Download LIPOPOLYSACCHARIDE-MEDIATED REGULATION OF IL-17 RECEPTOR LEVELS IN HUMAN MONOCYTES

LIPOPOLYSACCHARIDE-MEDIATED REGULATION OF IL-17
RECEPTOR LEVELS IN HUMAN MONOCYTES
by
Xiubo Zhang
A thesis submitted to the Department of Microbiology and Immunology
In conformity with the requirements for
the degree of Master of Science
Queen’s University
Kingston, Ontario, Canada
(June, 2011)
Copyright ©Xiubo Zhang, 2011
Abstract
IL-17 promotes inflammation through the recruitment of monocytes and induction
of various chemokines and inflammatory cytokines.
Monocytes respond to IL-17
through the heteromeric IL-17 receptor (IL-17R) composed of subunits IL-17RA and IL17RC. Together, monocytes and IL-17 amplify inflammation. Controlling the cellular
response to IL-17 is crucial to prevent hyperactivation of inflammatory responses, which
could lead to chronic inflammatory diseases. The cellular response to increased IL-17
levels may be limited by controlling the receptor levels. Before we understand how
monocytes respond to IL-17 during infection, we must first characterize the expression of
IL-17R in these cells in response to LPS, a well-characterized pro-inflammatory signal.
The aim of this study is to understand the mechanisms which regulate IL-17R levels in
human monocytes. IL-17R mRNA and protein levels were measured in response to LPS
by RT-PCR and Western blot analysis in primary human monocytes, peripheral blood
mononuclear cells (PBMC), and the human monocytic cell line, THP-1. LPS enhanced
IL-17RA and RC transcript levels in monocytes and PBMC.
protein levels decreased with LPS treatment in these cells.
In contrast, IL-17RA
Investigation into
mechanisms regulating IL-17RA protein levels lead to the observation that IL-17RA
undergoes receptor degradation in response to LPS. This work identifies for the first time
that 1) LPS enhances transcript levels of IL-17R and 2) after LPS treatment, IL-17RA
protein levels are reduced via an endosome-dependent degradation pathway.
ii
Acknowledgements
I would like to express my deepest gratitude towards my supervisor Dr. Katrina Gee who
made research an adventure and the three years an absolute joy that was complemented
with continuous challenges. I don’t know where I would be without her guidance and
support.
My graduate experience was also significantly shaped my committee members: Dr. Bruce
Banfield and Dr. Nancy Martin. Their valuable input and critiques have strengthened me
as a budding scientist and as a person.
A big thank you to Dorothy Agnew, our phlebotomist, without whom, I would not have
had my precious blood and cells to get the data I needed. I would also like to thank Dr.
Banfield’s lab for the use of various antibodies and allowing me to use their pH meter,
and Dr. Basta’s lab for the use of the Varioskan reader and their chemical hood. My
experience would also have not been complete without the technical and administrative
support of Jerry, Chris and Jackie.
Who can forget my wonderful labmates Christina Guzzo and Ila Che Mat who showed
me how to do nearly all the experimental techniques in my degree since my time as a
summer undergraduate NSERC student?
Words are not sufficient to express my
gratitude. I believe everything happens for a reason, and it is for a reason that our paths
have crossed. I will never forget your kindness hidden beneath the constant abuse.
Although our academic years have come to an end, our friendship will last a lifetime. I
couldn’t be prouder to be a member of the loudest lab on the floor.
iii
Also thanks to other past and present members of the Gee lab: Brandon Davidson, our
technician, Amit Ayer, a fellow 499 student, and Taylor and Sarah, our past 499 students
for making it all so much fun.
Thanks to Sarah, Alanna and Julia, and all my departmental friends for all the laughter
and the joy you’ve given me. A special thank for all the treats, especially from Valerie
that kept me going till the end of the day. I couldn’t have survived without them,
literally.
