Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Lymphopoiesis wikipedia , lookup
Psychoneuroimmunology wikipedia , lookup
Adaptive immune system wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Cancer immunotherapy wikipedia , lookup
Molecular mimicry wikipedia , lookup
Immunosuppressive drug wikipedia , lookup
LIPOPOLYSACCHARIDE-MEDIATED REGULATION OF IL-17 RECEPTOR LEVELS IN HUMAN MONOCYTES by Xiubo Zhang A thesis submitted to the Department of Microbiology and Immunology In conformity with the requirements for the degree of Master of Science Queen’s University Kingston, Ontario, Canada (June, 2011) Copyright ©Xiubo Zhang, 2011 Abstract IL-17 promotes inflammation through the recruitment of monocytes and induction of various chemokines and inflammatory cytokines. Monocytes respond to IL-17 through the heteromeric IL-17 receptor (IL-17R) composed of subunits IL-17RA and IL17RC. Together, monocytes and IL-17 amplify inflammation. Controlling the cellular response to IL-17 is crucial to prevent hyperactivation of inflammatory responses, which could lead to chronic inflammatory diseases. The cellular response to increased IL-17 levels may be limited by controlling the receptor levels. Before we understand how monocytes respond to IL-17 during infection, we must first characterize the expression of IL-17R in these cells in response to LPS, a well-characterized pro-inflammatory signal. The aim of this study is to understand the mechanisms which regulate IL-17R levels in human monocytes. IL-17R mRNA and protein levels were measured in response to LPS by RT-PCR and Western blot analysis in primary human monocytes, peripheral blood mononuclear cells (PBMC), and the human monocytic cell line, THP-1. LPS enhanced IL-17RA and RC transcript levels in monocytes and PBMC. protein levels decreased with LPS treatment in these cells. In contrast, IL-17RA Investigation into mechanisms regulating IL-17RA protein levels lead to the observation that IL-17RA undergoes receptor degradation in response to LPS. This work identifies for the first time that 1) LPS enhances transcript levels of IL-17R and 2) after LPS treatment, IL-17RA protein levels are reduced via an endosome-dependent degradation pathway. ii Acknowledgements I would like to express my deepest gratitude towards my supervisor Dr. Katrina Gee who made research an adventure and the three years an absolute joy that was complemented with continuous challenges. I don’t know where I would be without her guidance and support. My graduate experience was also significantly shaped my committee members: Dr. Bruce Banfield and Dr. Nancy Martin. Their valuable input and critiques have strengthened me as a budding scientist and as a person. A big thank you to Dorothy Agnew, our phlebotomist, without whom, I would not have had my precious blood and cells to get the data I needed. I would also like to thank Dr. Banfield’s lab for the use of various antibodies and allowing me to use their pH meter, and Dr. Basta’s lab for the use of the Varioskan reader and their chemical hood. My experience would also have not been complete without the technical and administrative support of Jerry, Chris and Jackie. Who can forget my wonderful labmates Christina Guzzo and Ila Che Mat who showed me how to do nearly all the experimental techniques in my degree since my time as a summer undergraduate NSERC student? Words are not sufficient to express my gratitude. I believe everything happens for a reason, and it is for a reason that our paths have crossed. I will never forget your kindness hidden beneath the constant abuse. Although our academic years have come to an end, our friendship will last a lifetime. I couldn’t be prouder to be a member of the loudest lab on the floor. iii Also thanks to other past and present members of the Gee lab: Brandon Davidson, our technician, Amit Ayer, a fellow 499 student, and Taylor and Sarah, our past 499 students for making it all so much fun. Thanks to Sarah, Alanna and Julia, and all my departmental friends for all the laughter and the joy you’ve given me. A special thank for all the treats, especially from Valerie that kept me going till the end of the day. I couldn’t have survived without them, literally. Finally, I would like to thank my parents whom I dedicate this work to. Thank you for the constant criticism that motivated me to want to prove you wrong. Thank you for keeping my feet on the ground and making me understand that only through hard work can you achieve your dreams. iv Table of Contents Abstract ............................................................................................................................... ii Acknowledgements ............................................................................................................ iii Table of Contents ................................................................................................................ v List of Figures ................................................................................................................... vii List of Tables ................................................................................................................... viii List of Abbreviations ......................................................................................................... ix Chapter 1 Introduction ........................................................................................................ 1 Chapter 2 Literature Review ............................................................................................... 4 2.1 IL-17/Th17 discovery ............................................................................................. 4 2.2 IL-17 family members ............................................................................................ 6 2.3 Innate sources of IL-17 ........................................................................................... 8 2.4 IL-17 function ..................................................................................................... 11 2.5 The IL-17R receptor family .................................................................................. 13 2.6 IL-17 receptor structure ........................................................................................ 14 2.7 IL-17R signaling ................................................................................................... 16 2.8 Receptor regulatory mechanisms .......................................................................... 19 2.9 Role of IL-17 in disease ........................................................................................ 25 2.10 Rationale, Objectives and Hypothesis ................................................................ 28 Chapter 3 Materials and Methods ..................................................................................... 31 Cell culture and reagents ............................................................................................. 31 Isolation of Primary Monocytes.................................................................................. 31 RNA isolation ............................................................................................................. 32 RT-PCR analysis ......................................................................................................... 33 Concentrating Supernatant Protein ............................................................................. 36 Cell lysis for whole cell protein .................................................................................. 36 SDS-PAGE and Western Blot Analysis ..................................................................... 37 ELISA ......................................................................................................................... 38 Chapter 4 Results .............................................................................................................. 40 v 4.1 IL-17R response to LPS ........................................................................................ 40 4.1.1 LPS induces IL-17RA mRNA expression in primary cells ....................... 40 4.1.2 LPS induces IL-17RC mRNA expression in CD14 THP-1 cells and PBMCs ........................................................................... 41 4.1.3 LPS decreases IL-17RA protein expression in primary cells ..................... 43 4.1.4 IL-17RC protein expression is not affected by LPS................................... 43 4.1.5 IL-6 and TNF-α production increases in response to LPS treatment ......... 47 4.2 Extracellular domain of IL-17RA is not cleaved .................................................. 47 4.3 IL-17RA is degraded in response to LPS stimulation .......................................... 54 4.3.1 Bafilomycin and chloroquine dose optimization........................................ 54 4.3.2 Bafilomycin and chloroquine time administration optimization ................ 58 4.3.3 Bafilomycin and chloroquine pretreatment of cells stimulated with LPS.. 61 Chapter 5 Discussion ........................................................................................................ 64 5.1 Differential IL-17R mRNA upregulation in PMBC, monocytes and CD14 THP-1 cells ............................................................................................................................. 64 5.2 IL-17R mRNA and protein expression dichotomy ............................................... 67 5.3 IL-17R decrease in protein expression ................................................................. 73 5.3.1. Soluble Isoforms........................................................................................ 73 5.3.2 Receptor internalization ............................................................................. 75 5.3.3 Ubiquitination and signaling ...................................................................... 77 5.3.4 Therapeutic uses of soluble IL-17R ........................................................... 78 Chapter 6 Conclusion and Future Directions .................................................................... 81 References ......................................................................................................................... 83 Appendix: published works/co-authored manuscripts ...................................................... 92 vi List of Figures Figure 1: Different T cell lineages from naïve CD4+ T cell engagement with an antigen presenting cell ................................................................................................................. 3 Figure 2: Comparison of Th17 and IL-17 producing innate source development .............. 9 Figure 3: IL-17RA structure and signaling molecules in IL-17 downstream signaling ... 17 Figure 4: C/EBP involvement in positive and negative signaling of IL-17 ...................... 20 Figure 5: Receptor internalization .................................................................................... 24 Figure 6: LPS enhances IL-17 receptor transcript levels in PBMC and human monocytes ..................................................................................................................................... 42 Figure 7: LPS downregulates IL-17RA protein levels in PBMC and monocytes ............ 44 Figure 8: IL-27 and PMA downregulate IL-17RA protein levels in PBMC .................... 46 Figure 9: LPS does not significantly affect IL-17RC levels in PBMC and THP-1 cells.. 48 Figure 10: IL-6 and TNF-α protein levels in PBMC and monocytes detected by ELISA show that cells are still responding properly at 16hr and 24hr ................................... 49 Figure 11: Extracellular domain of IL-17RA is not cleaved and secreted as detected by ELISA and Western blot of concentrated supernatant protein ................................... 52 Figure 12: Bafilomycin and chloroquine treatment of PBMC at 10nM and 100nM, and 5uM and 50uM respectively ....................................................................................... 56 Figure 13: Chloroquine pretreatment of CD14 THP-1 cells was able to increase IL-17RA protein levels ............................................................................................................... 57 Figure 14: Time optimization of bafilomycin and chloroquine treatment in PBMC ....... 59 Figure 15: Bafilomycin treatment of monocytes following LPS pretreatment of 12hr did not increase IL-17RA levels ....................................................................................... 60 Figure 16: In primary monocytes, drug pretreatment followed by LPS increased IL-17RA protein levels ............................................................................................................... 62 Figure 17: Model system of IL-17 receptor regulation .................................................... 82 vii List of Tables Table 1: Sequences of primers and their expected sizes ................................................... 34 Table 2: Cycling conditions for primers .......................................................................... 35 viii List of Abbreviations a.a. Amino acid AMD AU- rich elements mediated decay AP2 Adaptor protein 2 ARE AU- rich elements ARE-BP AU-rich elements binding protein ATP Adenosine triphosphate BAF Bafilomycin BSA Bovine serum albumin CCR Chemokine receptor cDNA Complementary deoxyribonucleic acid C/EBP CCAAT/enhancer binding protein CIA Collagen-induced arthritis CLQ Chloroquine Cxcl1 CXC-chemokine ligand 1 EAE Experimental autoimmune encephalomyelitis ELISA Enzyme-linked immunosorbent assay ERK Extracellular signal-regulated kinase ESCRT Endosomal sorting complex required for transport Foxp3 Forkhead box P1 FRET Fluorescence resonance energy transfer GALT Gut-associated lymphoid tissue G-CSF Granulocyte colony stimulating factor GI Gastrointestinal GM-CSF Granulocyte macrophage colony stimulating factor Groα Growth-regulated oncogene α GTPase Guanosine triphosphatase HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HIV Human immunodeficiency virus ix IFNγ Interferon γ IL Interleukin JAK Janus kinase JNK Jun NH2-terminal kinases kDa Kilodalton KO Knock out L Litre LPS Lipopolysaccharide LTi Lymphoid-tissue inducer MAPK Mitogen-activated protein kinase MCP1 Macrophage chemoattractant protein-1 ml Millilitre M/M Monocytes/Macrophages miRNA Micro RNA mRNA Messenger RNA MS Multiple sclerosis MVB Multivesicular bodies MyD88 Myeloid differentiation primary response gene 88 NFκB Nuclear transcription factor kappa B N.D. Not detected NK Natural killer cells nM Nanomolar PAMP Pathogen-associated molecular pattern PBMC Peripheral blood mononuclear cells PDGF Platelet-derived growth factors PGE Prostaglandin E PI3K Phosphoinositol 3-kinase PKC Protein kinase C PMA Phorbol Myristate Acetate x PPR Pattern recognition receptors RA Rheumatoid arthritis RAG Recombination-activating gene RISC RNA-induced silencing complex RNA Ribonucleic acid RORc Retinoic acid related orphan receptor RT-PCR Reverse transcriptase polymerase chain reaction RUNX Runt-related transcription factor SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis SEFIR SEF/IL-17 receptor siRNA Small interfering RNA SIV Simian immunodeficiency virus STAT Signal transducer and activator of transcription T-bet Th1-specific T box TCR T cell receptor TGF β Transforming growth factor-β Th CD4+ T helper cell TILL TIR-like loop TIR Toll/IL-1R receptor TLR Toll like receptor TNF Tumor necrosis factor TRAF TNF receptor-associated factor 6 Treg Regulatory T cell TTP Tristetraprolin μg Microgram μl Microlitre μM Micromolar xi Chapter 1 Introduction The body defends against pathogens through the coordination of the innate and adaptive immune responses via cytokines. Cytokines are soluble proteins produced by immune cells that play a prominent role in the regulation of immune responses. Cytokine mediated effects range from impacting immune cell migration to sites of injury, to regulating the inflammatory responses, and to determining the differentiation of immune cells. A key player in the adaptive response is the CD4+ T helper (Th) cell. These cells are crucial in mediating specific pathogen responses that come later than the innate response, but are more robust and specific to the pathogen. In 1986, Mossman and Coffman first proposed the model of two distinct species of Th cells: Th1 and Th2[1-2]. It is now known that when a naïve T cell (T0) first engages an antigen offered by an antigen presenting cell via the T-cell receptor (TCR), it can differentiate either to Th1 or Th2 depending on the cytokine milieu. Interleukin (IL)-12 induces transcription factor Tbet for differentiation to Th1 cells, which are involved in cell mediated responses, whereas IL-4 induces GATA 3 transcription factor for production of Th2 cells, which are involved in antibody mediated responses[3]. Additionally, there is a T cell population termed regulatory T cells (Treg) that is immunomodulatory, which is important in maintaining immune system homeostasis and tolerating self-antigens. IL-10 and transforming growth factor β (TGF-β) upregulate Foxp3 transcription factor for Treg 1 differentiation[4]. Recently, a new subset of T cells has emerged, Th17, which is termed after its main effector cytokine IL-17 (Figure 1). IL-17/Th17 cells are drawing attention due to their crucial role in inflammation and autoimmune diseases. IL-17 mediates a stronger inflammatory response than either Th1 or Th2 cytokines through several ways that will be reviewed below. Cellular response to IL-17 is mediated by ligand binding and activation of IL-17 receptor (IL-17R), which initiates the downstream signaling cascade. During infection, monocytes are one of the main mediators of inflammation and these cells are also one of the main immune cells that respond to IL-17. Currently, there is much unknown about IL-17R such as its structure and functional domains, recruitment of signaling molecules and its expression levels during infection. The focus of this thesis is the characterization of IL-17R levels and the post-translational regulatory mechanisms of IL-17R in monocytes, the main immune cell responders to IL-17, in response to LPS. 2 Figure 1: Different T cell lineages from naïve CD4+ T cell engagement with an antigen presenting cell. Th1 and Th2 were the first Th cell subsets to be classified, later followed by the Treg, and finally the Th17 cells. IL-12 which consists of p40 and p35 subunits binds IL-12Rβ1 and IL-12Rβ2 receptor subunits, respectively on naïve T cells to induce Th1 cell differentiation by upregulating the transcription factor T-bet. Th1 cells specialize in cellular immunity and secrete classical Th1 cytokines such as IFN-γ and IL-12. IL-4 drives Th2 cell population differentiation by upregulating the GATA3 transcription factor. Th2 cells secrete IL-4 and IL-5, and specialize in humoral immunity by recruiting B cells and promoting antibody production. IL-10 and TGF-β drive Treg differentiation by inducing the Foxp3 transcription factor. Tregs suppress immune response by secreting anti-inflammatory cytokines such as IL-10, and TGF-β. Finally, Th17 differentiation is driven by the presence of both TGF-β and IL-6. IL-23, which consists of p40 and p19 subunits, binds IL-23 receptor subunits IL-12Rβ1 and IL-23R, respectively, to act as a maturation factor. These cytokines signal through RORc, STAT3, and RUNX-1 to drive Th17 development and increase production of IL-17, the prototypic Th17 cytokine, as well as IL-22 and TNF-. 3 Chapter 2 Literature Review 2.1 IL-17/Th17 discovery: IL-17 was first identified in 1993 as CTLA8, a rodent cDNA transcript[5]. Initially, it was not recognized as a cytokine due to its unusual amino acid sequence, which showed 58% homology to an open reading frame in Herpesvirus saimiri[5-7]. The functional significance of viral IL-17A is unknown. Evidence that suggested IL-17 was an interleukin came when it was found to promote the production of other cytokines and chemokines, such as IL-6, IL-8, and granulocyte colony stimulating factor (G-CSF) from various cell types including cells such as epithelial, endothelial cells, and fibroblasts [89]. While IL-17 was first discovered in 1993, focus on the cytokine did not come until 2003 when the Th17 cell population was first characterized and found to be involved in autoimmune diseases. The discovery of this Th17 subset came from studies on experimentally induced multiple sclerosis (MS) - experimental autoimmune encephalomyelitis (EAE). Both diseases are characterized by the demyelination of neurons, which leads to physical and cognitive impairment [10]. These studies expanded our understanding of T cell mediated immunity, leading to a revision of the classical model of T cell populations. Initially, Th1 cells were thought to be the culprit of autoimmunity, with incriminating evidence linking the characteristic Th1 cytokines, interferon (IFN)-γ and 4 IL-12, to the induction of EAE [11-14]. Expression of IFN-γ, a hallmark Th1 cytokine, has been shown to play paradoxical roles in EAE. While IFN-γ levels were observed to increase with the onset of EAE and to decrease with disease remission[12], other research showed mice with decreased IFN-γ production still suffered from EAE[15]. Moreover, IFN-γ depletion, either through genetic or antibody-mediated manipulation, actually enhanced EAE[16]. For example, mice that failed to produce IFN-γ were not protected from EAE, rather they developed more severe diseases [17-18]. Furthermore, IFN-γ injection in Lewis rats has been observed to block EAE[19]. This apparent contradictory role of IFN-γ challenged the traditional view of the role of Th1 cells in autoimmunity in that blocking Th1 responses did not provide immunity to EAE. This suggested that Th1 cells act as regulator cells rather than promoters of chronic inflammation. The inability of IFN-γ to account for the appearance of EAE in mice with blocked Th1 functions suggested the involvement of another subset of cells, eventually identified as CD4 Th17 cells. Identification of this new subset of T cells came about through studies of EAE in IL-12-deficient mice. IL-12 consists of p40 and p35 heterodimer. EAE failed to develop in p40 deficient mice, but not in p35-deficient mice[20]. In 2000, the p40 subunit of IL12 was observed to pair with a unique p19 subunit to form a novel cytokine termed IL23[21]. The importance of IL-23 and IL-17 in EAE development was demonstrated in IL-23p19 deficient mouse models, which showed decreased levels of IL-17 producing T cells due to failure of receptor activation and further downstream signaling of IL-23 [22], 5 thereby protecting mice from EAE. This receptor was later discovered to be a heterodimer that consisted of IL-12Rβ1, the docking site for the common p40 subunit, and a unique receptor subunit termed IL-23R that bound p19[21]. IL-23 was demonstrated to promote and expand a T cell population producing IL-17, a proinflammatory cytokine. Due to the unique cytokine profile that IL-23 induced, these T cells were determined to be distinctive from either Th1 or Th2 and thus termed Th17 after its major effector cytokine IL-17 [22-23]. 