRA IRX6 / COBL4 532 1.00E-150 KOBITO KOBITO 257 4.00E-68 THESEUS THESEUS 355 2.00E-97 AtCAD4 AtCAD4 379 1.00E-104 AtCAD5 AtCAD5 237 1.00E-61 FRA8 FRA8 291 6.00E-78 SUS1 SUS1 154 9.00E-37 SUS4 SUS4 300 2.00E-42 SPS SPS3F 302 3.00E-81 SPP SPP 268 4.00E-71 EF1 A EF1α 331 3.00E-90 EF1 B EF1α 320 3.00E-42 UBQ10 A UBQ10 475 3.00E-133 UBQ10 B UBQ10 360 2.00E-37 121 CONCLUDING REMARKS CONCLUDING REMARKS In order to alter cellulose biosynthesis in plant cell walls certain questions need to be addressed: How do cellulose microfibrils and other cell wall polymers interact? How do CESA proteins assemble to form rosette complexes? Can cellulose biosynthesis be increased by over-expressing a single CesA gene? Will constitutive expression of a secondary cell wall Eucalyptus CesA gene in Arabidopsis affect xylem cell wall morphology, cell wall chemistry and expression levels of endogenous genes involved in cell wall biosynthesis pathways? Should the transgenic CesA gene be expressed in a tissue specific manner using a xylem specific promoter? This M.Sc study has succeeded in constitutively expressing a Eucalyptus CesA gene, EgCesA1, in wild-type Arabidopsis thaliana plants. Three transgenic lines were generated, but microscopic analysis of the cell wall phenotype of transgenic plants expressing EgCesA1 in comparison to wild-type control plants did not reveal significant morphological changes. Analysis of the chemical composition of inflorescence stem cell walls revealed decreased levels of glucose, xylose and lignin in all three transgenic lines compared to wild-type control plants. However, the observed differences in cell wall chemistry were not as severe as those detected in plants with mutated CesA genes (Taylor et al., 2003; Zhong et al., 2003), or plants with defective hemicellulose synthesis (Brown et al., 2005). Constitutive expression of EgCesA1 did, therefore, not significantly affect cell wall chemistry in transgenic lines. Quantitative gene expression analysis revealed high levels of variation among biological replicates of wild-type control and transgenic plants. Transgenic line MO2 had especially high biological variation in expression levels of all the genes analysed. Chemical composition of MO2 cell walls did not differ significantly from the other transgenic lines. The quality or concentration of first strand cDNA used for one biological replicate of MO2 could have been insufficient for the experiment. Therefore, MO2 was excluded when comparisons were drawn between transgenic and wild-type gene expression levels. In order to reduce the incidence of Type II errors, future quantitative real-time PCR analysis should include at least three biological replicates of transgenic and wild-type control lines (Willems et al., 2008). 123 CONCLUDING REMARKS Relative expression levels of endogenous secondary cell wall associated CesA genes (AtCesA4, AtCesA7 and AtCesA8, Taylor et al., 2003) in upper and lower stems of MO3 were lower than in the wild-type control plants. This is in contrast to EgCesA1 relative expression levels that were highest in MO3. One possible explanation for this observation could be post-transcriptional gene silencing (PTGS) (Hammond et al., 2000). Expression levels above a threshold value could trigger PTGS of gene transcripts with gene sequences homologous to EgCesA1. EgCesA1 expression levels in MO1 could have been below such a threshold and could, therefore, not have induced PTGS. The observed increase in expression of AtCesA4 and AtCesA8 in upper stems (inflorescence stem above lowest leaf) of MO1 could reflect a reaction of MO1 plants to the expression of EgCesA1 when primary and secondary cell walls are actively deposited. However, transcript abundance profiles of endogenous secondary cell wall CesA genes and profiles of EgCesA1 transcript abundance did not reveal any consistent correlations. Taking into account the high biological variability, it cannot be concluded that EgCesA1 expression significantly influenced endogenous gene expression levels. Four possible hypotheses exist for why EgCesA1 expression did not