Finally, I would like to thank my parents whom I dedicate this work to. Thank you for
the constant criticism that motivated me to want to prove you wrong. Thank you for
keeping my feet on the ground and making me understand that only through hard work
can you achieve your dreams.
iv
Table of Contents
Abstract ............................................................................................................................... ii
Acknowledgements ............................................................................................................ iii
Table of Contents ................................................................................................................ v
List of Figures ................................................................................................................... vii
List of Tables ................................................................................................................... viii
List of Abbreviations ......................................................................................................... ix
Chapter 1 Introduction ........................................................................................................ 1
Chapter 2 Literature Review ............................................................................................... 4
2.1 IL-17/Th17 discovery ............................................................................................. 4
2.2 IL-17 family members ............................................................................................ 6
2.3 Innate sources of IL-17 ........................................................................................... 8
2.4 IL-17 function ..................................................................................................... 11
2.5 The IL-17R receptor family .................................................................................. 13
2.6 IL-17 receptor structure ........................................................................................ 14
2.7 IL-17R signaling ................................................................................................... 16
2.8 Receptor regulatory mechanisms .......................................................................... 19
2.9 Role of IL-17 in disease ........................................................................................ 25
2.10 Rationale, Objectives and Hypothesis ................................................................ 28
Chapter 3 Materials and Methods ..................................................................................... 31
Cell culture and reagents ............................................................................................. 31
Isolation of Primary Monocytes.................................................................................. 31
RNA isolation ............................................................................................................. 32
RT-PCR analysis ......................................................................................................... 33
Concentrating Supernatant Protein ............................................................................. 36
Cell lysis for whole cell protein .................................................................................. 36
SDS-PAGE and Western Blot Analysis ..................................................................... 37
ELISA ......................................................................................................................... 38
Chapter 4 Results .............................................................................................................. 40
v
4.1 IL-17R response to LPS ........................................................................................ 40
4.1.1 LPS induces IL-17RA mRNA expression in primary cells ....................... 40
4.1.2 LPS induces IL-17RC mRNA expression in
CD14 THP-1 cells and PBMCs ........................................................................... 41
4.1.3 LPS decreases IL-17RA protein expression in primary cells ..................... 43
4.1.4 IL-17RC protein expression is not affected by LPS................................... 43
4.1.5 IL-6 and TNF-α production increases in response to LPS treatment ......... 47
4.2 Extracellular domain of IL-17RA is not cleaved .................................................. 47
4.3 IL-17RA is degraded in response to LPS stimulation .......................................... 54
4.3.1 Bafilomycin and chloroquine dose optimization........................................ 54
4.3.2 Bafilomycin and chloroquine time administration optimization ................ 58
4.3.3 Bafilomycin and chloroquine pretreatment of cells stimulated with LPS.. 61
Chapter 5 Discussion ........................................................................................................ 64
5.1 Differential IL-17R mRNA upregulation in PMBC, monocytes and CD14 THP-1
cells ............................................................................................................................. 64
5.2 IL-17R mRNA and protein expression dichotomy ............................................... 67
5.3 IL-17R decrease in protein expression ................................................................. 73