2.2 IL-17 family members: Sequencing of vertebrate species’ genomes revealed that there are at least six IL17 members: IL-17A to IL-17F [24-25]. In order to better understand the characteristics of IL-17, the crystal structure of IL-17F was determined. It revealed a tertiary protein structure that is distinct from other interleukins. Although IL-17F adopts a fold similar to that of the cystine knot superfamily of proteins[26], such as platelet-derived growth factors (PDGFs) and the TGF-β family, there is deviation from the typical cystine knot structure. Specifically, IL-17F contains only two of the three distinctive cystine linkages that lend the family its name[26]. This distinctive folding is likely to be present in other IL-17 members as well. It also hints at a unique receptor structure that is needed to accommodate the ligand. 6 IL-17A and IL-17F Of the six members of the IL-17 family, IL-17A and IL-17F are the best characterized. These two may also be the closest related since they are the only members that are encoded adjacent to each other on the same chromosome, while others are encoded on different chromosomes. Specifically, Il17a and Il17f are encoded on mouse chromosome 1 and human chromosome 6 [27] . The two members bear 44% homology, compared to other members that are limited to 15-27% homology [28]. IL-17A is the dominant product of Th17 cells and is commonly referred to as IL-17. IL-17A and IL-17F exist as homodimers but heterodimers of IL-17A-IL-17F have also been observed [29]. These heterodimers are present at higher levels than IL-17A homodimers in human peripheral blood mononuclear cells (PBMC) in vitro, but the in vivo dominant form is undefined [30]. While both are pro-inflammatory, IL-17A and IL17F do vary subtly in their immunological roles. From studies of Il17a-/-and Il17f-/-, IL17A is shown to be the major player in autoimmunity[30-31]. This may be due to more potent and sustained signaling of IL-17A compared to IL-17F. IL-17F induced responses were 10-30 times weaker in terms of downstream gene activation than IL-17A[29]. IL-17B, IL-17C, IL-17D and IL-17E As for the rest of the family members, their roles are less well defined. However, they all have been shown to stimulate transcription of similar proinflammatory genes as those stimulated by IL-17A and IL-17F[32-33]. Additionally, experimental evidence suggests a similar involvement of these cytokines in autoimmunity. 7 For example, increased expression of IL-17B and IL-17C exacerbated collagen-induced arthritis (CIA), while antibodies against IL-17B partially suppressed CIA[34]. IL-17E also has been shown to induce pathological changes such as inflammatory cell infiltration, epithelial hyperplasia and hypertrophy of the liver, heart and lung [28]. However, IL-17E, also known as IL-25, is somewhat different from IL-17A in that it is produced by Th2 cells, not Th17 cells[7, 35]. Transgenic overexpression of IL17E promotes Th2 type cytokines, such as IL-4, IL-5, IL-10, and IL-13 [28], in addition to inducing cells and antibodies specializing in allergic responses. The implication of this link to Th2 cells is unknown. These IL-17 family members may become better defined in the future using gene knockouts and characterization of the function of the receptors. 2.3 Sources of IL-17: Th17 cells are not the sole source of IL-17. While Th17 cells are the main producers of IL-17, innate IL-17 producing cells have also been found in recombination activating gene (RAG) deficient mice [36]. Innate sources of IL-17 include γδ T cells, lymphoid-tissue inducer (LTi)-like cells, natural killer (NK) cells and myeloid cells[37]. These cells play important roles in tissue surveillance in the gut, lung and skin. Their ability to produce IL-17 independent of memory T cell formation is important for early inflammatory response and host defense. The regulation of innate sources of IL-17 is different from that of Th17 cells. A comparison of the development of these IL-17 producing cells is shown in Figure 2. 8 A) Th17 cell differentiation B) IL-17 producing innate cell development Figure 2: Comparison of CD4 positive Th17 and IL-17 producing innate γδ T cell development. IL-17 can be produced from the CD4 positive Th17 cells or the innate T cells. A) Development of Th17 cells from naive T cells requires engagement with antigen presenting cell, and presence of TGF-β and IL-6, with IL-23 as a maturation factor to upregulate transcription factors RORc, STAT3, and RUNX1. After differentiation and proliferation, Th17 cells migrate from lymph node to the sites of infection, which may take up to five days in vivo. B) IL-17 production from innate sources such as γδ T cells requires the presence of IL-1β and/or IL-23 secreted from antigen presenting cells stimulated with PAMPs or pathogen metabolites. These PAMPs and pathogen metabolites may also act directly on the innate cells that in combination with IL-1β and IL-23, upregulate RORc, STAT3, and RUNX1 to induce production of IL-17. Innate cells may produce IL-17 within 8 hours of induction. 9 IL-17 production from Th17 cells is highly regulated, requiring developmental factors IL-6, TGF-β, IL-21, and IL-23, and various transcription factors such as RUNX-1, STAT3, and RORc. The combination of IL-6 and TGF-β is necessary to provide the primary driving force in Th17 differentiation. In the early stages of differentiation, Th17 cells produce IL-21 that acts in an autocrine fashion to further amplify this population [27, 38-39]. In addition, IL-23 acts as a maturation factor that stabilizes and maintains Th17 cells. IL-23 is essential for the expansion and survival of Th17 effector memory cells[40]. Upon reinfection, these memory cells can rapidly be recruited and amplified for IL-17 production to quickly control infection. On the other hand, innate sources of IL-17 can produce IL-17 independent of the presence of IL-6, a key differentiating factor for Th17 cells. IL-17 producing cells were observed in IL-6 knock out (KO) mice, which cannot produce Th17 cells [41]. These innate cells can be activated by IL-23 and IL-1β, alone or in combination with pathogenassociated molecular pattern (PAMP) binding to pattern recognition receptors (PPRs) or through TCR activation[37]. Many of these innate IL-17 producing cells also constitutively express IL-23R and IL-1R1 [42-44], both of which are crucial in Th17 cell development. γδ T cells stimulated with IL-1β or IL-23, rapidly secrete IL-17 [45]. This response was also observed in LTi and NK cells. Innate cell secretion of IL-17 is very important in early inflammatory response to sequester and eliminate pathogens. Of the innate sources, the γδ T cell subset is the main source of IL-17 [37, 45]. It is an intraepithelial lymphocyte found mainly at the mucosal barrier [37]. 10 The exact functional role of these cells has not yet been elucidated. These γδ T cells can be sorted based on cell surface markers and ability to produce IFN-γ or IL-17. It is thought that the differentiation of γδ T cells is based on the strength of the signal from TCR engagement within the thymus. A strong interaction favors the IFN-γ production lineage, whereas a weak or lack of interaction favors the IL-17 production lineage [37]. CD27 surface expression marks cells as IFN-γ producing γδ T cells [46], whereas CC-chemokine receptor 6 (CCR6) are expressed by IL-17 producing γδ T cells. 2.4 IL-17 function: The primary function of IL-17 is mediating inflammation not adequately handled by cytokines from the Th1 and Th2 subsets. IL-17 protect against extracellular bacterial infections such as Klebsiella pneumoniae and fungal infections such as Candida albicans[27, 47]. IL-17 mediates an adaptive response against pathogens through the recruitment of cells primarily involved in innate responses such as neutrophils, and monocytes and macrophages (M/M). Like IL-17, M/M coordinate the immune system between the innate and adaptive branches of immunity. They are one of the first cells to arrive at the site of injury, where they engulf microbes and present the microbial peptides to the T cells. M/M also release cytokines such as IL-6, IL-1β, and tumor necrosis factor α (TNF-α) at sites of injury to promote inflammation and sequester pathogens at the site of injury. M/M were shown to be responsive to IL-17A, in that upon IL-17A binding, human macrophages have been shown to produce IL-1β and TNF-α [48]. Furthermore, 11 IL-17R is expressed in airway smooth muscle that upon binding to IL-17 induces CXCL8 expression which enhances integrin expression in monocytes and adherence to endothelial cells[49]. IL-17 mediates a strong proinflammatory tissue response through several mechanisms. Firstly, it induces the production of chemokines such as IL-8[50], monocyte chemoattractant protein-1 (MCP-1)[51], and growth-regulated oncogene α (Groα)[52] from target cells such as epithelial cells, fibroblasts and endothelial cells. Secondly, IL17 stimulates local production of IL-6 and PGE2, which further enhances inflammation[53]. Thirdly, it increases the proliferation of M/M from local stromal cells through stimulating the production of hematopoietic cytokine G-CSF and granulocyte macrophage (GM)-CSF in target cells to perpetuate the inflammatory responses [28, 54]. Chemokines, proinflammatory cytokines and M/M and neutrophils, together, act in a positive feedback loop that amplifies the overall inflammatory response. Understandably, deregulation of such a potent cytokine could lead to chronic inflammation and induction of autoimmune diseases. IL-17 produced from innate sources can also induce secretion of G-CSF from stromal cells and recruitment of neutrophils. IL-17 synergizes with other cytokines such as IL-6 and TNF to promote neutrophil infiltration for elimination of extracellular pathogens[37]. In the lung during Mycobacterium tuberculosis infection, γδ T cells produce IL-17, which enhances adaptive immunity by recruiting Th1 cells and inducing IFNγ production[47]. 12 IL-17 also plays a role in maintaining intestinal integrity by enhancing production of tight junction proteins such as claudin and zona occludens 1[37]. These proteins promote formation of interconnecting structures between epithelial cells to keep out luminal content and infectious agents from entering the bloodstream. IL-17 can also promote antimicrobial protein production such as defensins and S100 proteins from epithelial cells [37]. 2.5 The IL-17 receptor family: As there are multiple members of the IL-17 family, so are there multiple subunits comprising the IL-17R family, which consists of five receptor members: IL-17RA to IL17RE[28]. IL-17RA is the largest member of the family and is the most defined in structure and signaling. IL-17RA is indispensable in mediating the inflammatory effects of IL-17. For example, IL-17RA KO mice are predisposed to K. pneumoniae[55] and C. albicans infection [56]. IL-17RA KO mice also have increased mortality rates with Toxoplasma gondii infection due to lack of neutrophil trafficking to infection site[57]. It is a signaling subunit used by at least four members of IL-17 family: IL-17A, IL-17F, IL17D and IL-17E[58]. Binding assays using radiolabeled iodide IL-17 showed that IL-17 binds to IL-17RA with low affinity [59]. This was surprising since IL-17 is capable of inducing biological activity at low concentrations, suggesting that probably other subunits associate with IL-17RA to increase affinity towards the ligand. Indeed, further experiments confirm this. IL-17RA was shown to complex with IL-17RC using 13 fluorescence resonance energy transfer (FRET) [60] and co-immunoprecipitation studies[61]. The exact mechanism of how these receptor subunits interact to form a functional receptor for signaling has not been clarified. However, it does seem that IL17A behaves like other cytokine receptors, where subunits exist as monomers within the membrane and oligomerize with other subunits upon ligand binding, bringing signaling domains to close proximity to initiate downstream cascades. Expression of IL-17R members differ depending on the tissue type. While the main production of IL-17 is limited to Th17 cells, IL-17 receptors are expressed throughout the body on cells[62]. For instance, IL-17RB is expressed on organs such as the liver and kidneys, as well as Th2 cells, to bind IL-17E[24]. Meanwhile, IL-17RA is highly expressed on hematopoietic cells and poorly expressed on non-hematopoietic cells such as osteoblasts, fibroblasts, endothelial cells and epithelial cells [27]. In contrast, IL17RC is poorly expressed on hematopoietic cells and highly expressed on nonhematopoietic cells. This differential expression of IL-17R subunits could provide tissue specific signaling of IL-17. 2.6 IL-17 receptor structure IL-17 has been shown to assume a distinctive structure that deviates from the cystine knot family. IL-17R, unsurprisingly, also has distinguishing domains that lend to the unique functions of IL-17. All of the receptor subunits are type I single span transmembrane proteins[27, 58]. They consist of conserved structural motifs, such as an 14 extracellular fibronectin III-like domain and a cytoplasmic SEF/IL-17R (SEFIR) domain [7]. The SEFIR domain was discovered through bioinformatics analysis, which revealed that a conserved motif in the cytoplasmic tail of IL-17R was markedly homologous to the already known Toll/IL-1R (TIR) domain[63]. The TIR domain is essential for further downstream adaptors such as MYD88, which play important roles in Toll-like receptor signaling[64]. SEFIR similarity to TIR domain suggests similar downstream effects in upregulating pro-inflammatory mRNA transcripts. SEFIR was shown to play an important role in IL-17RA signaling as its deletion impairs the activation of NF-κB, a critical transcription factor, downstream of IL-17RA[65-66]. Although SEFIR bears some resemblance to TIR, it lacks certain elements present in the TIR domain, such as the TIR box 3 subdomain and the BB-loop, both of which are essential in determining specificity in TIR protein-protein interactions [67-68]. This difference suggests that SEFIR does not bind the same adaptor proteins as TIR, rather SEFIR would recruit a unique set of downstream molecules. Exactly what these molecules are and what functions they modulate require further research. A region at the carboxy-terminal side of the SEFIR domain is homologous to BBloops and is essential to IL-17RA function. IL-17RA is non-functional with mutations in this region which was termed TIR-like loop (TILL)[66]. This domain is unique to IL17RA, which may explain why IL-17RA is a common subunit shared by other receptors in the family. Through TILL, IL-17RA likely recruits essential downstream signaling 15 molecules in order to perpetuate the pro-inflammatory effects of various IL-17 family members. A third functional domain exists at the carboxy-terminal region and is not required for NF-κB and MAPK pathways activation. However, this region is essential for the downstream expression of CCAAT/enhancer binding protein (C/EBP) β, and was thus termed the C/EBPβ-activation domain (CBAD)[7]. C/EBP is another transcription factor IL-17A directly activates. 2.7 IL-17 signaling: Currently there is no clear outline of the IL-17 signaling pathway. Unlike other cytokines such as IL-6 and IL-12 where the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway is strongly induced for cellular response, IL-17 poorly induces JAK activation. Weak activation of STATs 1, 2, 3, and 4 have been reported, but may be due to secondary effects from IL-17 induced production of IL-6 that acts in an autocrine manner to upregulate STAT activation[69]. However, several signaling proteins have been identified (Figure 3). Through coimmunoprecipitaiton studies, it was shown that one of the upstream molecules that associates with IL-17RA is Act1, an adaptor protein that can lead to the activation of NFκB[65, 67]. Deficiency of Act1 using either knockout mice or siRNA addition led to inhibition of NF-κB induction upon IL-17RA signaling[70-71] . Act1 was also shown to 16 Figure 3: The IL-17A homodimer binds to a heteromeric receptor composed of IL-17RC and IL-17RA subunits whose cytoplasmic tail consists of three unique functional domains: SEFIR, TILL and CBAD. SEFIR is important for recruitment of downstream adaptor protein Act1, which in turn recruits TRAF6, a crucial upstream factor of the NFκB pathway. Act1 recruitment also activates all three MAPK members, with ERK being the most strongly and rapidly phosphorylated. TILL has a sequence similar to the Toll/IL-1R (TIR) BB loop that recruits Myd88 in TLR. The exact function of TILL is not well defined, however, it is expected that it provides unique docking sites for downstream signaling molecules. CBAD is essential for phosphorylation of C/EBPβ, which downregulates transcription of IL-17A induced genes. 17 play a role in stabilizing target mRNAs of cytokines and chemokines. For example, Act1 is essential in stabilization of Cxcl1 (CXC-chemokine ligand 1) mRNA[72]. Therefore, from this experimental evidence, Act1 appears to be an important element in the downstream cascade of IL-17RA. Act1 recruits TNF receptor-associated factor 6 (TRAF6), which is also important in mediating IL-17A signaling. Act1 contains binding domains for TRAF6 and TRAF3 which are adaptor proteins and required upstream factors in the canonical NF-κB signaling pathway[65]. TRAF6 knockout mouse embryonic fibroblasts failed to exhibit IL-17A signaling[73]. IL-17 has also been shown to activate all three subtypes of MAPK, which are Jun NH-terminal kinases (JNK), p38, and ERK[62], the last of which is the most rapidly phosphorylated and activated[58]. Like Act1, MAPKs also serve to stabilize mRNA through inhibition of destabilizing proteins such as tristetraprolin (TTP). These destabilizing proteins bind AU-rich elements (AREs) in mRNA transcripts, which are typically present in cytokine and proto-oncogene transcripts, and target them to exosome complexes for degradation[58]. TTP phosphorylation via MAPKs increases mRNA halflife by blocking its trafficking to the degradative machinery. Studies show that MAPKs increase the concentration of chemokine and cytokine gene transcripts induced by IL-17 [69], marking this class of signaling molecules as a positive contributor to IL-17 function. Through microarray screenings for IL-17A induced genes, it was shown that in addition to NF-κB, C/EBP transcription factors are also involved[74]. Two variants, C/EBPβ and C/EBPδ, are induced downstream of IL-17A. As with most signaling 18 molecules, phosphorylation serves as an important regulatory mechanism of IL-17A signaling. IL-17A signaling triggers dual, sequential phosphorylation of a regulatory site within C/EBPβ [75], the first of which is mediated by ERK [71] (Figure 4). Phosphorylation of C/EBPβ downregulates transcriptional activity, suggesting that it is an inhibitory signal of IL-17RA[71]. While C/EBPδ is regulated by IL-17RA through the canonical NF-κB pathway to upregulate IL-17A target genes, there is a simultaneous induction and phosphorylation of C/EBPβ that downregulates the target genes[76]. This could mean that even as the cell is trying to respond to IL-17, it is simultaneously upregulating inhibitory signals to prevent an over-response. The complex interplay between C/EBPβ and C/EBPδ could allow fine tuning of transcriptional control of C/EBP-dependent genes. However, there remains much to be understood about how C/EBP and other transcription factors interact with each other to coordinate a controlled increase of IL-17 target genes. 2.8 Receptor regulatory mechanisms At the receptor level, the regulation of IL-17RA is highly dynamic. For example, IL-21, an inducer of Th17 development, upregulates IL-17RA expression by CD8+ T cells[77], while phosphoinositol 3-kinase (PI3K) from IL-2 induction in T helper cells limits IL-17RA expression[78]. The regulation of IL-17RA is important because levels of IL-17RA expression correlate with IL-17A signaling strength. Cellular response to IL17 is dependent on high levels of IL-17RA [66]. Therefore, even during IL-17 increase, 19 Figure 4: CCAAT/enhancer binding protein(C/EBP) is a transcription factor induced by IL-17. C/EBP upregulates pro-inflammatory cytokine gene transcripts that are stabilized by the addition of poly A tails in posttranscriptional modification, possibly mediated by p38. Activated ERK can phosphorylate C/EBPβ, which inhibits C/EBPβ binding to the promoter and therefore downregulates transcription. 20 receptor regulation can prevent hyper-immune responses and damage to the tissues. Receptors can be regulated by several mechanisms. In the following paragraphs, mechanisms that have been found to be related to IL-17 receptors will be discussed. Generation of soluble cytokine receptors is a common way for cells to control ligand binding and signaling. Soluble cytokine receptors are important in regulating inflammation and immunity. There are many soluble isoforms of cytokine receptors, such as soluble IL-6 receptor (sIL-6R) and TNF receptors[79]. sIL-6 is derived either from proteolytic cleavage of the extracellular domain via disintegrin and metalloproteinase domain-containing protein (ADAM) or by alternative splicing[79]. Soluble isoforms can either act as signaling agonists, for example, sIL-6[80] or signaling antagonists, for example sgp130 and IL-1R type II [81]. Soluble isoforms of IL-17RB and IL-17RC with conserved ligand binding capacity have been predicted[27]. At least 90 splice variants of IL-17RC has been found compared to IL-17RA which is not alternatively spliced[82]. These soluble isoforms can serve as decoys that bind IL-17 without causing signaling. Another mechanism that regulates IL-17R is receptor internalization. Upon IL-17 binding, IL-17RA surface expression was shown to be rapidly decreased[78], which potentially serves as a negative feedback system to limit IL-17 signaling. The exact receptor internalization pathway has not been investigated; however, receptor internalization is a well known way used by cells to control signaling. There are two endocytic pathways- clathrin dependent, which is used in uptake of IL-5R[83] and TGF-β 21 receptors [84], and caveolae dependent, which is utilized in uptake of IL-2Rβ [85]. In clathrin mediated endocytosis, soluble clathrin is recruited from cytoplasm to the plasma membrane, where clathrin proteins assemble into a polygonal lattice that buds and pinches off from the membrane. This is facilitated by dynamin, a GTPase, with the aid of adaptor protein-2 (AP2) to release clathrin coated vesicles [86]. Clathrin then dissociates from the vesicle that fuses with the early endosome, which serves as a key control point for sorting receptors. At this point, receptors can be directed to the recycling endosome and back to the cell surface or shunted to multivesicular bodies (MVBs) to the lysosome for degradation, depending on intracellular signals such as the Rab proteins[86]. With respect to the caveolae dependent pathways, a clear delineation of the cellular mechanisms is unknown. However, once internalized, the vesicles would probably traffic to similar intracellular compartments as during clathrin mediated endocytosis. Intracellular trafficking has been studied with the vacuolar-type H(+)-ATPase inhibitors bafilomycin and the lysophilic weak base chloroquine, which inhibits lysosomal acidification[87-88]. Ubiquitination is another way that the cells control cell signaling. Ubiquitin is a highly conserved 76-amino acid polypeptide that can be attached covalently to lysines in target proteins in an enzyme dependent manner[89]. First, E1 activates the ubiquitin by hydrolyzing ATP to add an adenyl to an ubiquitin molecule. The activated ubiquitin is transferred to a conjugating enzyme, E2. Finally, E3, the ubiquitin ligase, catalyzes the transfer of ubiquitin from E2 to the target protein[90]. Ubiquitination was thought to be a 22 signal for protein degradation by proteasomes. However, subsequently it has also been shown to serve as a signal for endosomal trafficking, depending on whether it is monoubiquitinated or polyubiquitinated[90]. Polyubiquitination is the sequential addition of at least four ubiquitin residues to lysine 48 on the target protein. This signals the protein to be targeted to the proteosome for degradation[90]. Monoubiquitinated proteins are targeted to vesicles by endosomal sorting complexes required for transport (ESCRT) machinery to form MVBs that eventually fuse with lysosomes (Figure 5) [89]. It has been shown that multiubiquitination, which is the addition of several monoubiquitin molecules to a target protein, is a key signal for degradative sorting[86]. One study showed IL-17 can trigger ubiquitination of IL-17RA, which may involve TRAF6 that acts as E3 ligase[91]. The study showed that with aTRAF6 mutant, IL-17RA was not ubiquintated. This study also demonstrated that IL-17F but not IL-17A induced IL-17R ubiquintaiton via TRAF6. However, rather than triggering degradation following ubiquitination, luciferase reporter activity of an IL-17 driven gene was increased suggesting that ubiquitination was a positive regulator of cell signaling. Since IL-17A is the most potent IL-17 member, it calls into question whether ubiquitination is the main and necessary signaling mechanism. Receptor regulation through intra and extracellular signaling, soluble isoforms, receptor internalization and ubiquitination are potentially employed by the cells responsive to IL-17 as ways to control response to IL-17 to prevent over-activation that could lead to chronic inflammation. 