influence cellulose biosynthesis. First, it is possible that EgCesA1 was successfully transcribed but not translated. Although every measure was taken to ensure that functional protein could form from the EgCesA1 coding sequence (CDS) transcript, Western blot analysis would have had to be done to confirm that EgCESA1 protein formed. Since no antibody for EgCESA1 was available, Western blot analysis could not be performed. Another hypothesis assumes that EgCESA1 protein formed, but that it did not incorporate into the endogenous cellulose synthase rosette complexes. This would occur if EgCESA1 did not interact correctly with endogenous CESA proteins. The amino acid change from a glutamate to a lysine residue could have affected incorporation of EgCESA1 protein into rosettes. The residue is conserved between homologues of EgCesA1, but this could be because it is situated next to a highly conserved aspartate residue. Protein-tagging of EgCESA1 with a fluorescent reporter protein could elucidate the sub-cellular localization of EgCESA1. Fluorescent protein-tagging of CESA proteins have been 124 CONCLUDING REMARKS shown to result in functioning CESA proteins (Gardiner et al., 2003; Taylor et al., 2004). Since rosettes are assembled at the Golgi-apparatus and then transported intact to the plasma membrane (Haigler and Brown, 1986), it could be argued that localization of the fluorescent tag to the Golgiapparatus only would indicate that EgCESA1 is not successfully incorporated into the rosette, whereas localization of the fluorescent tag to the plasma membrane and the Golgi-apparatus could indicate that EgCESA1 is incorporated into rosettes. The third hypothesis assumes that EgCESA1 protein forms and incorporates into the endogenous rosette complexes, but does not function correctly. In a similar study, over-expression of AtCesA7 with a missense mutation (fra5) in wild-type Arabidopsis resulted in severely decreased cellulose biosynthesis. This was hypothesised to be caused by the competitive incorporation of the mutated AtCESA7 instead of the endogenous protein (Zhong et al., 2003). In the same study overexpression of a missense mutated AtCesA8 gene was tested to determine if it had the same effect, but no severe phenotype was observed. The authors did, however, not provide evidence for this observation. AtCesA8 is the Arabidopsis orthologue of EgCesA1 (Ranik and Myburg, 2006). This could explain why no severe phenotypic changes were observed when EgCesA1 was over-expressed. Alternatively, the lack of phenotypic change could be explained by the fourth hypothesis; again it is assumed that EgCESA1 protein forms and incorporates into the rosettes, but the EgCESA1 protein is assumed to function correctly in conjunction with the endogenous CESA proteins. The reason why no change in cellulose synthesis is observed is because up-regulation of one CesA gene is insufficient to induce assembly of more rosettes. Mutant complementation could be used to test the third and fourth hypotheses. Complementation of the corresponding Arabidopsis mutant (irx1) by over-expressing EgCesA1 would provide support for the fourth hypothesis, while lack of complementation of EgCesA1 in irx1 would provide support for the first three hypotheses. Although future work is required to further elucidate the function of EgCesA1 in Arabidopsis, this study does not support the hypothesis that cellulose biosynthesis can be manipulated by overexpression of a single CesA gene. CESA protein phosphorylation and subsequent degradation has been shown to occur when CesA protein levels exceed normal wild-type levels (Taylor, 2007). Thus, 125 CONCLUDING REMARKS even over-expression of multiple CesA genes might not result in increased cellulose biosynthesis. Another limitation may be the lack of available UDP-glucose monomers. It stands to reason that multiple genes involved in cellulose biosynthesis, not just the CesA genes, may need to be manipulated in order to increase the cellulose content in xylem cell walls. Manipulation of expression levels of transcription factors that induce