Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Public health genomics wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Designer baby wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Helitron (biology) wikipedia , lookup
Genetically modified crops wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Microsatellite wikipedia , lookup
Microevolution wikipedia , lookup
Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135 AENSI Journals Journal of Applied Science and Agriculture ISSN 1816-9112 Journal home page: www.aensiweb.com/JASA Foreground Selection of BC1F1 Families derived from MR 264 x Pongsu Seribu 2 using SSR marker 1 H. Nor’Aishah, 2Y.Mohd Rafii, 3H. Abdul Rahim, 4A. Shamsiah, 2A. Latif, 2S. Askhani 1 Faculty of Applied Science, Universiti Teknologi MARA, 72000 Kuala Pilah, Malaysia. Institutes of Tropical Agriculture, Universiti Putra Malaysia, 43600, Serdang, Malaysia. 3 Division of Agrotechnology and Bioprocess, Agency Nuclear Malaysia, 43000, Kajang, Malaysia. 4 Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA, 40450, Shah Alam, Malaysia. 2 ARTICLE INFO Article history: Received 25 July 2014 Received in revised form 8 July 2014 Accepted 15 September 2014 Available online 17 October 2014 Keywords: Blast Heterozygous MR 264 Marker-assisted backcrossing Pongsu Seribu 2 ABSTRACT Background: Blast is considered as an essential threat towards food security which gives significant losses to yield loss in rice production worldwide. Marker-assisted backcrossing is one of the reasonable approaches to develop a new resistant variety to confront with this challenge. Objective: The prime aim of this study was to identify the introgressed line in backcross population using selected foreground marker. Results: Crossing was conducted in Greenhouse of Agency Nuclear Malaysia (ANM) between MR 264 and Pongsu Seribu 2. MR 264 was identified as recipient parent while Pongsu Seribu 2 as donor parent for resistance gene. A total of 20 F1 seeds were successfully produced and subsequently backcrossing was done and produced a total of 36 BC1F1 seedlings. Foreground selection was performed with tightly linked marker towards pigene to 23 BC1F1 plants. Marker RM 413 which tightly linked with pi-21 demonstrated 6 heterozygous (score as “H”) out of 23 backcrossed plants. Conclusion: These selected genotypes were further used for recombinant and background selection with appropriate markers for further generation in development of stable blast resistant rice genotypes. © 2014 AENSI Publisher All rights reserved. To Cite This Article: H. Nor’Aishah, Y.Mohd Rafii, H. Abdul Rahim, A. Shamsiah, A. Latif, S. Askhani., Foreground Selection of BC1F1 Families derived from MR 264 x Pongsu Seribu 2 using SSR marker. J. Appl. Sci. & Agric., 9(18): 132-135, 2014 INTRODUCTION Rice is the primary and vital food crops for more than 2.7 billion people in South and Southeast Asia (Hossain, 2005). In Malaysia, rice grows in 2 major seasons and occupied 389,544 ha area (Paddy Statistic of Malaysia, 2011). Currently, blast disease is one of the major obstacles hampering rice production. Blast disease caused by Magnaporthe oryzae affected most of the growing rice countries including Malaysia and approximately 1049 hectares land was destroyed. Recent outbreak had been reported at MADA, Kedah, resulted 20-40% or 2.2 tan metric/hectare of yield losses (MADA, 2013). Due to this concern, more research and technology advancement should be made to help the poor farmers and developing countries whose totally depends on the rice as their source of energy. The instability of blast fungus can be threatened by the development of blast resistant cultivar. Over the decade, conventional methods had been practiced by the breeders to develop the blast resistant variety. However, it is tedious, time consuming and mostly dependent on environment. Currently, breeders are using a molecular approach that is easier, highly efficient and environmental friendly to manage the disease (Miah et al., 2013). In this method, a broad spectrum of resistance gene (qualitative or quantitative) is incorporate in resistance variety to develop durable blast resistant cultivar. Prior technology such as the development of tightly linked molecular markers had made it possible to pyramid major gene into one genotype and simultaneously select several complex characters. Marker assisted backcrossing offers a greatly approaches in improving the selection strategies in rice breeding (Mondal et al., 2013). Currently, SSRs are predominantly being used to map and introgress agronomically important Quantitative Trait Loci (QTLs) into popular varieties using Marker-Assisted Backcrossing (MABC).SSR or microsatellite markers are proved to be ideal for making genetic maps (Islam, 2004; Niones, 2004), assisting selection (Bhuiyan, 2005) and studying genetic diversity in crop germplasm. Microsatellite marker analysis is promising to identify major gene locus for blast resistant that can be helpful for plant breeders to develop new cultivars However, their use is still limited due to lack of sufficient polymorphism particularly within related genotypes, labour requirements and cost of application. In addition, SSR markers Corresponding Author: H. Nor’Aishah, Faculty of Applied Science, Universiti Teknologi MARA, 72000 Kuala Pilah, Malaysia, Tel: 60-0126922863 H. Nor’Aishah et al, 2014 133 Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135 have a low potential for multiplexing and require lengthy periods of time to genotype many markers as during the initial background selection in the marker-assisted backcrossing protocol (Thomson et al., 2010). Therefore in this study our aim is to identify the introgress lines of backcrossed population in MR 264 and Pongsu Seribu 2 using specific foreground marker. Methodology: 1.1 Plant Material: Two local rice varieties of Pongsu Seribu 2 and MR 264 were obtained from Malaysia Nuclear Agency and were used for hybridization to produce 98 F1 seeds. Subsequently 20 identified F 1 seeds were crossed with MR 264 to produce BC1F1 seeds (Figure 1). Among these seeds, 36 seeds were germinated in the experimental field. Only 23 seedlings were selected to collect the leaf samples to apply foreground selection using SSR markers. Normal and reciprocal crosses were conducted according to Virmani and Sharma, 1992 with some modification. Complete NPK were introduced to plants with recommended doses. 1. Fig. 1: BC1F1 families grown in greenhouse. 1.2 Extraction: Three weeks young and fresh leaves were collected to extract genomic DNA using modified CTAB method. Two grams of leaf samples were chopped into small pieces and were added with 5 ml extraction buffer prior to ground in Tissue Lyser (QIAGEN, Germany) for 2 minutes. Samples then were precipitated using 70% ethanol. Dried DNA pellet was re-suspended in 1xTE buffer. Concentration of DNA was measured by NanoDrop spectrophotometry while DNA quality was checked by 1.5% agarose gel electrophoresis at 90 V for 30 minutes. Separation of DNA fragments was visualized under UV light. 1.3 Polymorphism survey for primer selection: Polymorphism survey of parental plants was carried out and foreground selection of 23 BC1F1 plants were screened with marker tightly linked with pi-gene. 1.4 PCR Amplification: PCR assay was performed in a program; 30 cycles of denaturation at 94°C for 1 minute, annealing for 1 minute at 55°C and polymerization at 72°C for 2 minutes. Final elongation was at 72°C for 7 min. The amplification products were analyzed by electrophoresis in a 3.0 % agarose in 1xTBE at 90 V for 1 hour. Gels were stained with ethidium bromide. The amplified fragments were visualized with UV transilluminator. The 100 bp DNA ladder was used as a DNA size marker. Primer PCR product size (bp) Sequence (5’ – 3’) Position Repeat motif Annealing Temperature (oC) RM 413 79 F:GGCGATTCTTGGATGAAGA G R:TCCCCACCAATCTTGTCTTC 5 (AG)11 55 1.5 Data Analysis: The pattern of bands obtained after amplification with primers was scored with reference to two parents. Bands having same level with MR 264 was scored A, bands similar with Pongsu Seribu 2 was scored B. H was scored for bands having both parents. Size of bands (molecular weight, bp) was determined using Alpha Ease FC 5.0 software based on migration relative to 100bp DNA ladder. 