23 KEY: Figure 5: Receptor internalization can either traffic to recycling endosomes or lysosomes for degradation. Upon ligand binding (1), a receptor can be activated to induce downstream signaling. One way that the cell regulates signaling is via (2) monoubiquitination which leads to (3) receptor internalization. Vesicles may traffic to early endosomes that can either fuse with (4) recycling endosomes or to (5) endocytic intermediate organelles in the lysosomal degradative pathways called multiple vesicular bodies (MVB), depending on internal trafficking proteins such as RabGTPases. In the recycling endosome, ubiquitin molecules are removed to allow receptors to traffic to plasma membrane. When fused with MVB, receptors are targeted to lysosomal degradation, which would further inhibit signaling. Bafiloymcin and chloroquine (6) act on lysosome and endosome structures to prevent protein degradation. Bafilomycin is a specific inhibitor of vacuolar-type H(+)-ATPase. Chloroquine is a lysophilic weak base that rapidly becomes protonated within the endocytic vesicles, thereby neutralizing the acidic environment. With the pH change, enzymes in endosome compartments are denatured and lose bioactivity. By inhibiting degradation, both drugs cause protein accumulation. 24 Response to IL-17 is tightly regulated due to the strong inflammatory reaction that IL-17 induces, from its production to its binding to receptors and signaling to the nucleus. Currently, there are still unanswered questions to ligand-receptor interactions of IL-17 and receptors, IL-17 signaling and in vivo function of IL-17. Of particular interest is the IL-17 receptor and signaling molecules. Regulation of IL-17R is important as receptors provide the first level of control in cellular response. By better understanding ligandreceptor and receptor activation of downstream signaling, effective treatments may be developed against receptors involved in autoimmunity while preserving necessary IL-17 inflammatory effects. 2.9 Role of IL-17 in diseases: Th17 cells are now well recognized to be major players in autoimmune diseases such as MS, colitis, psoriases, and rheumatoid arthritis (RA). As the major effector cytokine of Th17, IL-17 is implicated in chronic inflammatory diseases and organ transplant rejection[62]. While the cytokine is important in controlling some pathogen types, certain pathogens that do not need IL-17 to be cleared, still induce its production. For example, bacteria such as Pseudomonas aeruginosa[92] and fungi such as Aspergillus fumigates[93] induce IL-17 production, while both type of infections can be cleared without strong neutrophil recruitment[94]. In such cases, IL-17 driven inflammation may not be protective but rather increases the risk of chronic inflammation. 25 Monocytes and macrophages are important in mediating IL-17 pro-inflammatory effects. Although the half-life of a macrophage varies depending on the organ, it is known that in chronically inflamed organs such as in asthmatic lungs, macrophage survival is enhanced [95]. This may be associated with survival factors that IL-17 produces such as IL-1β, TNF-α, and GM-CSF[96]. Recently, IL-17 has been shown to induce airway macrophage migration and survival [97] as well as monocyte migration in synovial fluid of RA patients[98], leading to tissue destruction. Neutralization of either IL-17 or its receptors significantly reduced monocyte migration[98]. RA is a chronic inflammatory disease that leads to the destruction of bone and cartilage. IL-17 is found in synovial fluids of RA patients, where it stimulates production of catabolic enzymes in human chondrocytes that results in decreased chondrocyte proliferation[99]. IL-17 along with IL-1β and TNFα, stimulate secretion of further growth factor and pro-inflammatory cytokines such as GM-CSF and IL-6. Additionally, IL-17 induces matrix metalloproteinases in synoviocytes, which leads to proteolytic degradation of cartilage [100]. In these cases, IL-17 is a double edged sword. The same functions that IL-17 mediates to control infections become damaging to the host through the release of cytokines such as IL-6, IL-8 and IL-1β. While IL-17 deregulation is associated with autoimmune diseases, more recently it has also been linked to human immunodeficiency virus (HIV) infection. This virus impairs the immune system by targeting immune cells such as T cells and monocytes, leading to an increased risk of opportunistic infections. Whereas IL-17 function is 26 exaggerated in autoimmunity, suppression of IL-17 by HIV infection could be one mechanism that increases susceptibility to infections. Th17 cells play important roles in mucosal immunity, as they are found in high concentration in the lamina propria of the GI tract[101]. Th17 cells prevent microbial translocation across mucosal surfaces by enhancing expression of antimicrobial peptides and mobilizing neutrophils to the infected site. Gut-associated lymphoid tissue (GALT) is also a major reservoir for CD4+ T cell, the source of Th17 cells, and a key site of HIV replication[39]. Mucosal surface transmission of HIV is one major route of entry and site of viral infection. Therefore, understanding how Th17 cells are dysregulated by HIV infection is crucial to restoring Th17 population and function. Dysregulation of IL-17 function and Th17 cells at the mucosal surface during HIV infection may increase opportunistic infections that Th17 cells normally protect against. Current literatures do not agree on how IL-17 is affected by HIV infection. The first report that associated HIV infection with IL-17 showed an increase of IL-17 production by CD4+ T cells in the peripheral blood of HIV patients[102]. However, this was contradicted in a later report that showed HIV-1 infected children with a plasma viral load below 50 copies/ml had detectable IL-17 production, in contrast to those with detectable viremia who had no observable IL-17 production[103]. This suggested viral mediated impairment of Th17 cells, which led to decreased levels of IL-17. Additionally, Yue et al, demonstrated that IL-17 producing T cells were detectable only in early HIV-1 infection[104]. These data suggest that IL-17 production is likely to be negatively 27 correlated with the progression of disease, which increasingly deregulates the immune system. IL-17 may initially increase to fight viral infection, but is later suppressed as Th17 cells are depleted towards end stage disease. Current research on HIV and Th17 has focused on the involvement of the T cell itself, which is the primary target of HIV infection. However, M/M are also major targets of HIV infection. They serve as the main reservoirs for HIV to replicate and contribute to persistent viral infection. Upon HIV infection, M/M become functionally impaired, leading to deregulation of cytokine production and function[105] and consequently, a decrease in inflammatory response against pathogens. Because monocyte is one of the first responders to an injury, it is important to understand how IL-17 signaling is deregulated in these cells, so that pharmacological therapies may be developed. Drugs targeting specific molecules in the signaling cascade can preserve the important proinflammatory function of IL-17 while prevent against the diseased state. 2.10 Rationale, Objectives and Hypothesis Rationale: During extracellular bacterial or fungal infections, Th17 cells produce IL-17, which enhances inflammation primarily through the recruitment and induction of proliferation of monocytes [51, 54]. Monocytes are one of the first responders during infection. They are important in processing and presenting microbial peptides to T cells to mount a robust adaptive immune response. They are also one of the major mediators 28 of inflammation [106-107]. Both IL-17 and monocytes have been implicated in chronic inflammatory diseases such as RA [98] and allergic airway inflammation[97]. Since monocytes respond to IL-17 to amplify inflammation, it is important to understand the signaling process in these cells. Monocytes must first express IL-17R to prepare for IL-17 binding later during infection. Therefore, before we can understand how monocytes respond to IL-17, we must first characterize the IL-17R levels in these cells during inflammatory responses. To this end, we used lipopolysaccharide (LPS), a well-characterized pro-inflammatory signal. LPS found in the cell membrane of Gram negative bacteria, is a pyrogen that activates monocytes and upregulates the inflammatory properties of these cells[108]. LPS was used to simulate a bacterial infected state, during which IL-17R levels in monocytes was measured. Understanding the IL-17R response towards LPS is important because IL-17R initiates the downstream signaling responses leading to upregulation of pro-inflammatory cytokines and chemokines. By better understanding regulation of IL-17R in human monocytes, monocyte signaling in response to IL-17 may become better elucidated. Overall Aim: To understand the mechanisms which influence IL-17R levels in human monocytes in response to LPS Specific aims: 1) Are IL-17RA and IL-17RC expressed in human monocytes? 29 2) What are the post-translational regulatory mechanisms regulating IL-17RA levels in response to LPS in human monocytes? Hypothesis: LPS induces upregulation of IL-17RA and IL-17RC levels in human monocytes. 30 Chapter 3 Material and Methods Cell Culture and Reagents: THP-1 cells stably transfected with a plasmid containing CD14 cDNA sequences (CD14 THP-1) were provided by Dr. R. Ulevitch (The Scripps Research Institute, La Jolla, CA) [109]. CD14 THP-1, human peripheral blood mononuclear cells (PBMC), and primary monocytes were cultured in Iscoves’ Modified Dulbecco Medium (IMDM) with 10% fetal calf serum at 37°C with 5% CO2. CD14 THP-1 and primary cells, were stimulated with lipopolysaccaride (LPS) from Escherichia coli 0111:B4 at 1 μg/ml (Sigma), or IL-27 at 120ng/ml, or phorbol myristate acetate (PMA) at 20ng/ml over indicated time periods. Bafilomycin (Sigma Cat #B1793), an ATPase inhibitor and chloroquine, a lysophilic weak base, (Sigma Cat# C6628) were used to inhibit protein degradation. Isolation of Primary Monocytes: Primary human monocytes were isolated from healthy whole blood obtained as per Queen's University Research Ethics Board approval. Whole blood was diluted 1:1 ratio with PBS-EDTA-2% FCS and overlayed onto Lympholyte (Cedarlane Laboratories) in a 4:3 ratio of diluted blood to Lympholyte. Overlay tubes were centrifuged for 20min at 1200g, at room temperature with the brake off. The PBMC fraction was washed twice with PBS-EDTA-2%FCS and used to isolate primary monocytes using the protocol of 31 negative selection from the Human Monocyte Enrichment Kit without CD16 Depletion [Cat #19058, Stem Cell Technology]. Briefly, washed PBMC were resuspended in PBSEDTA-2% FCS at 5x107cells/ml. Antibody cocktail was added to PBMC at a concentration of 50 μg/ml and incubated for 10 minutes at room temperature. Antibody cocktail contains a combination of mouse monoclonal IgG1 antibodies and an FcR blocker of class IgG2b to prevent non specific binding to monocytes. Dextran coated magnetic beads used for labeling unwanted cells using Tetrameric Antibody Complexes (TAC) were vortexed for 30 seconds for homogenization and added at 50 μg/ml to PBMC and incubated for 5 minutes at room temperature. The PBMC suspension was brought to a total volume of 5ml with PBS-EDTA-2% FCS, and inserted with the cap off into a magnet for 2 minutes and 30 seconds to allow for separation of unlabeled target cells from magnetically labeled cells. The purified monocytes were poured into a fresh conical tube and were cultured as described above. RNA isolation: Total RNA was isolated from cells using the Tri Reagent method (Sigma). Briefly, pellets were lysed in 1 ml of TRI reagent per 5-10 x 106 cells. The homogenate was supplemented with 50μl of 4-bromoanisole (Sigma) per ml of TRI reagent. The samples were vortexed for 15 seconds and centrifuged at 12,000g for 15 minutes at 4°C. The upper aqueous phase was collected and transferred to fresh tubes. 0.5ml of isopropanol (BioShop Canada) was added to precipitate RNA and the samples were 32 incubated for 10 minutes and centrifuged at 12,000g for 5minutes at 4°C. Supernatant was discarded and the RNA pellet was washed with 1ml of 75% of ethanol by vortexing and subsequent centrifugation at 12000g for 5minutes at 4°C. The ethanol was removed and RNA pellet was dissolved in 50μl of RNase free water. RT-PCR analysis: RNA OD was measured using an ND1000 spectrophotometer (Fisher Scientific). RNA samples were diluted using RNase free dH2O to obtain 1μg of RNA. RNA(1μg) was reverse transcribed with random primers, dNTP, 5X buffer and Moloney Murine Leukemia Virus Reverse Transcriptase Enzyme (Invitrogen Cat. #28025-013). The RTPCR cycling condition was 25°C for 15 minutes, 42°C for 1 hr, followed by 95°C for 5 minutes. cDNA was added to specific primers: IL-17RA, IL-17RC, IL-6 or TNFα, or 18s primer sets, with Taq Polymerase 5X master mix (New England Biolabs Cat #M0285L) containing dNTPs, MgCl2, KCl and stabilizers. Sequences are shown in Table 1. Primer cycling parameters were optimized on a Px2 Thermal Cycler (Thermo Electron Corporation) and their expected sizes were calculated using BLAST (Basic Local Alignment Search Tool). Cycling conditions for each primer set are shown in Table 2. PCR products (12μl) were loaded with 2μl of 6X loading dye and run on a 1.2% agarose gel with ethidium bromide in 0.5X TBE buffer at 75V until bands of desired size were separated. Gels were imaged on an HD2 Alpha-Innotech imager (Fisher Scientific). 33 Table 1: Sequences of primers and their expected sizes. Primer Forward Sequence Reverse Sequence Expected Size 18s 5’ 5’ CCA GAC AAA TCG CTC 200 ACTCAACACGGGAA CAC CAAC 3’ ACCTCAC 3’ IL-17RA IL-17RC IL-6 TNF-α 5’ 5’ TGACAGCTGGATTC TGGTGTTCAGCTGCAGGACAG ACCCTCGAAA 3’ ATA 3’ 5’ 5’ AGGTTCTCGAGTTC TGAAGTACAGCCACTGGGTTC CCATTGCTGA 3’ CAA 3’ 5’ 5’ GAACTCCTTCTCCA GAATCCAGATTGGAAGCATCC CAAGCG 3’ 3’ 5’GAGTGACAAGCCT 5’GGCAATGATGATCCCAAAG GTAGCCCATGTTGT TAGACCTGCCCAGACT 3’ 187 196 300 AGCA 3’ 34 440 Table 2: Cycling conditions for primers Primer Cycling Conditions Number of cycles 18s, IL-17RA, IL-6 95°C for 10 min 40 cycles 95°C for 45 sec 55°C for 60 sec 72° C for 45 sec 72° C for 10 min IL-17RC 95°C for 10 min 50 cycles 95°C for 45 sec 54°C for 60 sec 72° C for 45 sec 72° C for 10 min TNF-α 95°C for 10 min 95°C for 60 sec 65°C for 60 sec 72° C for 60 sec 72° C for 10 min 35 30 cycles Concentrating Supernatant Protein: PBMC were stimulated with LPS for 24h and cell supernatants were collected. Proteins in the supernatant were concentrated using the Total Protein Concentration Kit (Norgen Cat #22000). Briefly, a spin column was assembled with the collection tube and 400μl of Column Activation and Wash Buffer. The tubes were centrifuged for 2 minutes at 7000 rpm, and flowthrough was discarded. The column activation step was repeated two more times. Supernatant (500μl) was diluted in 500μl of PBS and supplemented with 40μl of pH Binding Buffer that was provided. Protein solution (500μl) was added to column and centrifuged for 2 minutes at 7000 rpm. This was repeated once more with remaining supernatant dilution. Column was washed with 400μl of Column Activation and Wash Buffer and centrifuged for 2 minutes. This was repeated once more. Neutralizer (9.3μl) was added to a fresh 1.7ml Elution Tube. The spin column was transferred into the Elution Tube and 100μl of Elution Buffer was applied to the column and centrifuged for 2 minutes to elute bound proteins. Concentrated proteins were separated by SDS-PAGE and analyzed by Western blot as described in the following section. Media alone and media with FCS were also concentrated down using the same procedure as control. Cell lysis for whole cell protein: Cells were collected and lysed in lysis buffer [1M HEPES, 0.5M NaF, 0.5M EGTA, 2.5M NaCl, 1M MgCl2, 100% glycerol, 100% Triton-X-100], containing a protease 36 inhibitor cocktail (serine and cysteine, and calpain protease inhibitors) (Pierce #78410). The Bradford Assay was used to determine protein concentration. Absorbencies were measured with Varioskan Rev. 2.0 (Thermo Electron Corporation) 96-well plate reader. Negative control cell lysate from bone, heart and skeletal muscles were obtained from ProSci. SDS-PAGE and Western blot analysis: IL-17 RA and IL-17RC protein levels were measured by Western blot analysis. 50μg of total protein were resolved on 10% polyacrylamide gels and were transferred to polyvinylidene fluoride membranes (Millipore) and blocked for 1hr with 2.5% bovine serum albumin (BSA) at room temperature. Membranes were probed with IL-17RA Nterminus (Santa Cruz Cat # 30175) diluted 1:1000 in BSA, IL-17RC (R&D Cat AF2269) diluted at 1:1000 overnight at 4°C with gentle agitation. Appropriate secondary antibody (horseradish peroxidase-conjugated rabbit anti-goat, goat anti-rabbit, or goat anti-mouse polyclonal antibody [Santa Cruz Biotechnology]) were added to the membranes at 1:10000 for 1 hour and washed with TBST buffer (150 mM Tris-HCl, 1 M NaCl, and 1% Tween 20). Blots were visualized with Enhanced Chemiluminescence (ECL) (Amersham Biosciences) on an HD2 Alpha-Innotech imager. Membranes were stripped (1 M Tris-HCl (pH 6.8), β-mercaptoethanol, 2% SDS, and 0.7 mM dithiothreitol) at 50 °C and washed with TBST buffer seven times followed by re-probing 37 with 1:5000 alpha-tubulin (Sigma) or 1:1000 heat-shock protein 90 antibody (Santa Cruz Cat #7947) as loading controls. ELISA: PBMC were stimulated with LPS for 24hr and the cell supernatants were collected. 96 well microplates were coated overnight at 4°C with 50μl of capture antibody IL-17R (R&D Cat #: MAB 1771) at 2μg/ml diluted with coating buffer A (8.0g NaCl, 1.13 g Na2HPO4, 0.2g KH2PO4, 0.2g KCl, and 0.1% ProClin in 1L of dH2O, pH 7.4). Plates were washed and blocked for 1hr at room temperature with 300μl of assay buffer (8.0g NaCl, 1.13 g Na2HPO4, 0.2g KH2PO4, 0.2g KCl, 5.0g bovine serum albumin, 1ml Tween 20 and 0.5% ProClin in 1L of dH2O, pH 7.4). Standard recombinant human IL-17R protein (R&D Cat #: 177-IR) was diluted to 1000 pg/ml and serially diluted two fold in 450μl of assay buffer. Standards or stock sample supernatant was added for 2hrs before addition of 25μl of biotinylated IL-17R antibody (R&D Cat #: BAF177) at 0.1μg/ml diluted with assay buffer. This was incubated for 2hrs more at room temperature with continual shaking. The plate was washed with 300μl of 1X washing buffer (Wash buffer 25X: 0.2g KH2PO4, 1.9g K2HPO4- 3H2O, 0.4g EDTA, 0.5ml Tween 20 in 1L of dH2O, pH to 7.4), incubated with 50μl of streptavidin-HRP, washed again before addition of TMB Stabilized Chromogen (Biosource). 100μl of 1.8N H2SO4 was added to stop the reaction and absorbencies were immediately measured on BioTek ELx800 Absorbance Microplate Reader at 595nm. 38 Detection of IL-6 (Biosource CHC1263) and TNF-α (Biosource CHC1753) followed the manufacturer’s protocol. Briefly, plates were coated with capture IL-6 at 1 μg/ml, or TNF-α at 2μg/ml. Plates were washed and blocked for 1hr, followed by addition of standards or samples, 1:50 dilution for IL-6, and stock sample for TNF-α. Detection antibody was added immediately to microplates (IL-6: 0.16 μg/ml, or TNF-α: 0.32 μg/ml) and incubated for 2 hr with continual shaking. The plate was washed with 300μl of 1X washing buffer (Wash buffer 25X: 0.2g KH2PO4, 1.9g K2HPO4- 3H2O, 0.4g EDTA, 0.5ml Tween 20 in 1L of dH2O, pH to 7.4), incubated with 50μl of streptavidinHRP, washed again before addition of TMB Stabilized Chromogen (Biosource). 100μl of 1.8N H2SO4 was added to stop the reaction and absorbencies were immediately measured on BioTek ELx800 Absorbance Microplate Reader at 595nm. 39 Chapter 4 Results 4.1 IL-17R response to LPS The expression of IL-17RA is ubiquitous throughout tissues in the body, with higher expression on hematopoietic cells. In order to respond to IL-17, IL-17RA must complex with IL-17RC, which is expressed poorly on hematopoietic cells, to form functioning signaling receptor [7, 61]. IL-17 promotes monocyte recruitment and proliferation [54]. These cells are precursors of macrophages and are the first responders during infection. Currently levels of IL-17R in monocytes, in particular during inflammatory responses, are not well characterized. Therefore, in this study we focus on the regulation of IL-17 receptor components in response to inflammatory signals given by LPS in human monocytic cells. 4.1.1 LPS induces IL-17RA mRNA in primary human immune cells Here, we determined mRNA levels of IL-17RA and IL-17RC in CD14 THP-1 cells, PBMC, and monocytes. We hypothesized that LPS, which upregulates a variety of cytokines such as IL-6, IL-12, and TNF-α [110-111], will also enhance mRNA levels of IL-17R. All three types of cells were stimulated with LPS for a time course of 0 to 24 hours to measure mRNA expression of IL-17RA using primers directed at the coding sequence for the extracellular region. 