genes involved in cellulose biosynthesis could result in increased cellulose content (Grotewold, 2008). MYB46 is a transcription factor that increases expression of AtCesA7 and AtCesA8 when over-expressed (Zhong et al., 2007a). Other transcription factors that induce expression of genes involved in cellulose biosynthesis include NAC transcription factors, NST1 and SND1 (Zhong et al., 2006; Zhong et al., 2007b), but these transcription factors also induce expression of genes involved in lignin- and xylan biosynthesis. SND2, SND3 and MYB103 have recently been shown to induce cellulose biosynthetic pathway genes in cells undergoing secondary cell wall deposition (Zhong et al., 2008). Over- expression of the individual genes that transcribe these transcription factors resulted in increased cellulose content in secondary cell walls of Arabidopsis. All three of the transcription factors were shown to increase AtCesA8 expression when over-expressed. Manipulation of expression levels of three CesA genes, carbon flux regulatory genes or transcription factors like SND2, SND3, MYB103 and MYB46 could result in increased cellulose biosynthesis. Future research will aim to determine which of these strategies is best for increased cellulose biosynthesis and by how much can cellulose biosynthesis increase before normal plant development is affected. References Brown, D.M., Zeef, L.A.H., Ellis, J., Goodacre, R., and Turner, S.R. (2005). Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17, 2281-2295. 126 CONCLUDING REMARKS Gardiner, J.C., Taylor, N.G., and Turner, S.R. (2003). Control of cellulose synthase complex localization in developing xylem. Plant Cell 15, 1740-1748. Grotewold, E. (2008). Transcription factors for predictive plant metabolic engineering: Are we there yet? Current Opinion in Biotechnology 19, 138-144. Haigler, C.H., and Brown, R.M. (1986). Transport of rosettes from the Golgi-apparatus to the plasma membrane in isolated mesophyll cells of Zinnia elegans during differentiation to tracheary elements in suspension-culture. Protoplasma 134, 111-120. Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293-296. Ranik, M., and Myburg, A.A. (2006). Six new cellulose synthase genes from Eucalyptus are associated with primary and secondary cell wall biosynthesis. Tree Physiology 26, 545–556. Taylor, N.G. (2007). Identification of cellulose synthase AtCESA7 (IRX3) in vivo phosphorylation sites - A potential role in regulating protein degradation. Plant Molecular Biology 64, 161-171. Taylor, N.G., Gardiner, J.C., Whiteman, R., and Turner, S.R. (2004). Cellulose synthesis in the Arabidopsis secondary cell wall. Cellulose 11, 329-338. Taylor, N.G., Howells, R.M., Huttly, A.K., Vickers, K., and Turner, S.R. (2003). Interactions among three distinct CESA proteins essential for cellulose synthesis. Proceedings of the National Academy of Sciences of the United States of America 100, 1450-1455. Willems, E., Leyns, L., and Vandesompele, J. (2008). Standardization of real-time PCR gene expression data from independent biological replicates. Analytical Biochemistry 379, 127-129. Zhong, R., Demura, T., and Ye, Z.H. (2006). SND1, a NAC domain transcription factor, is a key regulator of secondary wall synthesis in fibers of Arabidopsis. Plant Cell 18, 3158-3170. Zhong, R., Richardson, E.A., and Ye, Z.H. (2007a). The MYB46 transcription factor is a direct target of SND1 and regulates secondary wall biosynthesis in Arabidopsis. Plant Cell 19, 27762792. Zhong, R., Richardson, E.A., and Ye, Z.H. (2007b). Two NAC domain transcription factors, SND1 and NST1, function redundantly in regulation of secondary wall synthesis in fibres of Arabidopsis. Planta 225, 1603-1611. 127 CONCLUDING REMARKS Zhong, R., Lee, C., Zhou, J., McCarthy, R.L., and Ye, Z.H. (2008). A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant Cell 20, 2763-2782. Zhong, R.Q., Morrison, W.H., Freshour, G.D., Hahn, M.G., and Ye, Z.H. (2003). Expression of a mutant form of cellulose synthase AtCesA7 causes dominant negative effect on cellulose biosynthesis. Plant Physiology 132, 786-795. 128