2. Results: Marker Assissted Backcrossing (MAB) was performed in this study in order to maximize the recovery of all desirable trait of recurrent parent, MR 264. Table 2 demonstrated the characteristic of MR 264 in comparison with Pongsu Seribu 2. MR 264 possesses lesser days to flowering and lower plant height compared to Pongsu Seribu 2. Polymorphism survey is an essential requirement before conducting MAB. For further successful foreground and background selection, polymorphic marker needs to cover the entire genome of rice chromosome. In this study, a total of 98 SSR marker tightly linked with pi gene were selected and screened for H. Nor’Aishah et al, 2014 134 Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135 polymorphism between both parents. Out of 98 markers, only 14 markers showed a polymorphism and considered as foreground marker. Table 3 demonstrated the foreground marker in this study. Table 2: Characteristics of local varities, MR 264 and Pongsu Seribu 2. Charactertistic MR 264 Plant height Semi dwarf Seed Long Panicle High Grain yield High Blast Disease Susceptible Days to flowering 113 days Pongsu Seribu 2 Tall Medium long Small Low Resistant 150 days Table 3: Foreground markers for MR 264 and Pongsu Seribu 2 population. Primer RM 495 RM 1 RM 140 RM 1167 RM 462 RM 250 RM 148 RM 303 RM 413 RM 296 RM 3912 RM 244 RM 206 RM 101 Sequence Forward AATCCAAGGTGCAGAGATGG GCGAAAACACAATGCAAAAA TGCCTCTTCCCTGGCTCCCCTG GAACATAAACCATGCGGGAG ACGGCCCATATAAAAGCCTC GGTTCAAACCAAGCTGATCA ATACAACATTAGGGATGAGGCTGG GCATGGCCAAATATTAAAGG GGCGATTCTTGGATGAAGAG CACATGGCACCAACCTCC TGTGTGCCCGATCTACCC CCGACTGTTCGTCCTTATCA CCCATGCGTTTAACTATTCT GTGAATGGTCAAGTGACTTAGGTGGC Reverse CAACGATGACGAACACAACC GCGTTGGTTGGACCTGAC GGCATGCCGAATGAAATGCATG AGCTAGTGGCAAAAGTGTGC AAGATGGCGGAGTAGCTCAG GATGAAGGCCTTCCACGCAG TCCTTAAAGGTGGTGCAATGCGAG GGTTGGAAATAGAAGTTCGGT TCCCCACCAATCTTGTCTTC GCCAAGTCATTCACTACTCTGG CCCCCATCCCCACTAAATAC CTGCTCTCGGGTGAACGT CGTTCCATCGATCCGTATGG ACACAACATGTTCCCTCCCATGC Annealing Temperature (OC) 55 55 55 55 55 55 55 55 55 55 55 55 55 55 In this study, out of 14 foreground marker, only RM 413 tightly linked with pi-21 were demonstrated a highly reproducible band with BC1F1 families. Figure 2 showed the band scoring with RM 413 when electrophoreses with 3% agarose gel. A total of 6 plants were detected with H indicated the heterozygous plants. Three plants were detected as B, showed a similar bands of Pongsu Seribu 2 while eleven plants followed MR 264. However, there are 3 plants failed to showed any bands and were recorded as AB (Table 4). Table 4: Twenty three BC1F1 families with respects to the alleles amplified by microsatellite marker. Primers Total no. of parental BC1F1 families Pattern of BC1F1 families Resistant type Susceptible type Heterozygous (PS 2) (MR 264) RM 413 23 3 11 6 Fig. 2: Marker banding patterns in BC1F1 families for SSR marker; RM 413 electrophoresed on 3% agarose gel. Lane M: 100 bp DNA ladder; Lane A: MR 264; Lane B: PS2; Lanes 1 -12: progenies; Lane N: Negative control. Discussion: In this study, MR 264 was used as recurrent parent and Pongsu Seribu 2 was act as donor parent. According to Ashkani et al., 2013, Pongsu Seribu 2 had known as traditional variety that consists a resistance towards blast disease. MR 264 was an advance mutant line (300 Gy) of Khao Dok Mali derived from a breeding program of Malaysian Nuclear Agency. MR 264 is susceptibility to panicle blast and not release to the farmer therefore an attempt had been made to produce families of BC1F1 by introgressed the resistance gene from Pongsu Seribu 2 while retains the characteristic of, MR 264 which produces more yields. 