40 mRNA expression of IL-17RA was observed to increase over 24 hours in PMBCs and monocytes (Figure 6A). IL-17RA mRNA expression increased significantly at 16hr in PBMC whereas in primary monocytes, increased transcript levels were observed at 8hrs. However, no increase in mRNA expression was observed in the CD14 THP-1 cell line. It is interesting to note that the kinetics of increased IL-17RA transcript level differed between PBMC and monocytes. This may be because monocytes only constitute up 10-20% of PBMC, and the responses observed in PBMC may be contributed more by lymphocytes such as T cells that constitute up to 50% of PBMC. Since levels of IL-17RA mRNA are upregulated relatively late in response to LPS, we wanted to ensure that the cells were able to respond to LPS at earlier time points. Therefore, we examined IL-6 and TNF-α expression in primary cells. In PBMC, both cytokine transcript levels were shown to increase over the 24hr period with maximal induction at 4hr (Figure 6C). A similar trend was observed in monocytes over a 16hr period. 4.1.2 LPS induces IL-17RC mRNA in CD14 THP-1 cells, but only weakly in PBMC and monocytes IL-17RC is a crucial partner to IL-17RA in mediating cellular response to IL-17A in humans. cells[27]. Unlike IL-17RA, IL-17RC is only weakly expressed in hematopoietic Thus, it is important to measure IL-17RC mRNA and protein levels in monocytes as the level of IL-17RC will determine cellular responses to IL-17. 41 A) B) C) PBMCs --------LPS-------0 4h 8h 16h 24h IL-6 Monocytes -----LPS----0 4h 8h 16h TNF-α 18srRNA Figure 6: LPS enhances IL-17 receptor transcript levels in PBMC and human monocytes. PBMC were collected from healthy subjects. Primary monocytes were isolated from PBMC using negative selection. Cells were treated with or without LPS (1μg/ml) for times ranging from 0 to 24hr. Cells were harvested and RNA was extracted for RT-PCR analysis of either IL-17RA (A) or IL-17RC (B). Positive controls of IL-6 and TNF-α expression were shown for both PBMC and monocytes (C). 18srRNA was included as a loading control. Gels are representative of at least five separate experiments. 42 As with IL-17RA, we hypothesize that IL-17RC mRNA levels will increase in response to LPS to facilitate for IL-17 binding. From RT-PCR analysis, transcript levels of IL17RC increased in all three types of cells (Figure 6B). However, IL-17RC mRNA levels in PBMC and monocytes were significantly weaker compared to CD14 THP-1 cells. The kinetics of IL-17RC mRNA upregulation were similar in both CD14 THP-1 cells and PBMC, with a significant increase at 16hr. In monocytes, IL-17RC was only weakly upregulated at 24hr. 4.1.3 LPS decreased levels of IL-17RA protein levels in primary cells Since we observed LPS-mediated induction of IL-17RA and IL-17RC mRNA expression, we wanted to confirm this result at the protein level. Therefore, levels of protein expression of IL-17RA and IL-17RC were measured using SDS PAGE and Western blot analysis. IL-17RA is approximately 120kDa and a type I single span transmembrane protein with variable extracellular glycosylation at the N-terminus. To detect changes in levels of IL-17RA, an antibody directed against the extracellular Nterminus of the protein was used. It is expected from the increase in mRNA transcription in RT-PCR that IL-17RA protein levels will also increase in response to LPS treatment. Interestingly, IL-17RA protein levels were significantly decreased under the same conditions at 16 hrs in primary cells (Figure 7A). This drastic discrepancy between IL17RA mRNA and protein levels raised the question of what mechanisms may be leading to the decrease of IL-17RA protein levels. Furthermore, IL-17RA was only weakly 43 A) B) Figure 7: LPS downregulates IL-17RA protein levels in PBMC and Monocytes. PBMC were collected from healthy subjects. Primary monocytes were isolated from PBMC using negative selection. Cells were treated in presence of LPS (1μg/ml) for 24hr. A) 50μg or 100μg of total cell lysate or B) 5μl of cell lysate from negative controls of tissue cells where IL-17A is poorly expressed, were run on SDS-PAGE and membranes were blotted with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control. Blots shown are representative of at least five separate experiments. 44 detected in CD14 THP-1 cells. Even when running 100μg of CD14 THP-1 total cell lysate on SDS-PAGE, protein levels of IL-17RA was decreased compared to primary cells with only 50μg of protein (Figure 7A). Kinetics of IL-17RA in CD14 THP-1 cells also did not exhibit a similar trend to what was observed in primary cells. In the cell line, IL-17RA was still weakly detectable at 16hr. To demonstrate IL-17RA antibody specificity, negative controls of bone, heart and skeletal muscle tissues were used since IL-17RA is poorly expressed in these tissues. Indeed, from the Western blot, no IL-17RA was detected, while hsp90 antibody shows presence of proteins (Figure 7B). In order to determine if IL-17RA response to cell activation is LPS-specific, PBMC were stimulated with two different stimulants: IL-27 (120 ng/ml) or PMA (20ng/ml). IL-27 has been shown to act on monocytes to upregulate various pro- inflammatory cytokines [112], and PMA is a known tumor promoter that strongly activates the signaling molecule protein kinase C (PKC) to upregulate proinflammatory cytokine expression [113]. With both stimuli, IL-17RA levels over 24hrs exhibited a similar trend as LPS stimulation (Figure 8). This suggests that IL-17RA response to LPS is not specific, but rather a general response to pro-inflammatory stimuli. 4.1.4 IL-17RC protein level is not affected by LPS While IL-17RC mRNA expression increased at 24hr, like IL-17RA, the protein levels over 24hrs did not correspond to transcript levels. Since IL-17RA complexes with RC to 45 Figure 8: IL-27 and PMA downregulates IL-17RA protein levels in PBMC. PBMC were collected from healthy donors. Cells were treated with either IL-27 (120ng/ml) or PMA (20ng/ml). 50μg of total cell lysate were run on SDS-PAGE and membranes were blotted with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control. Blots shown are representative of at least five separate experiments. 46 induce signaling, we would expect IL-17RC to respond to LPS in a similar way as IL17RA, and decrease in response to LPS treatment. However, protein levels of IL-17RC in THP-1 cells and PBMC showed no change (Figure 9). In THP-1 cells, only one band was detected compared to two bands found in PBMC, one at the 86kDa mark, which is the molecular weight of IL-17RC, the other in the range of the 110kDa marker. In PBMC 0-8hr, multiple weak bands near the 110 kDa was observed, possibly due to glycosylation. Due to weak mRNA levels of IL-17RC in monocytes and protein levels in PBMC, protein levels of IL-17RC in monocytes were not further investigated. 4.1.5 IL-6 and TNF-α production increases in response to LPS treatment To show that primary cells were responding to LPS at 24hr, IL-6 and TNF-α production from LPS stimulation were quantified by ELISA (Figure 10). Addition of LPS to PBMC increased IL-6 and TNF-α levels to 6500pg/ml and 1000pg/ml respectively, from non-detectable levels. IL-6 production increased significantly from 4hr to 24hr of incubation with LPS, whereas TNF-α levels increased the most from untreated to 4hr with LPS. Similarly in monocytes, IL-6 production increased over 24hr. 4.2 IL-17RA is not cleaved or secreted in response to LPS stimulation To investigate the discrepancy between mRNA and protein IL-17RA levels, two possibilities were considered: cleavage and secretion of the extracellular domain of IL17R or receptor internalization and degradation. Many cytokine receptors, such as soluble 47 Figure 9: LPS does not significantly affect IL-17RC protein levels in PBMC and THP-1 cells. PBMC collected from healthy donors and THP-1 cells were treated with LPS (1μg/ml) over 24hrs. 50μg of cell lysate were loaded in SDS PAGE for Western blot analysis. Membranes were blotted for IL-17RC and later hsp 90 for loading control. Blots shown are representative of at least five separate experiments. 48 A) 8000 7000 IL-6 (pg/ml) 6000 5000 4000 3000 2000 1000 N.D 0 . untreated 4h LPS 24h LPS 1200 TNF-α (pg/ml) 1000 800 600 400 200 0 N.D . untreated 4h LPS 24h LPS B) 30000 IL-6 (pg/ml) 25000 20000 15000 10000 5000 N.D. 0 untreated 4h LPS 24h LPS 49 Figure 10: IL-6 and TNF-α protein levels in PBMC and monocytes detected by ELISA show that cells are still responding properly to LPS at 16hr and 24hr. PBMC were collected from healthy donors and monocytes were isolated using negative selection. PBMC (A) or monocytes (B) were stimulated with LPS (1μg/ml) and supernatant was collected for IL-6 or TNF-α quantification by ELISA. Error bars represent standard deviation. N.D: not detected. Data is representative of two different individuals. 50 gp130 and soluble IL-1R type II [114], have been observed to use soluble isoforms as a means to limit membrane bound receptor activation and signaling[81]. Soluble forms of IL-17RB and IL-17RC have been predicted but not investigated [27]. Soluble isoforms may be generated by several mechanisms, one of which is cleavage and secretion of the extracellular region of receptor. In order to determine if IL-17RA is either cleaved and/or secreted, an ELISA was performed to detect soluble isoforms of IL-17RA. It was expected that if IL-17RA was cleaved or released as a soluble receptor, then sIL-17RA levels should increase at 16hr, corresponding to the decrease in cellular protein levels. However, no soluble isoforms of IL-17R in the PBMC supernatant were detected (Figure 11A). IL-17RA concentration in supernatant was below the lowest standard concentration and no significant trend was observed. A positive control of standard IL-17R was included, and IL-17RA protein was detected confirming that the antibodies and protocol were working. To confirm that there were no soluble isoforms of IL-17RA as detected by ELISA, protein in the supernatant was concentrated for SDS PAGE and Western blot analysis (Figure 11B). Given that the average weight of one a.a is 135 Da, and there are approximately 320 a.a in the extracellular domain, with seven potential sites of N-linked glycosylation [115], if IL-17RA was cleaved, then the extracellular domain would be around 90kDa. However, no band at the 90kDa marker was observed. Multiple bands at 245, 120, 20 kDa mark were observed, however, these bands were also present in the 51 A) IL-17RA expression in PBMC supernatant 3.5 Absorbancy 3 2.5 2 1.5 1 0.5 0 1000 pg/ml 500 pg/ml 250 pg/ml 125 pg/ml 62.5 ug/ml ---------------standard rIL-17RA------------ B) 52 0 4h LPS 8h LPS 16h LPS 24h LPS ----------PBMC supernatant------------- Figure 11: Extracellular domain of IL-17RA is not cleaved and secreted as detected by ELISA and Western blot of concentrated supernatant protein. PBMC were collected from healthy donors and monocytes were isolated using negative selection. A) Supernatants from PBMC or monocytes treated with LPS (1μg/ml) were collected to quantify cleaved isoforms of IL-17RA. Standard rIL-17R was diluted to 1000pg/ml and serially diluted two fold to generate standard curve. B) Western blot of concentrated supernatant protein using Total Protein Concentration Kit confirmed negative result found in ELISA. There was no significant difference in supernatant protein when compared to media with FCS control. Graphs are representative of at least five separate experiments. Western blot of concentrated protein in supernatant is representative of at least three separate experiments. 53 media control with fetal calf serum (FCS) which contain growth factors to help cells grow [116], suggesting that these bands were due to nonspecific binding of antibody. No bands were observed in the medium alone, suggesting the source of these proteins came from the FCS. 4.3 IL-17RA is degraded in response to LPS stimulation From previous experiments, it is unlikely that IL-17RA is cleaved and secreted, as both ELISA and Western analysis of concentrated supernatant proteins failed to detect IL-17RA. Receptor internalization and degradation is another mechanism by which cells control signaling. For example, IL-5R was demonstrated to undergo receptor internalization via both clathrin and lipid raft mediated endocytosis to both positively and negatively control signaling, respectively[83]. To explore the possibility of receptor degradation that may account for the decrease of IL-17RA levels at 16hr as detected by Western analysis, cells were pretreated with bafilomycin or chloroquine to prevent protein degradation. 4.3.1 Bafilomycin and chloroquine dose optimization Bafilomycin is an ATPase inhibitor, whereas chloroquine is a lysophilic weak base that neutralizes the acidic compartment of lysosome[87-88]. Both drugs are able to inhibit receptor recycling and degradation. Receptor levels were expected to increase with drug treatment if receptor internalization and degradation was occurring. First, 54 PBMC were treated with the drug at various doses to optimize drug dosage. Doses used for optimization were selected based on literature that studied drugs effect on monocytes or closely related immune cells. Bafilomycin concentrations of 10nM to 100nM, were within range of what is used in the literature for monocytes [117-120]. Chloroquine concentrations of 5μM to 100μM were also selected based on experiments on monocytes from the literature [121-122]. Based on the Western blot and other experiments, the dosage that increased IL-17RA levels the most without causing cell death was selected. Specifically, bafilomycin 100nM and chloroquine at 50μM was selected (Figure 12). It is also interesting to note that in CD14 THP-1 cells, chloroquine was able to increase IL-17RA protein levels (Figure 13B). Compared to CD14 THP-1 cells stimulated with only LPS (Figure 13A), IL-17RA was significantly increased by chloroquine overnight pretreatment at all doses followed by addition of LPS. Total protein of 100μg was run on SDS-PAGE showed weak bands for IL-17RA in the absence of the drug, compared to only 50μg of total protein from THP-1 cells treated with chloroquine. Moreover, 50μM and 100μM of chloroquine also increased IL-17RA protein levels at 16hrs. However, it should be noted that IL-17RA levels did not decrease at 16hr in these cells with LPS treatment alone. Therefore, further experimentation in primary cells was conducted to confirm a similar trend and mechanism. In CD14 THP-1 cells, 50μM of chloroquine was able to increase IL-17RA protein levels at 16hr, therefore, this dose was selected for further experiments. 55 Figure 12: Bafilomycin and chloroquine treatment of PBMC at 10nM and 100nM, and 5uM and 50uM respectively. PBMC collected from healthy donors were treated with LPS alone or either drug alone to optimize drug concentration and drug effect on IL-17RA levels. 50μg of total cell lysate were run on SDS-PAGE and membranes were blotted with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control. Doses for further experiments were chosen based on which doses had the highest effect on IL-17RA protein levels without affecting cell viability. Bafilomycin 100nM and chloroquine 50uM were chosen for later experiments. Western blot is representative of three separate experiments. BAF: bafilomycin, CLQ: chloroquine. 56 A) B) Figure 13: Chloroquine pretreatment of THP-1 cells increased IL-17RA protein levels. 50μg of total cell lysate were run on SDS-PAGE and membranes were blotted with IL17RA. THP-1 cells were pretreated with increasing doses of chloroquine overnight, 25μM, 50μM and 100μM, followed by LPS treatment of indicated times. Membranes were later probed with hsp90 antibodies or alpha tubulin as loading controls. Western blot is representative of three separate experiments. CLQ: chloroquine. 57 4.3.2 Bafilomycin and chloroquine time course optimization In order to optimize the drug effect on IL-17RA protein levels, PBMC were incubated with either drug under three conditions: 1) pretreatment of either drug for 2hr, followed by addition of LPS for 0 to 16hr, 2) simultaneous incubation of LPS and drug, or 3) LPS pretreatment followed by drug. Bafilomycin alone increased IL-17RA protein levels (Figure 14). The third treatment option did not yield significant increase of IL-17R (Figure 14), and this option was further tested in monocytes. In monocytes, LPS pretreatment of 12hr, followed by increasing duration of bafilomycin treatment showed that with increasing time of the drug, there was a decrease in IL-17RA protein levels, suggesting a decrease in drug efficacy (Figure 15). However, stock bafilomycin may have lost its efficacy during monocyte treatment. This is based on the observation that previous bafilomycin treatment affected hsp90 levels (Figure 14). However, hsp90 was not significantly affected in bafilomycin treatment on monocytes. Simultaneous treatment of bafilomycin and LPS did not increase IL-17RA but IL17RA protein levels at 16hr were preserved compared to 4hr (Figure 14). Results from bafilomycin 2h pretreatment were surprising, since pretreatment for 2hr in other studies was effective for protein inhibition. However hsp90 was significantly affected, suggesting cell death. Therefore, simultaneous treatment of LPS and bafilomycin or pretreatment of bafilomycin were investigated in further experiments in monocytes. 58 Figure 14: Time optimization of bafilomycin and chloroquine treatment in PBMC. PBMC collected from healthy donors were stimulated with LPS, drug alone, or together in three different combinations: 1) pretreatment with drug for 2hr, followed by LPS 2) simultaneous LPS and drug treatment, or 3) pretreatment with LPS followed by drug treatment. For LPS pretreatment (data not shown unless indicated), three different time points were tested: 1) LPS for 12hr, followed by drug for 4hr, 2) LPS for 8hr, followed by drug 8hr (data shown), or 3) LPS for 4hr, followed by drug for 12hr. 50μg of total cell lysates were run on SDS-PAGE and membranes were blotted with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control. Western blot is representative of at least three separate Western blots. BAF: bafilomycin, CLQ: chloroquine. p2h: pretreated for 2hr. 59 Figure 15: Bafilomycin treatment of monocytes following LPS pretreatment of 12hr did not increase IL-17RA levels. Monocytes negatively isolated from healthy PBMC were treated with LPS alone, bafilomycin alone or pretreated with LPS for 12hrs followed by bafilomycin for the indicated times. 50μg of total cell lysate were run on SDS-PAGE and membranes were blotted with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control. Blots shown are representative of at least five separate Western blots. BAF: bafilomycin. p12h: pretreated for 12hr. 60 In contrast to bafilomycin, chloroquine alone did not increase IL-17RA protein levels at 16hr (Figure 14). It is likely, looking at the hsp90, that chloroquine induced cell death, therefore explaining the absence of IL-17RA at 16hr. However, pretreatment of chloroquine for 2hrs followed by LPS treatment significantly increased IL-17RA levels at all time points. IL-17RA levels at 16hr in the presence of chloroquine were significantly increased compared to no drug treatment. This effect may be due to presence of LPS that induced IL-17RA and rescued cellular response. Simultaneous treatment of LPS and chloroquine did not significantly increase IL-17RA levels. Similar to bafilomycin, LPS pretreatment followed by chloroquine did not significantly increase IL-17RA levels. Overall, chloroquine had a stronger effect on IL-17RA levels than bafilomycin. 4.3.3 Bafilomycin and chloroquine pretreatment of cells stimulated with LPS in monocytes increased IL-17RA protein levels In monocytes, both simultaneous incubation of LPS and bafilomycin, and bafilomycin pretreatment resulted in increased IL-17RA protein levels compared to no drug treatment (Figure 16). As in PBMC (Figure 13), bafilomycin alone increased IL17RA protein levels. In contrast to PBMC (Figure 13), in monocytes, chloroquine treatment alone increased IL-17RA levels after 16hr. Pretreatment of 2hrs and overnight chloroquine treatment increased IL-17RA levels at all time points compared to no drug addition. As in PBMC, in monocytes, chloroquine more strongly increased IL-17RA protein levels 61 A) B) Figure 16: In primary monocytes, drug pretreatment followed by LPS increased IL-17RA protein levels. Primary monocytes were negatively selected from healthy PBMCs and were treated with LPS or drug alone, or pretreated with drug followed by LPS. A) Monocytes were pretreated with chloroquine for 2hrs. Additionally, cells were also treated simultaneously with bafilomycin and LPS. B) Monocytes were pretreated with chloroquine overnight at a concentration of 50μM. 50μg of total cell lysates were run on SDS-PAGE and membranes were blotted with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control. BAF: bafilomycin, CLQ: chloroquine. p2h: pretreated for 2hr. 62 than bafilomycin. Taken together, this data indicates that IL-17RA may be degraded in response to LPS treatment. 63 Chapter 5 Discussion There is disparity between levels of transcript and protein of IL-17R in PBMC and monocytes treated with LPS. LPS decreases IL-17RA protein levels while upregulating IL-17RA transcript levels. IL-17RC mRNA and protein levels also differ. Cellular mechanisms that may account for the decrease in IL-17RA protein at 16hr was investigated further and IL-17RA was found to undergo receptor degradation with LPS treatment. This control mechanism is crucial for monocytes, the main mediators of inflammation, to downregulate IL-17RA as one way to prevent overactivation of cells by IL-17. 5.1 Differential IL-17R mRNA upregulation in PMBC, monocytes, and CD14 THP1 cells RT-PCR of IL-17RA revealed upregulation of transcript levels in the presence of LPS only in PBMC and monocytes, but not in CD14 THP-1 cells. This points to the differential response between freshly isolated primary cells and a cell line. Transfected CD14 THP-1 cells are marked by surface membrane CD14 that functions as a co-receptor to TLR4 in response to LPS to upregulate proinflammatory cytokines such as IL-6 and TNF-α [123-124]. However, these transformed leukemic cells differed in responses from primary cells. In CD14 THP-1 cells, IL-17RA surface levels may already be maximally saturated and thus cells can no longer increase IL-17RA. Another possibility 64 is that downstream signaling is changed in CD14 THP-1 cells, so that slight variations in the combination of downstream factors would lead to failure to bind promoter of Il17ra and upregulate transcription. This difference in response demonstrates the limitations of using a cell line and the importance of using primary cells. In contrast, the IL-17RC mRNA transcript levels were increased in all three types of cells, with varying kinetics in response to LPS treatment. IL-17RC transcript in CD14 THP-1 cells did not reach the same level of expression as 18srRNA, whereas, IL-17RA and 18srRNA levels were expressed at equal intensity in CD14 THP-1 cells. This suggests then, that the level of transcript may be what is determining if IL-17R can be upregulated further. In a transformed cell such as CD14 THP-1, control of basal levels of Il17ra may be lost. Therefore, in the presence of further stimulus, Il17ra cannot be upregulated because it is already maximally transcribed. In CD14 THP-1 cells, loss of tight regulation and basal expression of IL-17RC transcript may explain the strong induction of IL-17RC. Overall regulation of IL-17R transcript levels is crucial in controlling cellular responses to IL-17, as mRNA levels predict protein levels which determine surface levels of receptors to IL-17, a potent pro-inflammatory cytokine. Comparison between monocytes and PBMC reveals a difference in kinetics of IL17R mRNA upregulation. In PBMC, there is a stronger expression and earlier upregulation of both Il17ra and Il17rc. This may be because monocytes only constitute up to 10-20% of PBMC [125]. Therefore, the response observed in PBMC may be contributed more by lymphocytes such as T cells, which also express IL-17RA, and 65 constitute up to 50% of total PBMC population[126]. In order to understand how IL-17R is regulated in monocytes, it is important to first measure IL-17RA in a pure monocyte population. Therefore, primary monocytes were isolated to measure IL-17RA transcript levels in these main mediators of inflammation. Since IL-17RA is a subunit shared by other IL-17R family members, such as IL17RB to bind IL-17RE, it is not surprising the IL-17RA mRNA transcript is expressed at a higher level than IL-17RC. An absence of IL-17RC at basal levels in both primary cells was expected since it is known that IL-17RC is poorly expressed in hematopoietic cells. Regulating transcript expression levels of IL-17RA and RC, which must complex together to induce signaling, at different levels is significant. different tissues to regulate pro-inflammatory responses. This allows cells in By limiting one receptor transcript level, cells can dampen response to IL-17A, while still responding to other IL17 members. On the other hand, kinetics of both IL-17RA and IL-17RC transcript upregulation in primary cells were similar. In PBMCs, both subunit mRNA levels increased significantly at 16hr, and in monocytes, the strongest induction was at 24hr. Simultaneous upregulation of both IL-17RA and IL-17RC mRNA levels are important in that both subunits are required for signaling. From the RT-PCR, IL-17RC transcript was only upregulated in presence of LPS. However, poor expression of IL-17RC in monocytes, suggests that LPS alone may not be sufficient to upregulate IL-17RC. In PBMCs, where there is a mixed population of 66 various innate IL-17 producing cells and T cells, cells can secrete factors such as IL-6 and TGF-β that are necessary to drive IL-17 production to act on monocytes in a paracrine fashion. With a pure monocyte population, these factors are not present at sufficient levels to synergize with LPS to upregulate IL-17RC. 5.2 IL-17R mRNA and protein levels dichotomy Due to variability between individual donors, there were also differences between IL-17RA protein levels in response to LPS. LPS induced an increase in IL-17RA protein level between 0 and 4hr in a few individuals, whereas this induction was not observed in others. However, all donors, Western blot analysis revealed IL-17RA protein levels to be decreased at 16hrs in PBMC and monocytic cells. This was surprising since in response to LPS, the transcript levels of the receptor subunits in all three types of cells were upregulated in contrast to the striking decrease in IL-17R protein levels. From the positive control of IL-6 and TNF-α, LPS is observed to induce the two proinflammatory cytokine expression at 2 to 4 hr post-stimulation. This is early compared to receptor transcripts that were still seen to be increasing for 16hr. This may be due to feedback effects from secreted factors and proinflammatory cytokines as result of LPS stimulation. These factors act in an autocrine and paracrine fashion to increase IL-17R transcript levels as a secondary effect. Indeed LPS-induced cytokine secretion may play a role in the decrease of IL-17RA protein at the 16 hr time point. 67 As discussed above, primary cells may differ slightly in responses from transformed cells as the transformed cells have lost various regulatory networks that keep growth in check. One of the main differences between THP-1 cells and primary monocytes is their differential ability to respond to IL-10. IL-10 is an immunosuppressive cytokine that is produced in response to LPS. It functions as an antiinflammatory cytokine that is produced after proinflammatory IL-6 and TNF-α cytokines generation. Although able to produce IL-10 in response to LPS stimulation, THP-1 cells are refractory to this cytokine [127]. It is possible that LPS induces IL-10 production in primary monocytes, which as a secondary LPS-mediated effect, can downregulate IL17RA protein levels. This is supported by the fact that the LPS-mediated downregulation of IL-17RA protein levels was observed 8 to 16 hr after treatment only in primary cells. In CD14 THP-1 cells, there was a significant difference between mRNA and protein levels ofIL-17RA. High protein levels were expected since IL-17RA mRNA expression was high. While IL-17RA protein levels in CD14 THP-1 cells did not change significantly with LPS stimulation, following the same trend as the transcript expression, IL-17RA protein levels were significantly weaker compared to the high transcript levels. In contrast to IL-17RA, IL-17RC protein levels did not change compared to an induction in transcript levels in all three types of cells. In addition, IL-17RC protein levels between PBMC and CD14 THP-1 cells were comparable in that there was no significant change in protein levels in both types of cells. Clearly IL-17RA and RC are regulated differently. 68 Differences and similarities in responses between the cells may be due to posttranscriptional and post-translational modifications. Discrepancy between mRNA and protein levels observed in the THP-1 cells may be due to mRNA post-transcriptional modification, which is one of the most common ways to regulate gene expression after transcription. Modifications can either increase transcript stability by the addition of a poly A tail and 5’ cap [128], or it can decrease transcript levels by destroying the transcript that was just made through mechanisms such as small interfering RNA (siRNA) and micro RNA (miRNA). Additionally, recruitment of AU- rich elements (ARE) binding proteins (ARE-BP) can positively or negatively regulate transcript stability [129]. ARE mediated decay (AMD) regulates a variety of cytokine transcripts such as IL-1β, IL-6, IFN-γ and TNF [129]. The ability of ARE-BPs to bind their target sequence is further regulated by phosphorylation via kinases and phosphatases. P38 MAPK, which IL-17 induces, is a classical regulator of mRNA stability. Macrophages activated by LPS increase transcription of ARE-containing mRNA molecules encoding proinflammatory proteins such as TNF, IL-1β, and IL-6 [130]. Components of the AMD pathway may also associate with the RNA-induced silencing complex (RISC) to regulate the stability and translation of cytokine transcripts. RISC can also mediate siRNA–induced mRNA decay and miRNA-induced translational silencing [129]. miRNA 155, is found to be essential in repressing the expression of IL4, IL-5 and IL-10 in activated T cells [131-132]. All these factors, among others, may lead to a decrease in IL-17RA and RC in CD14 THP-1 cells. 69 Future studies in elucidating these possible mechanisms may utilize siRNA and inhibitors of destabilizing proteins and complexes to study if these are contributing factors to the lack of IL-17RA protein levels in CD14 THP-1 cells. In primary cells, there was a dichotomy between the transcript and protein levels. While the above mechanisms may contribute to the lack of IL-17RA protein observed in THP-1 cells, the complete abrogation of IL-17RA at 16hr in primary cells compared to a high level of mRNA expression suggested the possibility of post-translational mechanisms. IL-6 and TNF-α ELISA showed that cells were still responding to LPS. Therefore, the decrease in IL-17RA levels is not a result of decreased cell viability at 24hr. Although it is possible that LPS-induced cytokines such as IL-10 may contribute to IL-17RA protein downregulation, the decrease of IL-17RA protein levels was shown to not be specific to LPS. IL-27 and PMA, both inducers of pro-inflammatory cytokine expression via different mechanisms, also decreased IL-17RA levels. IL-27 signals through STAT3 and NF-κB to upregulate proinflammatory cytokines such as IL-6, TNFα and MIP-1 [112], while PMA constitutively activates PKC to induce transcription of many genes among which are pro-inflammatory cytokines [133]. In the presence of either two stimuli, IL-17RA protein levels in PBMC exhibited the same downregulation at 16hr. This suggested that IL-17RA downregulation may be a general response to proinflammatory signals. Therefore, it is possible that IL-17RA levels were decreased due to negative feedback response as an indirect result of pro-inflammatory cytokines and 70 proteins being upregulated. This decrease in IL-17RA levels is yet to be demonstrated in vivo during infection. However, decreasing IL-17RA levels may serve as an important control mechanism to curb the response to IL-17. The data from this section should be carefully interpreted as the loading control was not equal, therefore IL-17RA levels in response to these stimuli at 16hr may have been higher than in response to LPS. The mechanisms for the decrease in IL-17RA levels were investigated in more detail with further experiments that will be discussed in the next section. Since IL-17RA must partner with IL-17RC to form a heteromeric receptor to bind IL-17, low levels of IL-17RC limit the amount of functional receptors. The failure of LPS to induce IL-17RC levels suggested that supplementary factors may be required in addition to a pro-inflammatory signal to fully increase IL-17RC levels. These factors may have effects post-transcriptionally and post-translationally that would lead to more stable protein and thus, increase protein. Receptors requiring more than one signal are not novel. For example, CD30 expressed on an activated T cell is a signal transducing receptor that enhances T cell proliferation in response to CD3 crosslinking [134]. CD30 surface levels are dependent on the presence of CD28 costimulatory signals or IL-4 during T cell activation [134]. Therefore, upregulation of IL-17RC may require the presence of other cytokines that induce downstream signaling molecules that may strongly bind Il17rc promoter or stabilize protein product. It is interesting to note that in PBMC, IL-17RC has a double band compared to a single band in THP-1 cells. This is also true for IL-17RA, with multiple bands observed 71 in PBMC and monocytes, compared to single weak band from CD14 THP-1 cell lysate. In the case of IL-17RA, these multiple bands are possibly due to glycosylation. The relative mobility of IL-17RA on SDS-PAGE is approximately 120kDa protein due to various N-linked glycosylation modifications[115], which can contribute to multiple detection of multiples bands. Specific glycosylated IL-17RA isoforms can inducibly associate with IL-17RC [135]. Therefore, as its partner IL-17RA levels decreased at 16hr, IL-17RC levels remained unchanged due to lack of association. On the other hand, the cause and effect may be reversed. Multiple weak bands were associated with IL17RC in PBMC, but this phenomenon decreased at 16hr. These bands may be due to IL17RC glycosylation [82]. Since IL-17RA and RC associate, failure of IL-17RC to be glycosylated may prevent IL-17RA protein to be stably expressed, therefore leading to a decrease in protein levels in primary cells. This possibility may be explored in the future by inhibiting glycosylation and observing IL-17RA and RC levels. The specificity of the antibody to IL-17RC may be tested by knocking down IL17RC through siRNA and using Western blot analysis for IL-17RC analysis. If the antibody is specific to IL-17RC, the bands observed in Figure 9 would not be expected to be observed. In addition, a positive control of cells expressing high IL-17RC such as fibroblasts or cells from the prostate or kidney[136] may be included to verify antibody specificity. 72 5.3 IL-17R decrease in protein levels 5.3.1 Soluble Isoforms Two considerations were made in addressing the mechanisms that may be mediating the decrease of IL-17RA protein levels at16hr: 1) IL-17RA may be cleaved and secreted, in which case, soluble isoforms of IL-17RA may be detected in the supernatant, or 2) the receptor was internalized and degraded. From the IL-17RA ELISA and the Western analysis of proteins concentrated from supernatant, soluble isoforms of IL-17RA were not detected. analysis, multiple bands were detected in the supernatant. In the Western blot However, the cleaved extracellular region of IL-17RA is estimated to be around 90kDa, which was not observed on the membrane. At all time points, bands were observed at 120kDa mark, which is approximately the size of the IL-17RA. This was not observed in the Media FCS control lane. This band may be due to the release of full length receptors via exosome-like vesicles [80]. However, if the decrease in IL-17RA from total cell lysate was a result of exosomal vesicle release of IL-17RA, we would expect an increase in protein levels at 16hr. Instead, the protein level was maintained at similar levels throughout the LPS time course. This suggests that this is a non-specific band. The disadvantage of running a SDS-PAGE with supernatant proteins is that control protein cannot be found. There is no secreted household protein that is expressed at a steady level with LPS stimulation over 24hr. 73 Soluble cytokine receptors, which can either attenuate or promote cytokine signaling, are important regulators of inflammation and immunity. They play a key role in preventing excessive inflammatory responses. One classical example is the autosomal dominant, TNF receptor-associated periodic syndrome, which is characterized by mutations in the extracellular domain of the 55-kDa, type I TNFR that impairs receptor shedding [137]. Viruses also recognize the importance of soluble isoforms by encoding soluble homologues of mammalian receptors, thereby inhibiting essential cytokines and evading immunity. For example, poxviruses, such as cowpox, variola, myxoma, and Shope fibroma viruses, encode TNFR superfamily homologues to prevent TNF signaling [138]. Soluble cytokine receptors can be generated by several mechanisms. These are proteolytic cleavage of receptor and release of extracellular portion of receptor or alternative splicing of mRNA transcripts, both of which are utilized by IL-6R to generate soluble receptors [80]. They can also be encoded as distinct genes as in the case of Decoy receptor 3, a TNFR secreted member, that prevents apoptosis by binding to Fas ligand to inhibit association with Fas [139-140]. Soluble receptors may also be released in full-length through exosome-like vesicles as exemplified by FasL release from melanoma cells that promotes apoptosis on Fas-sensitive lymphoid cells resulting in impaired antitumor responses [141]. Finally, cleavage of GPI-anchored receptors can also generate soluble receptors as in ciliary neurotrophic factor receptor α which is 74 anchored to cell membranes by a GPI-linkage and released by phosphatidylinositolspecific phospholipase C. For the IL-17 receptor family, except for IL-17RA, all other IL-17 receptor subunits have been shown to be alternatively spliced. The double band from IL-17RC Western blot in PBMC may be due to alternative splicing. IL-17RC has been reported to have 90 spliced isoforms in a human prostate cancer line [82]. The alternative splicing of IL-17RC has been shown to create frame-shifts and introduce stop codons that result in secreted soluble proteins [82]. These soluble proteins are predicted to serve as soluble decoy receptors. However, these soluble isoforms have yet to be found in vivo, and their effects confirmed. There is also evidence of alternative splicing of IL-17RE in the EST database, however their effects are unknown. Alternative transcription start sites are also observed in the various isoforms of IL-17RD, which produce proteins named IL-17RLM long and IL-17RLM short. 5.3.2 Receptor degradation While IL-17RA is not secreted as a soluble isoform, it is not the only explanation for the decrease in IL-17RA levels at 16hr. To investigate the possibility of receptor degradation, bafilomycin and chloroquine were used. Drug pretreatment of PBMC and monocytes increased IL-17RA levels at 16hr compared to LPS treatment alone. Chloroquine also significantly increased IL-17RA levels in CD14 THP-1 cells, especially at 16hr. These results together suggest that in the presence of LPS, IL-17RA may 75 undergo receptor internalization followed by degradation to control pro-inflammatory responses. In the presence of the drugs alone, chloroquine was more effective than bafilomycin at increasing levels of IL-17RA. Chloroquine differs from bafilomycin in its mode of action, and has various uses such as a malarial drug. As a lysophilic weak base, chloroquine can change cellular pH, thereby affecting various cellular functions. Chloroquine is also a drug used to treat RA patients. It has been shown to reduce levels of pro-inflammatory cytokines by blocking TNF-α and IL-6 synthesis in LPS treated human monocytes [142-143]. Jang et al, showed that chloroquine inhibited TNF-α maturation mainly by blocking cleavage of cell-associated 26-kDa TNF-α precursor to the soluble active 17-kDa mature form [122]. Thus, the reason chloroquine had a stronger effect on increasing IL-17RA levels may be because it was preventing more than protein degradation. Furthermore, chloroquine was shown to inhibit LPS-induced activation of ERK in human PBMCs, thereby blocking transcription of the TNF-α gene. IL-1β and IL-6 production were also shown to decrease in the presence of chloroquine, resulting from decreased transcript stability [122]. Similarly, the presence of chloroquine may prevent post-transcriptional modifications that may lead to increased instability of Il17ra transcript levels. Untreated cells collected at 0, 4, and 16 hr showed no difference in IL-17RA levels (Figure 12). This suggests that the change in IL-17RA levels during LPS treatment is not an artifact; rather it is a true response towards LPS. In the presence of the drug 76 alone, the basal level of IL-17RA did not increase over the 16hr treatment. This suggests that receptor degradation is induced only in the presence of LPS. Chloroquine pretreatment for 2hr or overnight did not appear to make a difference in increasing IL-17RA levels, except that longer incubation negatively impacted cell viability. Pretreatment of chloroquine yielded the greatest increase in IL-17RA levels compared to bafilomycin, which maintained levels at 16hr relative to 4hr with simultaneous incubation with LPS and pretreatment. Bafilomycin effect on IL-17RA levels at 16hr was more pronounced in monocytes than in PBMC. For monocytes, the primary responder to IL-17, receptor degradation is one way to downregulate IL-17RA. This cellular response is crucial in controlling inflammatory response. Long incubations of either drug at high concentrations led to cell death as reflected by a decrease in hsp90. This is normal in that long incubations with these drugs interfere with regular cellular machinery such as recycling, degradation and other pH dependent activities necessary for cellular homeostasis. 5.3.3 Ubiquitination and signaling Changes in IL-17RA levels may also be driven by ubiquitination. IL-17RA has been shown to be ubiquitinated via TRAF upon IL-17F binding[91]. While Rong et al, showed ubiquitination as a positive regulator of signaling of IL-17F[91], protein recycling and degradation through ubiquitination remains a possibility to be explored. Ubiquitination, while known for protein degradation, is also utilized in cell signaling. 77 Ubiquitination can lead to activation of downstream signaling molecules such as protein kinases [144]. For example, IL-1R activation leads to the recruitment of TRAF6, which acts as E3 ligase that activates TGF-beta activated-kinase (TAK1), which in turn phosphorylates Ikkb. Activated Ikk phosphorylates IkB inhibitory proteins, resulting in their ubiquitination and subsequent degradation by the proteasome. As a result, NF-kB is liberated to enter the nucleus to induce target gene expression. TRAF-mediated polyubiquitination is crucial in the activation of TAK1 and IKK by multiple signaling pathways, such as those downstream of TNFR, IL-1R, and TCR [144]. Therefore, with IL-17RA, ubiquitination may play a role both as a positive contributor in signaling through recruitment of adaptor proteins, and by marking downstream inhibitory proteins such as Ikkb for degradation to release NF-κB for binding to the promoter, and also possibly as a negative regulator in marking IL-17RA for degradation. 5.3.4 Therapeutic uses of soluble IL-17R While detection of in vivo soluble isoforms of IL-17RA is yet to be found, soluble isoforms of IL-17RA and RC have been designed in laboratories as a means to study the therapeutic effects of blocking IL-17 signaling. Soluble IL‑17R subunits, such as fusions to IgG Fc, have already been evaluated in pre‑clinical models [145-146]. The fusion proteins involve the extracellular region of IL-17RA fused to the Fc portion of the IgG. Rats with arthritis injected with IL-17R IgG-Fc fusion protein, show reduction in joint inflammation and bone erosion[145]. Currently, there are already drugs in place using 78 soluble receptors to antagonize ligand effects in order to reduce inflammation. TNF is another cytokine involved in chronic inflammation and autoimmune diseases such as RA and MS [147]. Etanercept, generically known as Enbrel, is a recombinant TNF blocker made from fusing two soluble human 75-kDa TNF receptors to IgG-Fc. Etanercept has shown a beneficial effect in many clinical conditions including RA, psoriasis, and ankylosing spondilitis[147]. Abatacept is another soluble fusion protein that consists of the extracellular domain of human cytotoxic T lymphocyte-associated antigen 4 linked to the modified IgG Fc portion [147]. The drug blocks costimulatory signals between antigen-presenting cells and T cells in RA patients. Another way to inhibit IL-17RA activation is by preventing receptor assembly by means of soluble peptides containing the pre‑ligand assembly domain (PLAD) of IL‑17RA [148]. PLAD binding to IL-17RA subunit prevents association with other receptor subunit to form a functional and signaling receptor. This approach is another possible avenue for drug development, similar to approaches used with TNFR signaling. However, receptors not only induce signaling but may be involved in negative feedback that inhibits cytokine production. Smith et al, shows that IL-17A treatment can actually inhibit the expansion of IL-17A-producing T cells in mice through a “short-loop” negative feedback mediated by the IL-17R[149]. In IL-17R deficient mice, systemic levels of IL-17A and tissue expression of IL-17A were elevated [149]. This finding then questions the usefulness of anti-IL-17R therapies for autoimmune disease because such therapies may lead to unwanted expansion of IL-17A producing T cells. 79 Taken together, blocking IL-17R may appear to be an effective way of preventing IL-17 mediated chronic inflammation. However, caution must be taken to prevent adverse affects such as allowing for expansion of IL-17 by interfering with a naturally occurring feedback loop that needs to be better elucidated. Better understanding of IL17R members and their roles in activation and possibly decreasing levels of IL-17 will provide for clearer targets for inhibitors. Furthermore, defining downstream signal transduction in cells such as monocytes, the main mediators of inflammation, and cells that IL-17 actively recruits, will also allow for drug therapeutics to block for specific intracellular pathways. 