135 H. Nor’Aishah et al, 2014 Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135 Polymorphic assay was very essential in order to select the foreground marker that tightly linked with pigene between these populations. Polymorphic markers are defined as a type of marker that can distinguish between two parental genotypes, in this study MR 264 and Pongsu Seribu 2 (Alam et al., 2012). Twenty three (n=23) BC1F1 families were develop from Marker Assisted Backcrossing method from F1 families (MR 264 x Pongsu Seribu 2) with recurrent parent, MR 264. Foreground selection were assayed using SSR markers which distributed entire 12 rice chromosome. A total of 14 markers showed polymorphism by producing a reproducible and clearly discriminate band in both parental varieties. Those markers also were reported as highly polymorphic in Mahsuri x Pongsu Seribu 2 for blast disease tolerant in the study made by Ashkani et al., 2012 and was confirmed by NorÁishah et al., 2013 in his preliminary study with F1 families. El-rafaee et al., (2006) also reported that 80% of the tested SSR markers showed polymorphic pattern in rice population using Binadhan-7 x FL-378. Among 14 polymorphic markers, only markers RM 413 showed a wide variation in BC1F1 families. Table 2 demonstrated the banding pattern (allelic score) of BC1F1 families by using both parents as a control. Primer RM 413 indicated 6 lines were introgressed and 11 lines as susceptible in comparison with blast resistant parent, Pongsu Seribu 2 and susceptible parent, MR 264. Conclusion: RM 413 was successfully identified the introgressed rice line in BC1F1 families. RM 413 marker can be further used as a foreground marker to facilitate the screening for development of blast resistant variety. ACKNOWLEDGEMENT The authors are grateful to Universiti Teknologi MARA and Malaysian Nuclear Agency for the facilities, support and financial aids during the research work. Research was supported by FRGS (600-RMI/FRGS 5/3 (151/2013) REFERENCE Ashkani, S., M.Y. Rafii, H. Abdul Rahim and M.A. Latif, 2013. Mapping of the quantitative trait locus (QTL) conferring partial resistance to rice leaf blast disease. Biotechnol Lett., 35: 799-810. Bhuiyan, M.A.R., 2005. Efficiency in evaluating salt tolerance in rice using phenotypic and marker assisted selection. M.S. Thesis, Department of Genetics and Plant Breeding, Bangladesh Agricultural University, Mymensingh, Bangladesh, 96. El-Rafaee, Y.Z., M. Atallah, M.L. Savo and E. Porceddu, 2006. Fine QTLs mapping for salinity tolerance in rice. Proc 50th Italian Soc. Agric. Genetics Annual Congress. Ischia Italy,ISBN 88-900622-7-4. Hossain, M.M., M.M. Islam, H. Hossain, M.S. Ali, J.A. Teixeira da Silva, A. Komamine, S.H. Prodhan, 2012. Genetic diversity analysis of aromatic landraces of rice (Oryza sativa L.) by microsatellite markers. Genes, Genomes and Genomics, 6: 42-47. Islam, M.M., 2004. Mapping salinity tolerance genes in rice (Oryza sativa L.) at reproductive stage. Ph. D. Dissertation. University of the Philippines Los Baños, College, Laguna, Philippines, 149. Miah, G., M.Y. Rafii, M.R. Ismail, A.B. Puteh, H.A. Rahim, R. Asfaliza, M.A. Latif 2013. Blastresistance in rice: a review of conventional breeding to molecularapproaches. Mol Biol Rep, 40: 2369-2388. Niones, J.M., 2004. Fine mapping of the salinity tolerance gene on chromosome 1 of rice (Oryza sativa L.) using near-isogenic lines. M. S. dissertation. University of the Philippines Los Baños, College, Laguna, Philippines, 78. MADA, 2013. Laporan Pemantauan projek IRPA. Mondal, K.T. and A.G. Showkat, 2013. Identification and Characterization off salt-responsive miRNA-SSR markers in rice (Oryzae sativa). Genes, 535(2): 204-209. Nor’Aishah, H., H. Abdul Rahim, A.R. Khairuddin, H. Sobri, M.N. Norain and M.Z. Nursamahah, 2013. “ Assessment of Purity of F1 Plants Derived from the Cross of MR264 and Pongsu Seribu 2 Using Microsatellite Markers”, International Conference on Sustainable Environment and Agriculture IPCBEE. 57 pp. 1-3. DOI: 10.7763/IPCBEE. Thomson, M.J., A.M. Ismail, S.R. McCouch, M.J. Mackill, 2010. Marker Assisted Breeding (Chap. 20), Abiotic Stress Adaptation in Plants: Physiological, Molecular and Genomic Foundation, 451-469. Paddy Statistic of Malaysia, 2011. Laporan Statistik Padi di Malaysia.