80 Conclusion and Future Directions: Control of IL-17R expression at the transcript and protein levels in monocytes are crucial in limiting response to IL-17, a potent inducer of inflammation. Decreased IL17R protein levels in response to LPS stimulation has not been described before in the literature. Since both IL-17RA and RC are required to form functional receptor to bind IL-17, the decrease in IL-17RA prevents formation of a functional receptor. This prevents an over response to IL-17, as IL-17 is involved in multiple chronic inflammatory diseases where this level of control may be lost. Figure 17 summarizes the findings. Receptor internalization and degradation is one way by which cells can decrease IL17RA protein in monocytes. However, there are other mechanisms such as secretion of soluble isoforms and ubiquitination, which may be also at work. Receptor degradation may be a general cellular response to activation by LPS to control further signaling that could lead to overexpression of pro-inflammatory cytokines. Future experiments designed to better elucidate IL-17RA regulation in monocytes should target posttranscriptional modifications, and investigate the role of glycosylation of IL-17RA and RC in receptor activity. The findings of this project have important physiological relevance in that receptor turnover keep the immune response in balances even as cells upregulate pro-inflammatory cytokines in response to pathogens. 81 Figure 17: Model system of IL-17 receptor regulation. 1) LPS signals through TLR4 and CD14 to induce signaling (2), leading to upregulation of pro-inflammatory cytokines (3). 4) IL-17RA undergoes receptor internalization, though it is not known whether it is through the direct effect of LPS signaling or the indirect effect of pro-inflammatory cytokines upregulated as a result. Vesicles transporting IL-17RA fuse with lysosome, leading to protein degradation. 5) IL-17RA and IL-17RC transcripts are also upregulated, either as direct or indirect result of LPS signaling. These transcripts are subject to post-transcriptional and post-translational modifications. 82 References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. Coffman, R.L. and J. Carty, A T cell activity that enhances polyclonal IgE production and its inhibition by interferon-gamma. J Immunol, 1986. 136(3): p. 949-54. Mosmann, T.R., et al., Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol, 1986. 136(7): p. 234857. Romagnani, S., The Th1/Th2 paradigm. Immunology Today, 1997. 18(6): p. 263-266. Diaconu, C.C., et al., Plasticity of regulatory T cells under cytokine pressure. Roum Arch Microbiol Immunol, 2010. 69(4): p. 190-6. Rouvier, E., et al., CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus saimiri gene. J Immunol, 1993. 150(12): p. 5445-56. Yao, Z., et al., Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity, 1995. 3(6): p. 811-821. Gaffen, S.L., Structure and signalling in the IL-17 receptor family. Nat Rev Immunol, 2009. 9(8): p. 556-67. Fossiez, F., et al., T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med, 1996. 183(6): p. 2593-2603 Kennedy, J., et al., Mouse IL-17: a cytokine preferentially expressed by alpha beta TCR + CD4-CD8-T cells. Journal of Interferon & Cytokine Research, 1996. 16(8): p. 611-7. Compston, A. and A. Coles, Multiple sclerosis. Lancet, 2002. 359(9313): p. 1221-1231. Balashov, K.E., et al., Seasonal variation of interferon-gamma production in progressive multiple sclerosis. Ann Neurol, 1998. 44(5): p. 824-8. Issazadeh, S., et al., Interferon gamma, interleukin 4 and transforming growth factor beta in experimental autoimmune encephalomyelitis in Lewis rats: dynamics of cellular mRNA expression in the central nervous system and lymphoid cells. J Neurosci Res, 1995. 40(5): p. 579-90. Karni, A., et al., IL-18 is linked to raised IFN-[gamma] in multiple sclerosis and is induced by activated CD4+ T cells via CD40-CD40 ligand interactions. J Neuroimmunol, 2002. 125(1-2): p. 134-140. Segal, B.M., B.K. Dwyer, and E.M. Shevach, An interleukin (IL)-10/IL-12 immunoregulatory circuit controls susceptibility to autoimmune disease. J Exp Med, 1998. 187(4): p. 537-546. Cua, D.J., et al., Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature, 2003. 421(6924): p. 744-8. Billiau, A., et al., Enhancement of experimental allergic encephalomyelitis in mice by antibodies against IFN-gamma. J Immunol, 1988. 140(5): p. 1506-10. Ferber, I.A., et al., Mice with a disrupted IFN-gamma gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J Immunol, 1996. 156(1): p. 5-7. Krakowski, M. and T. Owens, Interferon- confers resistance to experimental allergic encephalomyelitis. Eur J Immunol, 1996. 26(7): p. 1641-6. Voorthuis, J., et al., Suppression of experimental allergic encephalomyelitis by intraventricular administration of interferon-gamma in Lewis rats. Clin Exp Immunol, 1990. 81(2): p. 183-8. 83 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. Zhang, G.X., et al., Induction of experimental autoimmune encephalomyelitis in IL-12 receptor-beta 2-deficient mice: IL-12 responsiveness is not required in the pathogenesis of inflammatory demyelination in the central nervous system. J Immunol, 2003. 170(4): p. 2153-60. Oppmann, B., et al., Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity, 2000. 13(5): p. 71525. Langrish, C.L., et al., IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med, 2005. 201(2): p. 233-40. Park, H., et al., A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol, 2005. 6(11): p. 1133-41. Lee, J., et al., IL-17E, a Novel Proinflammatory Ligand for the IL-17 Receptor Homolog IL-17Rh1. J Biol Chem, 2001. 276(2): p. 1660-1664. Li, H., et al., Cloning and characterization of IL-17B and IL-17C, two new members of the IL-17 cytokine family. Proc. Natl. Acad. Sci. U. S. A., 2000. 97(2): p. 773-778 Hymowitz, S., et al., IL-17s adopt a cystine knot fold: structure and activity of a novel cytokine, IL-17F, and implications for receptor binding. The EMBO Journal, 2001. 20(19): p. 5332-5341 Korn, T., et al., IL-17 and Th17 Cells. Annu Rev Immunol, 2009. 27: p. 485-517. Aggarwal, S. and A.L. Gurney, IL-17: prototype member of an emerging cytokine family. J Leukoc Biol, 2002. 71(1): p. 1-8. Wright, J.F., et al., Identification of an interleukin 17F/17A heterodimer in activated human CD4+ T cells. J Biol Chem, 2007. 282(18): p. 13447-55. Yang, X., et al., Regulation of inflammatory responses by IL-17F. J Exp Med, 2008. 205(5): p. 1063-75. Ishigame, H., et al., Differential roles of interleukin-17A and -17F in host defense against mucoepithelial bacterial infection and allergic responses. Immunity, 2009. 30(1): p. 10819. Aarvak, T., et al., IL-17 Is Produced by Some Proinflammatory Th1/Th0 Cells But Not by Th2 Cells. J Immunol, 1999. 162(3): p. 1246-1251. Starnes, T., et al., Cutting edge: IL-17F, a novel cytokine selectively expressed in activated T cells and monocytes, regulates angiogenesis and endothelial cell cytokine production. J Immunol, 2001. 167(8): p. 4137-4140. Yamaguchi, Y., et al., IL-17B and IL-17C are associated with TNF-alpha production and contribute to the exacerbation of inflammatory arthritis. J Immunol, 2007. 179(10): p. 7128-36. Conti, H.R., et al., Th17 cells and IL-17 receptor signaling are essential for mucosal host defense against oral candidiasis. J Exp Med, 2009. 206(2): p. 299-311. Uhlig, H.H., et al., Differential activity of IL-12 and IL-23 in mucosal and systemic innate immune pathology. Immunity, 2006. 25(2): p. 309-18. Cua, D.J. and C.M. Tato, Innate IL-17-producing cells: the sentinels of the immune system. Nat Rev Immunol, 2010. 10(7): p. 479-89. Korn, T., et al., IL-21 initiates an alternative pathway to induce proinflammatory TH17 cells. Nature, 2007. 448(7152): p. 484-487. McGeachy, M.J. and D.J. Cua, Th17 cell differentiation: the long and winding road. Immunity, 2008. 28(4): p. 445-53. 84 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. Veldhoen, M., et al., TGF [beta] in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity, 2006. 24(2): p. 179-189. Grajewski, R.S., et al., Activation of invariant NKT cells ameliorates experimental ocular autoimmunity by a mechanism involving innate IFN-gamma production and dampening of the adaptive Th1 and Th17 responses. J Immunol, 2008. 181(7): p. 4791-7. Yoshiga, Y., et al., Invariant NKT cells produce IL-17 through IL-23-dependent and independent pathways with potential modulation of Th17 response in collagen-induced arthritis. Int J Mol Med, 2008. 22(3): p. 369-74. Martin, B., et al., Interleukin-17-producing gammadelta T cells selectively expand in response to pathogen products and environmental signals. Immunity, 2009. 31(2): p. 321-30. Rachitskaya, A.V., et al., Cutting edge: NKT cells constitutively express IL-23 receptor and RORgammat and rapidly produce IL-17 upon receptor ligation in an IL-6independent fashion. J Immunol, 2008. 180(8): p. 5167-71. Sutton, C.E., et al., Interleukin-1 and IL-23 induce innate IL-17 production from gammadelta T cells, amplifying Th17 responses and autoimmunity. Immunity, 2009. 31(2): p. 331-41. Ribot, J.C., et al., CD27 is a thymic determinant of the balance between interferongamma- and interleukin 17-producing gammadelta T cell subsets. Nat Immunol, 2009. 10(4): p. 427-36. Umemura, M., et al., IL-17-mediated regulation of innate and acquired immune response against pulmonary Mycobacterium bovis bacille Calmette-Guerin infection. J Immunol, 2007. 178(6): p. 3786-96. Jovanovic, D., et al., IL-17 stimulates the production and expression of proinflammatory cytokines, IL-{beta} and TNF-{alpha}, by human macrophages. J Immunol, 1998. 160(7): p. 3513- 3521. Rahman, M., et al., IL-17R activation of human airway smooth muscle cells induces CXCL-8 production via a transcriptional-dependent mechanism. Clin Immunol, 2005. 115(3): p. 268-276. Laan, M., et al., IL-17-induced cytokine release in human bronchial epithelial cells in vitro: role of mitogen-activated protein (MAP) kinases. Bri J Pharmacol, 2001. 133(1): p. 200-206. Cai, X.Y., et al., Regulation of granulocyte colony-stimulating factor gene expression by interleukin-17. Immunol Lett, 1998. 62(1): p. 51-8. Witowski, J., et al., IL-17 stimulates intraperitoneal neutrophil infiltration through the release of GRO {alpha} chemokine from mesothelial cells. J Immunol, 2000. 165(10): p. 5814-5821. Schwarzenberger, P., et al., Requirement of endogenous stem cell factor and granulocytecolony-stimulating factor for IL-17-mediated granulopoiesis. J Immunol, 2000. 164(9): p. 4783- 4789. Woltman, A.M., et al., Interleukin-17 and CD40-ligand synergistically enhance cytokine and chemokine production by renal epithelial cells. J Am Soc Nephrol, 2000. 11(11): p. 2044-55. 85 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. Ye, P., et al., Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med, 2001. 194(4): p. 519-27. Huang, W., et al., Requirement of interleukin-17A for systemic anti-Candida albicans host defense in mice. J Infect Dis, 2004. 190(3): p. 624-631. Kelly, M., et al., Interleukin-17/interleukin-17 receptor-mediated signaling is important for generation of an optimal polymorphonuclear response against Toxoplasma gondii infection. Infect Immun, 2005. 73(1): p. 617-621. Gaffen, S.L., Structure and signalling in the IL-17 receptor family. Nat Rev Immunol, 2009. 9(8): p. 556-67. Yao, Z., et al., Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine, 1997. 9(11): p. 794-800. Kramer, J.M., et al., Cutting edge: identification of a pre-ligand assembly domain (PLAD) and ligand binding site in the IL-17 receptor. J Immunol, 2007. 179(10): p. 6379-83. Toy, D., et al., Cutting edge: interleukin 17 signals through a heteromeric receptor complex. J Immunol, 2006. 177(1): p. 36-9. Aggarwal, S. and A. Gurney, IL-17: prototype member of an emerging cytokine family. J Leukoc Biol, 2002. 71(1): p. 1-8 O'Quinn, D., et al., Emergence of the Th17 pathway and its role in host defense. Adv Immunol, 2008. 99: p. 115-163. Gaffen, S.L., An overview of IL-17 function and signaling. Cytokine, 2008. 43(3): p. 4027. Qian, Y., et al., The adaptor Act1 is required for interleukin 17-dependent signaling associated with autoimmune and inflammatory disease. Nat Immunol, 2007. 8(3): p. 247-256. Maitra, A., et al., Distinct functional motifs within the IL-17 receptor regulate signal transduction and target gene expression. Proc. Natl. Acad. Sci, 2007. 104(18): p. 750611. Novatchkova, M., et al., The STIR-domain superfamily in signal transduction, development and immunity. Trends Biochem Sci 2003. 28(5): p. 226-9. Toshchakov, V.Y. and S.N. Vogel, Cell-penetrating TIR BB loop decoy peptides a novel class of TLR signaling inhibitors and a tool to study topology of TIR-TIR interactions. Expert Opin Biol Ther, 2007. 7(7): p. 1035-50. Shen, F. and S.L. Gaffen, Structure-function relationships in the IL-17 receptor: implications for signal transduction and therapy. Cytokine, 2008. 41(2): p. 92-104. Dong, C., Regulation and pro-inflammatory function of interleukin-17 family cytokines. Immunol Rev 2008. 226: p. 80-6. Shen, F., et al., IL-17 Receptor Signaling Inhibits C/EBP{beta} by Sequential Phosphorylation of the Regulatory 2 Domain. Sci Signal, 2009. 2(59): p. ra8. Hartupee, J., et al., IL-17 Signaling for mRNA Stabilization Does Not Require TNF Receptor-Associated Factor 6. J Immunol, 2009. 182(3): p. 1660-1666. Schwandner, R., K. Yamaguchi, and Z. Cao, Requirement of tumor necrosis factor receptor-associated factor (TRAF)6 in interleukin 17 signal transduction. J Exp Med, 2000. 191(7): p. 1233-40. 86 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. Ruddy, M., et al., Functional cooperation between interleukin-17 and tumor necrosis factor-{alpha} is mediated by CCAAT/enhancer-binding protein family members. J Biol Chem, 2004. 279(4): p. 2559-2567. Dipak, P. and F. Pelagia, CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J, 2002. 365: p. 561-575. Shen, F., et al., Cytokines link osteoblasts and inflammation: microarray analysis of interleukin-17- and TNF-alpha-induced genes in bone cells. J Leukoc Biol, 2005. 77(3): p. 388-99. Zeng, R., et al., Synergy of IL-21 and IL-15 in regulating CD8+ T cell expansion and function. J Exp Med, 2005. 201(1): p. 139-148. Lindemann, M.J., et al., Differential Regulation of the IL-17 Receptor by γc Cytokines. J Biol Chem, 2008. 283(20): p. 14100-14108. Althoff, K., et al., Shedding of interleukin-6 receptor and tumor necrosis factor alpha. Contribution of the stalk sequence to the cleavage pattern of transmembrane proteins. Eur J Biochem, 2000. 267(9): p. 2624-31. Levine, S.J., Mechanisms of soluble cytokine receptor generation. J Immunol, 2004. 173(9): p. 5343-8. Jostock, T., et al., Soluble gp130 is the natural inhibitor of soluble interleukin 6 receptor transsignaling responses. Eur J Biol Chem, 2001. 268(1): p. 160-167. Haudenschild, D., et al., Soluble and transmembrane isoforms of novel interleukin-17 receptor-like protein by RNA splicing and expression in prostate cancer. J Biol Chem, 2002. 277(6): p. 4309-16. Lei, J.T. and M. Martinez-Moczygemba, Separate endocytic pathways regulate IL-5 receptor internalization and signaling. J Leuokoc Biol, 2008. 84(2): p. 499-509. Di Guglielmo, G.M., et al., Distinct endocytic pathways regulate TGF-beta receptor signalling and turnover. Nat Cell Biol, 2003. 5(5): p. 410-21. Lamaze, C., et al., Interleukin 2 receptors and detergent-resistant membrane domains define a clathrin-independent endocytic pathway. Mol Cell, 2001. 7(3): p. 661-71. Le Roy, C. and J.L. Wrana, Clathrin- and non-clathrin-mediated endocytic regulation of cell signalling. Nat Rev Mol Cell Biol, 2005. 6(2): p. 112-26. Ciak, J. and F.E. Hahn, Chloroquine: mode of action. Science, 1966. 151(708): p. 347-9. Harada, M., et al., Bafilomycin A1, a specific inhibitor of vacuolar-type H+-ATPases, inhibits the receptor-mediated endocytosis of asialoglycoproteins in isolated rat hepatocytes. J Hepatol, 1996. 24(5): p. 594-603. Donaldson, J.G. and N. Segev, Regulation and coordination of intracellular trafficking: an overview. Trafficking Inside Cells: Pathways, Mechanisms and Regulation. Austin/New York: Landes Bioscience/Springer Science+ Business Media, 2009: p. 329– 41. Clague, M.J. and S. Urbe, Ubiquitin: same molecule, different degradation pathways. Cell, 2010. 143(5): p. 682-5. Rong, Z., et al., Interleukin-17F signaling requires ubiquitination of interleukin-17 receptor via TRAF6. Cell Signal, 2007. 19(7): p. 1514-20. Dubin, P. and J. Kolls, IL-23 mediates inflammatory responses to mucoid Pseudomonas aeruginosa lung infection in mice. Am J Physiol Lung Cell Mol Physiol, 2007. 292(2): p. L519- 528. 87 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. Romani, L., et al., Defective tryptophan catabolism underlies inflammation in mouse chronic granulomatous disease. Nature, 2008. 451(7175): p. 211-215. Korn, T., et al., IL-17 and Th17 Cells. Annu Rev Immunol, 2009. 27: p. 485-517. Vignola, A.M., et al., Evaluation of apoptosis of eosinophils, macrophages, and T lymphocytes in mucosal biopsy specimens of patients with asthma and chronic bronchitis. J Allergy Clin Immunol, 1999. 103(4): p. 563-73. Mangan, D. and S. Wahl, Differential regulation of human monocyte programmed cell death (apoptosis) by chemotactic factors and pro-inflammatory cytokines. J Immunol, 1991. 147(10): p. 3408-3412. Sergejeva, S., et al., Interleukin-17 as a recruitment and survival factor for airway macrophages in allergic airway inflammation. Am J Respir Cell Mol Biol, 2005. 33(3): p. 248-53. Shahrara, S., et al., IL-17 induces monocyte migration in rheumatoid arthritis. J Immunol, 2009. 182(6): p. 3884-91. Honorati, M.C., et al., High in vivo expression of interleukin-17 receptor in synovial endothelial cells and chondrocytes from arthritis patients. Rheumatology (Oxford), 2001. 40(5): p. 522-7. Jovanovic, D.V., et al., Stimulation of 92-kd gelatinase (matrix metalloproteinase 9) production by interleukin-17 in human monocyte/macrophages: a possible role in rheumatoid arthritis. Arthritis Rheum, 2000. 43(5): p. 1134-44. Hunt, P.W., Th17, gut, and HIV: therapeutic implications. Curr Opin HIV AIDS, 2010. 5(2): p. 189-93. Maek, A.N.W., et al., Increased interleukin-17 production both in helper T cell subset Th17 and CD4-negative T cells in human immunodeficiency virus infection. Viral Immunol, 2007. 20(1): p. 66-75. Ndhlovu, L.C., et al., Suppression of HIV-1 plasma viral load below detection preserves IL-17 producing T cells in HIV-1 infection. AIDS, 2008. 22(8): p. 990-2. Yue, F.Y., et al., Viral specific IL-17 producing CD4+ T cells are detectable in early HIV-1 infection. J Virol, 2008. 82(13): p. 6767–6771. Griffin, G.E., et al., Activation of HIV gene expression during monocyte differentiation by induction of NF-kB. Nature, 1989. 339(6219): p. 70-73. Garcia-Zepeda, E., et al., Human monocyte chemoattractant protein (MCP)-4 is a novel CC chemokine with activities on monocytes, eosinophils, and basophils induced in allergic and nonallergic inflammation that signals through the CC chemokine receptors (CCR)-2 and-3. J Immunol, 1996. 157(12): p. 5613-26. Witko-Sarsat, V., et al., Neutrophils: molecules, functions and pathophysiological aspects. Laboratory investigation, 2000. 80(5): p. 617-653. Guha, M. and N. Mackman, LPS induction of gene expression in human monocytes. Cell Signal, 2001. 13(2): p. 85-94. Ma, W., et al., The p38 mitogen-activated kinase pathway regulates the human interleukin-10 promoter via the activation of Sp1 transcription factor in lipopolysaccharide-stimulated human macrophages. J Biol Chem, 2001. 276(17): p. 13664-74. Lee, S.M., et al., The regulation and biological activity of interleukin 12. Leuk Lymphoma, 1998. 29(5-6): p. 427-38. 88 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. Liu, D.-f., W. Wei, and L.-h. Song, Upregulation of TNF-[alpha] and IL-6 mRNA in mouse liver induced by bacille Calmette-Guerin plus lipopolysaccharide. Acta Pharmacol Sin, 2006. 27(4): p. 460-468. Guzzo, C., N.F. Che Mat, and K. Gee, Interleukin-27 induces a STAT1/3- and NFkappaB-dependent proinflammatory cytokine profile in human monocytes. J Biol Chem, 2010. 285(32): p. 24404-11. Reibman, J., et al., Regulation of Expression of Granulocyte-Macrophage ColonyStimulating Factor in Human Bronchial Epithelial Cells: Roles of Protein Kinase C and Mitogen-Activated Protein Kinases. J Immunol, 2000. 165(3): p. 1618-1625. Dunne, A. and L. O'Neill, The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci STKE, 2003. 2003(171): p. re3. Gaffen, S.L., et al., The IL-17 cytokine family. Vitam Horm, 2006. 74: p. 255-82. De Bruyn, C., et al., Modulation of human cord blood progenitor cell growth by recombinant human interleukin 3 (IL-3), IL-6, granulocyte-macrophage colony stimulating factor (GM-CSF) and stem cell factor (SCF) in serum-supplemented and serum-free medium. Stem Cells, 1994. 12(6): p. 616-625. Van Grol, J., et al., HIV-1 Inhibits Autophagy in Bystander Macrophage/Monocytic Cells through Src-Akt and STAT3. PLoS One, 2010. 5(7): p. e11733. Heinzelmann, M., et al., Endocytosis of heparin-binding protein (CAP37) is essential for the enhancement of lipopolysaccharide-induced TNF-alpha production in human monocytes. J Immunol, 1999. 162(7): p. 4240-5. Tveten, K., et al., The effect of bafilomycin A1 and protease inhibitors on the degradation and recycling of a Class 5-mutant LDLR. Acta Biochim Biophys Sin, 2009. 41(3): p. 246-255. Farina, c., et al., V-atpase inhibitors for use in the treatment of septic shock. 2007, WO Patent WO/2007/048,848. Scala, G. and J. Oppenheim, Antigen presentation by human monocytes: evidence for stimulant processing and requirement for interleukin 1. J Immunol, 1983. 131(3): p. 1160-1166. Jang, C.H., et al., Chloroquine inhibits production of TNF-alpha, IL-1beta and IL-6 from lipopolysaccharide-stimulated human monocytes/macrophages by different modes. Rheumatology (Oxford), 2006. 45(6): p. 703-10. Kitchens, R.L., Role of CD14 in cellular recognition of bacterial lipopolysaccharides. Chem Immunol, 2000. 74: p. 61-82. Dentener, M., et al., Involvement of CD14 in lipopolysaccharide-induced tumor necrosis factor-alpha, IL-6 and IL-8 release by human monocytes and alveolar macrophages. J Immunol, 1993. 150(7): p. 2885-91. Ladisch, S., et al., Modulation of the immune response by gangliosides. Inhibition of adherent monocyte accessory function in vitro. J Clin Invest, 1984. 74(6): p. 2074-81. Kamphuis, S., et al., Tolerogenic immune responses to novel T-cell epitopes from heatshock protein 60 in juvenile idiopathic arthritis. Lancet, 2005. 366(9479): p. 50-56. Gee, K., et al., Differential regulation of CD44 expression by lipopolysaccharide (LPS) and TNF-alpha in human monocytic cells: distinct involvement of c-Jun N-terminal kinase in LPS-induced CD44 expression. J Immunol, 2002. 169(10): p. 5660-72. 89 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. Day, D. and M. Tuite, Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview. J Endocrinol, 1998. 157(3): p. 361-71. Anderson, P., Post-transcriptional control of cytokine production. Nat Immunol, 2008. 9(4): p. 353-9. Stoecklin, G. and P. Anderson, Posttranscriptional mechanisms regulating the inflammatory response. Adv Immunol, 2006. 89: p. 1-37. O'Connell, R.M., et al., MicroRNA-155 is induced during the macrophage inflammatory response. Proc. Natl. Acad. Sci, 2007. 104(5): p. 1604-9. Rodriguez, A., et al., Requirement of bic/microRNA-155 for normal immune function. Science, 2007. 316(5824): p. 608-11. Kurosaka, K., N. Watanabe, and Y. Kobayashi, Production of proinflammatory cytokines by phorbol myristate acetate-treated THP-1 cells and monocyte-derived macrophages after phagocytosis of apoptotic CTLL-2 cells. J Immunol, 1998. 161(11): p. 6245-9. Gilfillan, M.C., et al., Expression of the Costimulatory Receptor CD30 Is Regulated by Both CD28 and Cytokines. J Immunol, 1998. 160(5): p. 2180-2187. Ho, A.W., et al., IL-17RC Is Required for Immune Signaling via an Extended SEF/IL-17R Signaling Domain in the Cytoplasmic Tail. J Immunol, 2010. 185(2): p. 1063-1070. Ho, A.W. and S.L. Gaffen, IL-17RC: a partner in IL-17 signaling and beyond. Semin Immunopathol, 2010. 32(1): p. 33-42. Hull, K.M., et al., The TNF receptor-associated periodic syndrome (TRAPS): emerging concepts of an autoinflammatory disorder. Medicine, 2002. 81(5): p. 349-68. Cunnion, K.M., Tumor necrosis factor receptors encoded by poxviruses. Mol Genet Metab, 1999. 67(4): p. 278-82. Pitti, R.M., et al., Genomic amplification of a decoy receptor for Fas ligand in lung and colon cancer. Nature, 1998. 396(6712): p. 699-703. Sung, H.H., et al., Transgenic expression of decoy receptor 3 protects islets from spontaneous and chemical-induced autoimmune destruction in nonobese diabetic mice. J Exp Med, 2004. 199(8): p. 1143-51. Andreola, G., et al., Induction of lymphocyte apoptosis by tumor cell secretion of FasLbearing microvesicles. J Exp Med, 2002. 195(10): p. 1303-16. van den Borne, B.E., et al., Chloroquine and hydroxychloroquine equally affect tumor necrosis factor-alpha, interleukin 6, and interferon-gamma production by peripheral blood mononuclear cells. J Rheumatol, 1997. 24(1): p. 55-60. Picot, S., et al., Chloroquine-induced inhibition of the production of TNF, but not of IL-6, is affected by disruption of iron metabolism. Immunology, 1993. 80(1): p. 127-33. Chen, Z.J. and L.J. Sun, Nonproteolytic functions of ubiquitin in cell signaling. Mol Cell, 2009. 33(3): p. 275-86. Bush, K.A., et al., Reduction of joint inflammation and bone erosion in rat adjuvant arthritis by treatment with interleukin-17 receptor IgG1 Fc fusion protein. Arthritis Rheum, 2002. 46(3): p. 802-5. Lubberts, E., IL-17/Th17 targeting: on the road to prevent chronic destructive arthritis? Cytokine, 2008. 41(2): p. 84-91. Kassiotis, G. and G. Kollias, TNF and receptors in organ-specific autoimmune disease: multi-layered functioning mirrored in animal models. J Clin Invest, 2001. 107(12): p. 1507-8. 90 148. 149. Deng, G.M., et al., Amelioration of inflammatory arthritis by targeting the pre-ligand assembly domain of tumor necrosis factor receptors. Nat Med, 2005. 11(10): p. 10661072. Smith, E., et al., IL-17A inhibits the expansion of IL-17A-producing T cells in mice through "short-loop" inhibition via IL-17 receptor. J Immunol, 2008. 181(2): p. 1357-64. 91 Appendix 92 Co-authored publications: 1. Che Mat NF, Zhang X, Guzzo C, Gee K. Interleukin-23-induced interleukin-23 receptor subunit expression is mediated by the janus kinase/signal transducer and activation of transcription pathway in human CD4 T cells. J Interferon Cytokine Res, 2011. 31(4):363-71 For this paper, I did RT-PCR and Western blot analysis that confirmed the induction of IL-23 receptors in response to IL-23, and Western blot analysis that showed phosphorylation of STAT3 in response to IL-23. 2. Guzzo C, Che Mat NF, Zhang X, Gee K. HIV Infection. Impact of HIV infection and HAART therapy on CD4 T helper cell subset expression and function.2011. InTech. In press. For this book chapter, I wrote the section on IL-17/Th17 role in HIV infection. 93 JOURNAL OF INTERFERON & CYTOKINE RESEARCH Volume 31, Number 4, 2011 ª Mary Ann Liebert, Inc. DOI: 10.1089/jir.2010.0083 Interleukin-23-Induced Interleukin-23 Receptor Subunit Expression Is Mediated by the Janus Kinase/Signal Transducer and Activation of Transcription Pathway in Human CD4 T Cells Nor Fazila Che Mat, Xiubo Zhang, Christina Guzzo, and Katrina Gee Interleukin (IL)-23 plays a critical role in the development of the T helper (Th) cell response and is responsible for the maintenance of the IL-17 producing subset of Th cells, Th17. IL-23 is a heterodimeric cytokine composed of IL-23p19 and IL-12p40 subunits, and the signaling pathway for IL-23 involves 2 receptor chains: IL-12Rb1 and IL-23Ra. The IL-23 receptor complex is expressed on a number of cells, including natural killer cells, monocytes, macrophages, dendritic cells, and CD4 T cells. Currently, the molecular mechanisms governing expression of the IL-23 receptor chains, IL-23Ra and IL-12Rb1, are not well understood. Our results show that IL-23 induces upregulation of IL-23Ra and IL-12Rb1 expression in human CD4 T cells. Further, we demonstrate that inhibition of the Janus kinase/signal transducer and activation of transcription ( JAK/STAT) pathway by SD-1029, a JAK2 inhibitor, 50 -deoxy-50 -(methylthio) adenosine, a STAT1 inhibitor, and STAT3 VII, a STAT3 inhibitor, were able to block IL-23-induced expression of IL-23 receptor subunits in the human SUPT-1 T cell line and in primary CD4 human T cells. Taken together, our results suggest a positive feedback regulation of the IL-23 receptor via IL-23mediated activation of the JAK/STAT pathway. Introduction T he interaction between interleukin-23 (IL-23) and its specific receptor, IL-23R, plays a critical role in promoting the proliferation of memory T helper 1 (Th1) cells. IL-23, produced by antigen presenting cells, has proinflammatory activity and is involved in the development of autoimmune diseases, including rheumatoid arthritis, multiple sclerosis, and psoriasis (Lee and others 2004; VakninDembinsky and others 2006; Kim and others 2007). This cytokine also supports the in vivo development and expansion of the novel IL-17 producing Th cell subset, Th17 cells (Harrington and others 2005; Langrish and others 2005; Chen and others 2007; Zhou and others 2007; Manel and others 2008; McGeachy and others 2009; Morishima and others 2009). Th17 cells play an important role in the induction of autoimmune disease and are also involved in host defense against extracellular bacteria and fungi (Langrish and others 2005; Weaver and others 2006, 2007; Bettelli and others 2007; Gee and others 2009). Regulation of IL-23 responsiveness, in terms of IL-23R expression is critical to the maintenance of the Th17 response pathway. The IL-23R is heterodimeric, consisting of a unique IL23Ra chain and the IL-12Rb1 chain as found in the IL-12 receptor (Parham and others 2002). IL-23Ra is expressed on activated T cells, memory T cells, as well as natural killer cells and monocytes/macrophage and dendritic cells (Belladonna and others 2002; Parham and others 2002), whereas the IL-12Rb1 chain has been shown to be expressed on T cells, natural killer cells, and dendritic cells (Desai and others 1992). Activated human CD4 T cells treated with anti-CD3 and anti-CD28 in the presence of IL-23 express enhanced levels of IL-23R (Chen and others 2007), and IL-6 and transforming growth factor-beta (TGF-b) have also been shown to induce the upregulation of IL-23R and enhance IL23 responsiveness/Th17 differentiation (Yang and others 2007; Zhou and others 2007; Morishima and others 2009). IL2, IL-7, and IL-15 have been shown to upregulate IL-12Rb1 expression (Wu and others 1997). However, the molecular mechanism behind IL-23-mediated IL-23Ra expression has not been investigated in CD4 T cells, and the effect of IL-23 on IL-12Rb1 expression has not been reported. IL-23 has been shown to activate a similar profile of the Janus kinase ( JAK) and signal transducers and activator of transcription (STAT) pathway as that of IL-12. Members of the JAK/STAT pathway induced by IL-12 and IL-23 include JAK2, Tyk2, STAT1, STAT3, STAT4, and STAT5 (Parham and others 2002). Both IL-23 receptor subunits are required Department of Microbiology and Immunology, Queen’s University, Kingston, Ontario, Canada. 94 363 364 CHE MAT ET AL. for the bioactivity of IL-23, but IL-23Ra is responsible for the activation of intracellular signal transduction due to its association with JAK2 and STAT3 (Parham and others 2002; Hunter 2005). A critical role for STAT3 in Th17 development has been described (Nishihara and others 2007; Yang and others 2007; Chaudhry and others 2009) and IL-23-induced activation of STAT3 plays a role in IL-17 production from Th17 cells (Cho and others 2006; Yang and others 2007; Caruso and others 2008). Using primary human CD4 T cells and the human T cell line, SUPT-1, we demonstrate that IL-23 induces the upregulation of both IL-23Ra and IL-12Rb1 receptor chains at both message and protein levels. Additionally, we show that JAK2, STAT1, and STAT3 activation are required for IL-23mediated induction of its own receptor. These results suggest that IL-23 plays an important role in a positive feedback loop in terms of IL-23R expression and IL-23 responsiveness in human CD4 T cells. Materials and Methods CD4 T lymphocyte isolation Peripheral blood mononuclear cells were isolated by centrifugation over Lympholyte (Cedarlane). CD4 T cells were purified from peripheral blood mononuclear cells by using the Human CD4þ T cell Enrichment Kit (Stem Cell Technologies) as per the manufacturer’s instructions. Briefly, the cells were washed with phosphate-buffered saline–EDTA (Sigma) with 2% fetal calf serum (FCS) (Hyclone). After washing, cells were cultured in Iscove’s modified Dulbecco’s medium (IMDM) (Gibco–Invitrogen) supplemented with 10% FCS, and the viability of the cells were tested with trypan blue (Fluka). Cell culture and stimulation Signalling Technology. For receptor expression, whole cell lysates were subjected to Western analysis using anti-IL12Rb1 and anti-IL-23Ra (Santa Cruz Biotechnology). b-Actin (Biovision) was used as a loading control as indicated. Horseradish peroxidase-labeled secondary antibodies, goat anti-mouse IgG, goat anti-rabbit IgG, and rabbit anti-goat IgG were obtained from Santa Cruz Biotechnology. Expression of protein was measured by chemiluminesce using the ECL Advance Detection Kit (Amersham Biosciences) and detected using the HD2 Alphalnnotech imaging system (Fisher Scientific). Fold increase relative to b-actin expression was measured using HD2 AlphaInnotech imaging software. Reverse transcriptase–polymerase chain reaction Total RNA was prepared using the TRI-Reagent (Bioshop Canada, Inc.) method. RNA was reverse transcribed into cDNA using Moloney murine leukemia virus RT, with random primers, RNase Out, and oligo dT (Invitrogen). PCR amplification of cDNA aliquots was performed by adding 2 mL of cDNA, sense and antisense primers, and 5 Taq Polymerase Master Mix (New England Biolabs). The following specific primers were used—IL-23Ra: sense 50 -TGTA CTGCACTGCTGAATGTCCCA-30 , antisense 50 -ATTCCAGG TGCAAGTCATGTTGCC-30 ; IL-12 Rb1: sense 50 -ACACTGT CACACTCTGGGTGGAAT-30 , antisense 50 -AACTGAGTTG TAGAGCTGCAGGGT-30 ; h18srRNA: sense 50 -TTCGGAAC TGAGGCCATGAT-30 , antisense 50 -CGAACCTCCGACTT TCGTTT-30 . The PCR products were separated on 2% agarose gels (Bioshop Canada Inc) containing ethidium bromide (Sigma) and were observed using the HD2 Alphalnnotech imaging system. Fold increase relative to 18srRNA expression was measured using HD2 AlphaInnotech imaging software. Electrophoretic mobility shift assay SUPT-1 (ATCC), a human leukemic T cell line, and primary CD4 T cells were cultured in IMDM supplemented with 10% FCS. SUPT-1 cells and primary CD4 T cells were stimulated with recombinant IL-23 (5 ng/mL) (R&D Systems) and incubated at 378C for different times for either Western blotting analysis or reverse transcriptase–polymerase chain reaction (RT-PCR). SD-1029 (Calbiochem) was used as JAK2 inhibitor, 50 -deoxy-50 -(methylthio) adenosine (MTA; Sigma) was used as STAT1 inhibitor, and STAT3 VII (Calbiochem) was used as STAT3 inhibitor. Western blot analysis SUPT-1 cells and primary CD4 T cells were cultured with IL-23 (5 ng/mL) from 0 to 60 min or from 0 to 24 h. Cells were harvested and lysed in lysis buffer [1 M HEPES, 0.5 M NaF, 0.5 M EGTA, 2.5 M NaCl, 1 M MgCl2, 100% glycerol, 100% Triton-X-100, and protease inhibitor cocktail (Pierce)]. Fifty micrograms of total protein was resolved on 12% polyacrylamide gels and were transferred to polyvinylidene fluoride (PVDF) membranes (Pall Corporation) and then blocked 1 h in 2.5% bovine serum albumin (Bioshop Canada, Inc.). Specific antibodies for phosphorylated JAK2, phosphorylated Tyk2, phosphorylated STAT1, phosphorylated STAT3, and phosphorylated STAT4 were purchased from Santa Cruz Biotechnology. Antibodies for pan JAK2, Tyk2, STAT1, STAT3, and STAT4 were purchased from Cell 95 Cell pellets were resuspended in 1 mL of cold Buffer A [10 mM HEPES (pH 7.9), 10 mM KCl, and 1.5 mM MgCl2] and centrifuged at 48C at 200 g for 5 min. Cell pellets were then again resuspended with cold Buffer A plus 0.1% NP40 and incubated on ice for 10 min followed by centrifugation at 48C at 20,000 g. Resulting cell pellets were resuspended with cold Buffer B [20 mM HEPES (pH 7.0), 420 nM NaCl, 1.5 mM MgCl2, 0.2 EDTA, and 25% glycerol] and incubated for 15 min on ice, followed by centrifugation at 48C at 20,000 g for 10 min. The supernatant was mixed with cold Buffer C (20 mM HEPES, 50 mM KCl, 0.2 mM EDTA, and 20% glycerol). Nuclear protein concentration was measured by the Bradford method. Binding reactions were carried out by incubating 5 mg of nuclear extract in binding buffer (100 mM Tris, 500 mM KCl, and 10 mM DTT) with 50% glycerol, 100 mM MgCl2, Poly dIdC, 1% NP-40, and biotin-labeled probes (STAT1: 50 -CAT GTT ATG CAT ATT CCT GTA AGT G-30 ; STAT3: 50 -GAT CCT TCT GGG AAT TCC TAG ATC-30 ). The specificity of protein–DNA complexes was determined by incubating the extracts with excess (200-fold) of annealed, unlabelled, cold competitor probe for 30 min at room temperature. Supershift analysis was performed by incubating 2 mg of polyclonal rabbit anti-STAT1 or antiSTAT3 (Santa Cruz) with the reaction for 1 h at room temperature. The analysis of the DNA–protein complex was carried out on a 5% nondenaturing polyacrylamide gel, IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS transferred to nylon membranes (Pierce) and cross-linked (Spectroline UV Crosslinker; Fisher Scientific). Detection was performed by chemiluminesce using the ECL Advance detection kit (Amersham Biosciences) and detected using the HD2 Alphalnnotech imaging system. Results Characterization of the IL-23-induced JAK/STAT pathway in human CD4 T cells To characterize the signaling pathway induced by IL-23, we stimulated CD4 T cells with IL-23 and examined the phosphorylation of JAK and STAT molecules. We initially performed these experiments in primary CD4 T cells (Fig. 1A). For an additional human CD4 T cell model system, we utilized the T cell line SUPT-1 (Fig. 1B). Our results demonstrate that IL-23 induces the phosphorylation of JAK2, Tyk2, STAT1, STAT3, and STAT4 in both primary human CD4 T cells (Fig. 1A) and in SUPT-1 cells (Fig. 1B). Phosphorylated JAK2, Tyk2, STAT1, and STAT3 proteins were detected at 5 min after stimulation and reached maximum levels after 15 min. The STAT4 activation is notably weaker in response to IL-23 in primary CD4 T cells (Fig. 1A). IL-23 induces IL-23 receptor expression in human CD4 T cells Previously, it has been reported that both IL-23 receptor chains are detected in human T cells (Parham and others 2002) and activated human CD4 T cells treated with IL-23 expressed elevated IL-23R mRNA expression (Chen and others 2007). However, there is no evidence as to whether IL23 alone is able to induce expression of the IL-23 receptor subunits in human CD4 T cells. To directly address this issue, we stimulated primary human CD4 T cells and SUPT-1 with IL-23 from 0 to 8 h, for mRNA expression, and from 0 to 24 h for protein expression. We found that IL-23 was able to in- 365 duce expression of both IL-23 receptor subunits in primary human CD4 T cells and SUPT-1 cells (Fig. 2). It has been demonstrated that IL-6 and TGF-b can stimulate IL-23R expression (Yang and others 2007; Zhou and others 2007; Morishima and others 2009). To confirm that the induction of IL-12Rb1 and IL-23Ra expression is due directly to IL-23mediated signaling in our cell systems and not secondary downstream induction of cytokines, we tested whether IL23-treated SUPT-1 cells and primary CD4 T cells expressed upregulated expression of either IL-6 or TGF-b. Our data indicated that although basal levels of TGF-b mRNA were detected in unstimulated cells, IL-23 was not able to enhance TGF-b expression. Additionally, no IL-6 was detectable in resting cells and IL-23 was not capable of inducing IL-6 expression (data not shown). Protein expression levels of IL-12Rb1 and IL-23Ra were enhanced after 4 h stimulation with IL-23 and, in the case of IL-12Rb1, persisted up to 24 h in primary CD4 T cells (Fig. 2A) and SUPT-1 cells (Fig. 2B). In the case of IL-23Ra, expression peaked at 16 h in primary cells and at 8 h in SUPT-1 cells and returned to basal levels after 24 h. To determine whether IL-23 affected IL-23R expression at the level of transcription, we examined the pattern of IL-23-induced IL23R expression by RT-PCR. IL-23 was able to induce IL-23Ra and IL-12Rb1 mRNA expression in both primary CD4 T cells and in SUPT-1 cells in a similar pattern as detected by Western blotting. IL-12Rb1 expression was enhanced after 2 h of IL-23 stimulation in primary cells (Fig. 2A) and in SUPT-1 cells (Fig. 2B). Upregulation of IL-12Rb1 mRNA expression persisted for up to 8 h. However, IL-23Ra expression induced after 2 h of IL-23 treatment in primary cells decreased to close to basal levels after 8 h of treatment (Fig. 2A). In SUPT-1 cells, IL-23Ra expression was induced after 4 h of IL-23 treatment and was ablated by 8 h (Fig. 2B). Taken together, these results indicate that the temporal regulation of IL-23R subunits by IL-23 stimulation may be differentially controlled. FIG. 1. IL-23 induces phosphorylation of the JAK/STAT pathway in human CD4 T cells. Primary human CD4 T cells (A) or SUPT-1 cells (B) were treated with IL-23 for the times indicated. Cell lysates were analyzed by SDS-PAGE and membranes were blotted using phospho (p)specific antibodies to JAK2, Tyk2, STAT1, STAT3, or STAT4. Membranes were also probed with pan antibodies for JAK2, Tyk2, STAT1, STAT3, or STAT4 as loading controls. Blots shown are representative of 5 separate experiments. IL, interleukin; JAK, Janus kinase; SDSPAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; STAT, signal transducers and activator of transcription. 96 366 CHE MAT ET AL. FIG. 2. IL-23 enhances expression of IL-23Ra and IL-12Rb1 expression in human CD4 T cells. Primary human CD4 T cells (A) or SUPT-1 cells (B) were treated with IL-23 for the times indicated. Cell lysates (left panels) were analyzed by SDS-PAGE and membranes were blotted using antibodies to either IL-12Rb1 or IL-23Ra. Membranes were probed with b-actin as a loading control. Total mRNA (right panels) was analyzed for IL-12Rb1 and IL-23Ra expression by RT-PCR. 18srRNA was included as the house keeping gene. Data shown are representative of 5 separate experiments. Fold increase was determined relative to b-actin or 18srRNA for Western blots and RT-PCR analysis, respectively. RT-PCR, reverse transcriptase–polymerase chain reaction. together, these results indicate the involvement of the JAK/ STAT pathway in IL-23-induced IL-23R expression. To further dissect this pathway, we examined the effect of the STAT1 inhibitor, MTA, on IL-23-induced IL-23R expression. Initially, we confirmed the specificity of MTA on the nuclear localization of the STAT1 protein by electrophoretic mobility shift assay (EMSA), since this inhibitor does not affect the phosphorylation of STAT1, but does inhibit the activation of STAT1 as measured by nuclear localization (Mowen and others 2001; Shen and Lentsch 2004). Nuclear extracts from SUPT-1 T cells were analyzed for the presence of activated STAT1 after 1 h incubation with MTA before IL-23 treatment. The addition of MTA at different doses (0.1, 0.3, and 1.0 mM) resulted in a dose-dependent inhibition of STAT1 activation (Fig. 4A). Supershift experiments using anti-STAT1 antibodies exhibited a partial inhibition of the protein–DNA complex, indicating the presence of activated STAT1 proteins. Additionally, STAT1/STAT3 heterodimers have been detected (Stancato and others 1996; Sato and others 1997; Sheikh and others 2004; Guzzo and others 2010). To test whether STAT1/3 heterodimers were being induced in this system, we performed supershift analysis using anti-STAT3 antibodies. Incubation of nuclear proteins with anti-STAT3 also resulted in a partial abrogation of protein–DNA complexes. To confirm these results, we also performed EMSA analysis using STAT3-specific probes. These results show that MTA is also able to inhibit STAT3 activation in a dosedependent manner. Supershift experiments using either anti-STAT1 or anti-STAT3 antibodies show inhibition of protein–DNA complexes, indicating the formation of IL-23induced STAT1/3 heterodimers. We next determined whether treatment of cells with MTA affected IL-23-induced IL-23R expression. The effect of MTA on IL-23R expression was examined at protein and mRNA levels. Analysis by Western blot and RT-PCR showed that MTA significantly downregulated the IL-12Rb1 and IL-23Ra expression in SUPT-1 (Fig. 4B) and primary CD4 T cells (Fig. 4C). The inhibitory effects were observed as early as 0.1 mM of MTA and levels of IL-12Rb1 and IL-23Ra expression returned to basal levels at 1 mM of MTA. The JAK/STAT pathway regulates IL-23-induced IL-23 receptor expression We sought to identify the regulatory mechanisms of IL-23mediated IL-23R subunit expression. Since JAK2 and STAT3 have been demonstrated to physically associate with the IL-23Ra, and STAT1 and STAT3 exhibit relatively strong phosphorylation in response to IL-23 stimulation in primary CD4 T cells (Fig. 1A) (Parham and others 2002), we chose to focus on the role of these JAK/STAT family members in IL-23-mediated IL-23R expression. To study the role played by the JAK/STAT pathway in IL-23-induced upregulation of IL-23Ra and IL-12Rb1 expression, we used specific inhibitors for JAK2 (SD-1029), STAT1 (MTA), and STAT3 (STAT3 VII). Initially, we investigated the effect of the JAK2 inhibitor on IL-23-mediated IL-23R expression. First, we confirmed the inhibitory effect of SD-1029 by measuring the phosphorylation of JAK2 in SUPT-1 cells. The phosphorylation of JAK2 in SUPT-1 (Fig. 3A) and primary CD4 T cells (data not shown) was suppressed after 1 h incubation with SD-1029 before IL-23 stimulation. The effect of SD-1029 on Tyk2 phosphorylation has not been well documented, and since IL-23 induces Tyk2 phosphorylation, we examined whether SD-1029 was also capable of inhibiting Tyk2 activation. The results indicate that IL-23-induced Tyk2 phosphorylation is blocked by SD-1029. Since phosphorylated JAK2 and Tyk2 subsequently activate downstream targets, including STAT1 and STAT3, we examined the effect of this inhibitor on the phosphorylation of STAT1 and STAT3. As expected, SD-1029 was also able to inhibit the phosphorylation of STAT1 and STAT3 (Fig. 3A). Evaluation of the effect of SD-1029 on IL-23-induced IL12Rb1 and IL-23Ra expression showed a significant inhibition of each receptor chain. In both SUPT-1 (Fig. 3B) and primary CD4 T cells (Fig. 3C), inhibition of protein and mRNA levels of IL-12Rb1 by SD-1029 were observed at 5 mM and decreased to basal levels at 10 mM. In the case of the IL23Ra subunit, SD-1029 preincubation resulted in the abrogation of protein and mRNA expression at 5 mM in both SUPT-1 (Fig. 3B) and primary CD4 T cells (Fig. 3C). Taken 97 IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS 367 FIG. 3. IL-23-induced IL23 receptor subunit expression is dependent on the JAK/STAT pathway. (A) SUPT-1 cells were pretreated for 1 h with the JAK2 inhibitor SD-1029 at doses ranging from 1 to 10 mM followed by treatment with IL-23 for 15 min. Cell lysates were analyzed by SDS-PAGE and membranes were probed using phospho (p) specific antibodies for JAK2, Tyk2, STAT1, and STAT3. JAK2 antibodies were used as loading control. SUPT-1 (B) and primary human CD4 T cells (C) were pretreated for 1 h with the JAK2 inhibitor SD-1029 at doses ranging from 0 to 10 mM followed by treatment with IL-23 for 8 or 4 h for Western blotting or RTPCR analysis, respectively. Cell lysates were analyzed by SDS-PAGE (top panels) and membranes were blotted using antibodies to either IL-12Rb1 or IL-23Ra. Membranes were probed with b-actin as a loading control. Total mRNA (bottom panels) was analyzed for IL-12Rb1 and IL-23Ra expression by RT-PCR. 18SrRNA was included as the house keeping gene. Data shown are representative of 5 separate experiments. Fold increase was determined relative to b-actin or 18srRNA for Western blots and RT-PCR analysis, respectively. vious work demonstrates that IL-23 activates the JAK/STAT pathway through complex formation with IL-23Ra and IL12Rb1 (Oppmann and others 2000; Parham and others 2002). As our model systems, we used primary human CD4 T cells isolated from healthy donors and the SUPT-1 human T cell line. In both cell types, we demonstrate that IL-23 was able to induce the JAK/STAT pathway via strong phosphorylation of JAK2, Tyk2, STAT1, and STAT3. In agreement with others, we demonstrated that IL-23 induces weaker phosphorylation of STAT4 compared to STAT1 or STAT3 in primary CD4 T cells (Oppmann and others 2000; Parham and others 2002). The activation of JAK/STAT signaling molecules in response to IL-23 is dependent on the presence of IL-23Ra (Parham and others 2002); however, the regulation of IL23Ra and that of IL-12Rb1 in response to IL-23 stimulation are not described. Previously, IL-6 was shown to upregulate IL-23R mRNA expression in the presence or absence of IL-23 in T cells after anti-CD3/anti-CD28 activation (Yang and others 2007). Further to this study, Morishima and others (2009) demonstrated that IL-23 in synergy with IL-6 was required to enhance IL-23R protein levels, whereas IL-6 alone enhanced IL-23R at the message level only. Our study shows that IL-23 is not able to induce IL-6 expression, indicating that IL-23-mediated IL-23R induction is occurring We next examined the role of STAT3 in IL-23-mediated induction of IL-23R through the use of a STAT3 inhibitor, STAT3 VII (Xu and others 2008). We cultured human CD4 T cells with STAT3 VII for 1 h before IL-23 stimulation and examined the suppression of STAT3 phosphorylation by Western analysis. Incubation with STAT3 VII for 1 h significantly suppressed the activation of STAT3 in SUPT-1 (Fig. 5A) and primary CD4 T cells (data not shown). The phosphorylation of STAT1 did not change, indicating that this inhibitor is specific for STAT3 and does not affect the phosphorylation of STAT1. STAT3 VII also had no significant effect on the total amount of cellular STAT3 protein as determined by Western analysis (Fig. 5A). In human CD4 T cells, incubation with STAT3 VII for 1 h before IL-23 stimulation led to inhibition of IL-23-induced IL-23R expression. The expression levels of IL-12Rb1 and IL-23Ra in both SUPT1 cells (Fig. 5B) and primary CD4 T cells (Fig. 5C) decreased at doses as low as 0.5 mM of STAT3 VII and returned to basal levels, or below, at 2 mM of STAT3 VII. Discussion In this study, we provide evidence that JAK2, STAT1, and STAT3 are involved in IL-23-induced IL-23R expression. Pre- 98 368 CHE MAT ET AL. FIG. 4. STAT1 is involved in IL-23-mediated IL-23Ra and IL-12Rb1 upregulation. (A) SUPT-1 cells were pretreated for 1 h with STAT1 inhibitor, MTA, at doses ranging from 0.1 to 1 mM followed by treatment with IL-23 for 15 min. EMSA was performed on nuclear lysates using probes specific for either STAT1 or STAT3. SS assays with antibodies for either STAT1 of STAT3 were performed as indicated. CC probe was added to indicate binding specificity. SUPT-1 (B) and primary human CD4 T cells (C) were pretreated for 1 h with the STAT1 inhibitor MTA at doses ranging from 0.1 to 1 mM followed by treatment with IL-23 for 8 or 4 h for Western blotting or RT-PCR analysis, respectively. Cell lysates were analyzed by SDSPAGE (top panels) and membranes were blotted using antibodies to either IL-12Rb1 or IL-23Ra. Membranes were probed with b-actin as a loading control. Total mRNA (bottom panels) was analyzed for IL-12Rb1 and IL-23Ra expression by RT-PCR. 18srRNA was included as the house keeping gene. Data shown are representative of 5 separate experiments. Fold increase was determined relative to b-actin or 18srRNA for Western blots and RT-PCR analysis, respectively. CC, cold competitor; MTA, 50 -deoxy-50 -(methylthio) adenosine; SS, supershift. independently of endogenous IL-6 expression in both SUPT-1 cells and primary CD4 T cells. A role for TGF-b in upregulation of IL-23Ra has also been demonstrated, whereby IL-6 stimulation of CD4 T cells induced the upregulation of TGF-b mRNA expression (Morishima and others 2009). However, as levels of IL-6 were undetectable and as TGF-b signals mainly through the Smad signaling family (Moustakas and others 2002; Letterio 2005), it is unlikely that TGF-b is involved in induction of IL-23R expression in our system. Indeed, our results demonstrated that IL-23 stimulation did not enhance mRNA levels of TGF-b. Human memory T cells are also able to upregulate IL-23 receptor expression in response to anti-CD3/anti-CD28 in combination with IL-23 (Chen and others 2007). The effects of activation of T cells on the molecular mechanism behind IL-23-mediated IL-23R upregulation are yet to be studied and the role of other key cytokines, including that of IL-6 and TGF-b, is yet to be fully elucidated. However, we demonstrate for the first time that IL-23 alone is able to induce both IL-23R subunit expression at mRNA and protein levels in primary human CD4 T cells. Recently, IL-23R has been shown to contribute to the development autoimmune disease. IL-23R can be alternatively spliced to generate at least 6 isoforms in normal lymphoid cells and in numerous tumor cell lines (Zhang and others 2006). Polymorphisms within the IL-23R gene locus have been reported to be involved in inflammatory bowel disease, Crohn’s disease, ulcerative colitis, and in the development of psoriasis (Duerr and others 2006; Garcia and others 2008). 99 Although the focus of many studies has been on the formation of splice variant expression of IL-23R, the molecular mechanisms governing regulation of IL-2R subunit expression have not been reported. Our data indicate that although IL-23 induced expression of both IL-12Rb and IL-23Ra in human CD4 T cells, the temporal regulation of each receptor unit is different, and thus may be regulated by different factors. In both cell types, induction of IL-23Ra appears to be transient, returning to basal levels after 24 h of IL-23 treatment. This effect is mirrored in the RT-PCR data, whereby after 8 h of IL-23 treatment the IL-23Ra expression is significantly diminished. On the other hand, expression of IL-12Rb1 appears to be maintained in both the protein and mRNA levels. IL-23 has been shown to induce expression suppressor of cytokine signaling 3(SOCS3) expression, which subsequently inhibits IL-23induced STAT3 activation (Chen and others 2006). Induction of SOCS proteins, in particular that of SOCS3, may account for the significant decrease in IL-23Ra expression compared to that of IL-12Rb1, and further work in this regard is required to identify a role for these proteins in IL-23-mediated IL-23R expression. In our study, we demonstrate that IL-23 enhances IL-23 receptor expression through the JAK/STAT pathway. We determined this through the use of specific inhibitors for JAK2, STAT1, and STAT3: namely, SD-1029, MTA, and STAT3 VII, respectively. Because JAK2 and STAT3 have been demonstrated to physically associate with the IL-23Ra (Parham and others 2002), and because our data showed that IL- IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS 369 FIG. 5. STAT3 is involved in IL-23-induced IL-23Ra and IL-12Rb1 upregulation. (A) SUPT-1 cells were pretreated for 1 h with STAT3 inhibitor, STAT3 VII, for doses ranging from 0.5 to 2 mM followed by treatment with IL-23 for 15 min. Cell lysates were analyzed by SDS-PAGE and membranes were probed using phospho (p)-specific antibodies for STAT1 and STAT3. STAT3 antibodies were used as loading control. SUPT-1 (B) and primary human CD4 T cells (C) were pretreated for 1 h with the STAT3 inhibitor STAT3 VII, for doses ranging from 0.5 to 2 mM followed by treatment with IL-23 for 8 or 4 h for Western blotting or RT-PCR analysis, respectively. Proteins were resolved by SDS-PAGE (top panels) and membranes were blotted using antibodies to either IL-12Rb1 or IL-23Ra. Membranes were probed with b-actin as a loading control. Total mRNA (bottom panels) was analyzed for IL-12Rb1 and IL-23Ra expression by RT-PCR. 18srRNA was included as the house keeping gene. Data shown are representative of 5 separate experiments. Fold increase was determined relative to b-actin or 18srRNA for Western blots and RT-PCR analysis, respectively. 23 stimulation elicited strong phosphorylation of STAT1 and STAT3 in primary CD4 T cells, we chose to focus on the role of these JAK/STAT family members in IL-23-mediated IL23R expression. SD-1029 has previously been reported as an inhibitor of STAT3 activation due to inhibition of JAK2 phosphorylation (Duan and others 2006). As we expected, SD-1029 inhibited not only JAK2 phosphorylation, but also the phosphorylation of STAT1 and STAT3. We also observed that SD-1029 strongly inhibited Tyk2 phosphorylation, implicating both JAK2 and Tyk2 as upstream requirements for IL-23-induced IL-23R expression. A specific role for Tyk2 in IL-23-induced IL-23R has yet to be clarified. Inhibition of the JAK/STAT pathway resulted in abrogation of IL-23-induced expression of both IL-23Ra and IL12Rb1 receptor chains in human CD4 T cells. We chose to further investigate the roles played by STAT1 and STAT3 in IL-23-induced IL-23R expression. To examine the effect of inhibiting STAT1 and STAT3 activation, we used MTA and STAT3 VII inhibitors, respectively. Both MTA and STAT3 VII blocked IL-23-induced IL-23R expression. In both cases, expression of IL-23Ra and IL-12Rb1 were returned to basal levels or were abrogated completely. In support of our data, IL-6-induced STAT3 activation has been suggested to be involved in IL-6 mediated upregulation of IL-23R (Yang and others 2007). The apparent requirement of both STAT1 and STAT3 can be attributed to the ability of STAT1 and STAT3 to form heterodimers (Stancato and others 1996; Sato and others 1997; Sheikh and others 2004; Guzzo and others 2010). Therefore, it may be possible that IL-23 induces heterodimer formation of STAT1 and STAT3, which is ultimately required for optimal IL-23Ra and IL-12Rb1 expression in response to IL-23. It has been suggested that although IL-23-induced phosphorylation of STAT4 is comparatively weaker to that of IL-12, STAT4 may form heterodimers with STAT3 (Parham and others 2002). IL-23 has also been shown to induce the activation of NF-kB and PI3 kinase in murine CD4 T cells (Cho and others 2006). Therefore, a role for other transcription factors, including that of NF-kB and STAT4, cannot be ruled out at this point and merits further investigation. IL-23 has been shown to play a critical role in the maintenance of the Th17 T cell subset and IL-23Ra has been shown to be expressed on Th17 cells (Langrish and others 2005; Annunziato and others 2007; Chen and others 2007; Zhou and others 2007; Manel and others 2008; Morishima and others 2009). The dependence of IL-23-mediated IL-23 receptor expression on the JAK/STAT pathway may have implications on the development of Th17 cells, particularly as STAT3 activation has been shown to be critical to the differentiation of Th17 cells as well as the production of IL-17 (Cho and others 2006; Nishihara and others 2007; Yang and others 2007; Caruso and others 2008; Chaudhry and others 2009). Thus, our results suggest that IL-23 itself may be an important regulator of Th17 cell differentiation and maintenance by enhancing IL-23 receptor expression on these T cells. Our data in primary CD4 T cells suggest that IL-23 treatment may expand and support Th17 cell development via upregulation of IL-23R and thus provide a positive feedback loop for response to this cytokine. Further work in this regard will be critical to characterizing this key feature of IL-23. In summary, we demonstrate activation of the JAK/STAT pathway induced by IL-23 in human CD4 T cells. For the 100 370 CHE MAT ET AL. first time, we show that IL-23 alone can upregulate its own receptor expression in these cells at both message and protein levels. Further, JAK2, STAT1, and STAT3 are involved in IL-23-induced IL-23 receptor expression. Taken together, our data suggest that JAK/STAT signaling molecules are important for the regulation of IL-23 receptor in human CD4 T cells. These findings provide new information on how IL-23 receptor expression is regulated in human T cells and suggest a potential molecular mechanism for IL-23 in Th17 cell development. Acknowledgments This work was supported by the National Sciences and Engineering Research Council of Canada and the Canada Foundation for Innovation. N.F.C.M. is supported by the Ministry of Higher Education, Malaysia, and Universiti Sains Malaysia. X.Z. is supported by a studentship from the National Sciences and Engineering Research Council of Canada. C.G. is supported by a Canadian Institutes of Health Research Vanier Award. Dorothy Agnew is gratefully acknowledged for phlebotomy. Author Disclosure Statement No competing financial interests exist. References Annunziato F, Cosmi L, Santarlasci V, Maggi L, Liotta F, Mazzinghi B, Parente E, Fili L, Ferri S, Frosali F, Giudici F, Romagnani P, Parronchi P, Tonelli F, Maggi E, Romagnani S. 2007. Phenotypic and functional features of human Th17 cells. J Exp Med 204(8):1849–1861. Belladonna ML, Renauld JC, Bianchi R, Vacca C, Fallarino F, Orabona C, Fioretti MC, Grohmann U, Puccetti P. 2002. IL-23 and IL-12 have overlapping, but distinct, effects on murine dendritic cells. J Immunol 168(11):5448–5454. Bettelli E, Korn T, Kuchroo VK. 2007. Th17: the third member of the effector T cell trilogy. Curr Opin Immunol 19(6):652–657. Caruso R, Fina D, Paoluzi OA, Del Vecchio BG, Stolfi C, Rizzo A, Caprioli F, Sarra M, Andrei F, Fantini MC, MacDonald TT, Pallone F, Monteleone G. 2008. IL-23-mediated regulation of IL-17 production in Helicobacter pylori-infected gastric mucosa. Eur J Immunol 38(2):470–478. Chaudhry A, Rudra D, Treuting P, Samstein RM, Liang Y, Kas A, Rudensky AY. 2009. CD4þ regulatory T cells control TH17 responses in a Stat3-dependent manner. Science 326(5955): 986–991. Chen Z, Laurence A, Kanno Y, Pacher-Zavisin M, Zhu BM, Tato C, Yoshimura A, Hennighausen L, O’Shea JJ. 2006. Selective regulatory function of Socs3 in the formation of IL-17-secreting T cells. Proc Natl Acad Sci U S A 103(21):8137–8142. Chen Z, Tato CM, Muul L, Laurence A, O’Shea JJ. 2007. Distinct regulation of interleukin-17 in human T helper lymphocytes. Arthritis Rheum 56(9):2936–2946. Cho ML, Kang JW, Moon YM, Nam HJ, Jhun JY, Heo SB, Jin HT, Min SY, Ju JH, Park KS, Cho YG, Yoon CH, Park SH, Sung YC, Kim HY. 2006. STAT3 and NF-kappaB signal pathway is required for IL-23-mediated IL-17 production in spontaneous arthritis animal model IL-1 receptor antagonist-deficient mice. J Immunol 176(9):5652–5661. Desai BB, Quinn PM, Wolitzky AG, Mongini PK, Chizzonite R, Gately MK. 1992. IL-12 receptor. II. Distribution and regulation of receptor expression. J Immunol 148(10):3125–3132. Duan Z, Bradner JE, Greenberg E, Levine R, Foster R, Mahoney J, Seiden MV. 2006. SD-1029 inhibits signal transducer and activator of transcription 3 nuclear translocation. Clin Cancer Res 12(22):6844–6852. Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ, Steinhart AH, Abraham C, Regueiro M, Griffiths A, Dassopoulos T, Bitton A, Yang H, Targan S, Datta LW, Kistner EO, Schumm LP, Lee AT, Gregersen PK, Barmada MM, Rotter JI, Nicolae DL, Cho JH. 2006. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 314(5804):1461–1463. Garcia VE, Chang M, Brandon R, Li Y, Matsunami N, CallisDuffin KP, Civello D, Rowland CM, Bui N, Catanese JJ, Krueger GG, Leppert MF, Begovich AB, Schrodi SJ. 2008. Detailed genetic characterization of the interleukin-23 receptor in psoriasis. Genes Immun 9(6):546–555. Gee K, Guzzo C, Che Mat NF, Ma W, Kumar A. 2009. The IL-12 family of cytokines in infection, inflammation and autoimmune disorders. Inflamm Allergy Drug Targets 8(1):40–52. Guzzo C, Che Mat NF, Gee K. 2010. Interleukin-27 induces a STAT1/3 and NF-{kappa}B dependent proinflammatory cytokine profile in human monocytes. J Biol Chem 285(32): 24404–24411. Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, Murphy KM, Weaver CT. 2005. Interleukin 17-producing CD4þ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6(11):1123–1132. Hunter CA. 2005. New IL-12-family members: IL-23 and IL-27, cytokines with divergent functions. Nat Rev Immunol 5(7): 521–531. Kim HR, Cho ML, Kim KW, Juhn JY, Hwang SY, Yoon CH, Park SH, Lee SH, Kim HY. 2007. Up-regulation of IL-23p19 expression in rheumatoid arthritis synovial fibroblasts by IL-17 through PI3-kinase-, NF-kappaB- and p38 MAPK-dependent signalling pathways. Rheumatology (Oxford) 46(1):57–64. Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, Sedgwick JD, McClanahan T, Kastelein RA, Cua DJ. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201(2):233–240. Lee E, Trepicchio WL, Oestreicher JL, Pittman D, Wang F, Chamian F, Dhodapkar M, Krueger JG. 2004. Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris. J Exp Med 199(1):125–130. Letterio JJ. 2005. TGF-beta signaling in T cells: roles in lymphoid and epithelial neoplasia. Oncogene 24(37):5701–5712. Manel N, Unutmaz D, Littman DR. 2008. The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat Immunol 9(6):641–649. McGeachy MJ, Chen Y, Tato CM, Laurence A, Joyce-Shaikh B, Blumenschein WM, McClanahan TK, O’Shea JJ, Cua DJ. 2009. The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17-producing effector T helper cells in vivo. Nat Immunol 10(3):314–324. Morishima N, Mizoguchi I, Takeda K, Mizuguchi J, Yoshimoto T. 2009. TGF-beta is necessary for induction of IL-23R and Th17 differentiation by IL-6 and IL-23. Biochem Biophys Res Commun 386(1):105–110. Moustakas A, Pardali K, Gaal A, Heldin CH. 2002. Mechanisms of TGF-beta signaling in regulation of cell growth and differentiation. Immunol Lett 82(1–2):85–91. Mowen KA, Tang J, Zhu W, Schurter BT, Shuai K, Herschman HR, David M. 2001. Arginine methylation of STAT1 modulates IFNalpha/beta-induced transcription. Cell 104(5): 731–741. 101 IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS Nishihara M, Ogura H, Ueda N, Tsuruoka M, Kitabayashi C, Tsuji F, Aono H, Ishihara K, Huseby E, Betz UA, Murakami M, Hirano T. 2007. IL-6-gp130-STAT3 in T cells directs the development of IL-17þ Th with a minimum effect on that of Treg in the steady state. Int Immunol 19(6):695–702. Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, Churakova T, Liu M, Gorman D, Wagner J, Zurawski S, Liu Y, Abrams JS, Moore KW, Rennick D, Waal-Malefyt R, Hannum C, Bazan JF, Kastelein RA. 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13(5): 715–725. Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Cheung J, Pflanz S, Zhang R, Singh KP, Vega F, To W, Wagner J, O’Farrell AM, McClanahan T, Zurawski S, Hannum C, Gorman D, Rennick DM, Kastelein RA, de Waal MR, Moore KW. 2002. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol 168(11):5699–5708. Sato T, Selleri C, Young NS, Maciejewski JP. 1997. Inhibition of interferon regulatory factor-1 expression results in predominance of cell growth stimulatory effects of interferon-gamma due to phosphorylation of Stat1 and Stat3. Blood 90(12):4749– 4758. Sheikh F, Baurin VV, Lewis-Antes A, Shah NK, Smirnov SV, Anantha S, Dickensheets H, Dumoutier L, Renauld JC, Zdanov A, Donnelly RP, Kotenko SV. 2004. Cutting edge: IL-26 signals through a novel receptor complex composed of IL-20 receptor 1 and IL-10 receptor 2. J Immunol 172(4): 2006–2010. Shen H, Lentsch AB. 2004. Progressive dysregulation of transcription factors NF-kappa B and STAT1 in prostate cancer cells causes proangiogenic production of CXC chemokines. Am J Physiol Cell Physiol 286(4):C840–C847. Stancato LF, David M, Carter-Su C, Larner AC, Pratt WB. 1996. Preassociation of STAT1 with STAT2 and STAT3 in separate signalling complexes prior to cytokine stimulation. J Biol Chem 271(8):4134–4137. Vaknin-Dembinsky A, Balashov K, Weiner HL. 2006. IL-23 is increased in dendritic cells in multiple sclerosis and downregulation of IL-23 by antisense oligos increases dendritic cell IL-10 production. J Immunol 176(12):7768–7774. 371 Weaver CT, Harrington LE, Mangan PR, Gavrieli M, Murphy KM. 2006. Th17: an effector CD4 T cell lineage with regulatory T cell ties. Immunity 24(6):677–688. Weaver CT, Hatton RD, Mangan PR, Harrington LE. 2007. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol 25:821–852. Wu C, Warrier RR, Wang X, Presky DH, Gately MK. 1997. Regulation of interleukin-12 receptor beta1 chain expression and interleukin-12 binding by human peripheral blood mononuclear cells. Eur J Immunol 27(1):147–154. Xu J, Cole DC, Chang CP, Ayyad R, Asselin M, Hao W, Gibbons J, Jelinsky SA, Saraf KA, Park K. 2008. Inhibition of the signal transducer and activator of transcription-3 (STAT3) signaling pathway by 4-oxo-1-phenyl-1,4-dihydroquinoline-3-carboxylic acid esters. J Med Chem 51 (14):4115–4121. Yang XO, Panopoulos AD, Nurieva R, Chang SH, Wang D, Watowich SS, Dong C. 2007. STAT3 regulates cytokinemediated generation of inflammatory helper T cells. J Biol Chem 282(13):9358–9363. Zhang XY, Zhang HJ, Zhang Y, Fu YJ, He J, Zhu LP, Wang SH, Liu L. 2006. Identification and expression analysis of alternatively spliced isoforms of human interleukin-23 receptor gene in normal lymphoid cells and selected tumor cells. Immunogenetics 57(12):934–943. Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, Leonard WJ, Littman DR. 2007. IL-6 programs T(H)17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol 8(9):967–974. Address correspondence to: Katrina Gee Assistant Professor Department of Microbiology and Immunology Queen’s University Room 739 Botterell Hall Kingston Ontario Canada K7L 3N6 E-mail: [email protected] Received 12 July 2010/Accepted 31 August 2010 102