5.3.1. Soluble Isoforms........................................................................................ 73
5.3.2 Receptor internalization ............................................................................. 75
5.3.3 Ubiquitination and signaling ...................................................................... 77
5.3.4 Therapeutic uses of soluble IL-17R ........................................................... 78
Chapter 6 Conclusion and Future Directions .................................................................... 81
References ......................................................................................................................... 83
Appendix: published works/co-authored manuscripts ...................................................... 92
vi
List of Figures
Figure 1: Different T cell lineages from naïve CD4+ T cell engagement with an antigen
presenting cell ................................................................................................................. 3
Figure 2: Comparison of Th17 and IL-17 producing innate source development .............. 9
Figure 3: IL-17RA structure and signaling molecules in IL-17 downstream signaling ... 17
Figure 4: C/EBP involvement in positive and negative signaling of IL-17 ...................... 20
Figure 5: Receptor internalization .................................................................................... 24
Figure 6: LPS enhances IL-17 receptor transcript levels in PBMC and human monocytes
..................................................................................................................................... 42
Figure 7: LPS downregulates IL-17RA protein levels in PBMC and monocytes ............ 44
Figure 8: IL-27 and PMA downregulate IL-17RA protein levels in PBMC .................... 46
Figure 9: LPS does not significantly affect IL-17RC levels in PBMC and THP-1 cells.. 48
Figure 10: IL-6 and TNF-α protein levels in PBMC and monocytes detected by ELISA
show that cells are still responding properly at 16hr and 24hr ................................... 49
Figure 11: Extracellular domain of IL-17RA is not cleaved and secreted as detected by
ELISA and Western blot of concentrated supernatant protein ................................... 52
Figure 12: Bafilomycin and chloroquine treatment of PBMC at 10nM and 100nM, and
5uM and 50uM respectively ....................................................................................... 56
Figure 13: Chloroquine pretreatment of CD14 THP-1 cells was able to increase IL-17RA
protein levels ............................................................................................................... 57
Figure 14: Time optimization of bafilomycin and chloroquine treatment in PBMC ....... 59
Figure 15: Bafilomycin treatment of monocytes following LPS pretreatment of 12hr did
not increase IL-17RA levels ....................................................................................... 60
Figure 16: In primary monocytes, drug pretreatment followed by LPS increased IL-17RA
protein levels ............................................................................................................... 62
Figure 17: Model system of IL-17 receptor regulation .................................................... 82
vii
List of Tables
Table 1: Sequences of primers and their expected sizes ................................................... 34
Table 2: Cycling conditions for primers .......................................................................... 35
viii
List of Abbreviations
a.a.
Amino acid
AMD
AU- rich elements mediated decay
AP2
Adaptor protein 2
ARE
AU- rich elements
ARE-BP
AU-rich elements binding protein
ATP
Adenosine triphosphate
BAF
Bafilomycin
BSA
Bovine serum albumin
CCR
Chemokine receptor
cDNA
Complementary deoxyribonucleic acid
C/EBP
CCAAT/enhancer binding protein
CIA
Collagen-induced arthritis
CLQ
Chloroquine
Cxcl1
CXC-chemokine ligand 1
EAE
Experimental autoimmune encephalomyelitis
ELISA
Enzyme-linked immunosorbent assay
ERK
Extracellular signal-regulated kinase
ESCRT
Endosomal sorting complex required for transport
Foxp3
Forkhead box P1
FRET
Fluorescence resonance energy transfer
GALT
Gut-associated lymphoid tissue
G-CSF
Granulocyte colony stimulating factor
GI
Gastrointestinal
GM-CSF
Granulocyte macrophage colony stimulating factor
Groα
Growth-regulated oncogene α
GTPase
Guanosine triphosphatase
HEPES
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HIV
Human immunodeficiency virus
ix
IFNγ
Interferon γ
IL
Interleukin
JAK
Janus kinase
JNK
Jun NH2-terminal kinases
kDa
Kilodalton
KO
Knock out
L
Litre
LPS
Lipopolysaccharide
LTi
Lymphoid-tissue inducer
MAPK
Mitogen-activated protein kinase
MCP1
Macrophage chemoattractant protein-1
ml
Millilitre
M/M
Monocytes/Macrophages
miRNA
Micro RNA
mRNA
Messenger RNA
MS
Multiple sclerosis
MVB
Multivesicular bodies
MyD88
Myeloid differentiation primary response gene 88
NFκB
Nuclear transcription factor kappa B
N.D.
Not detected
NK
Natural killer cells
nM
Nanomolar
PAMP
Pathogen-associated molecular pattern
PBMC
Peripheral blood mononuclear cells
PDGF
Platelet-derived growth factors
PGE
Prostaglandin E
PI3K
Phosphoinositol 3-kinase
PKC
Protein kinase C
PMA
Phorbol Myristate Acetate
x
PPR
Pattern recognition receptors
RA
Rheumatoid arthritis
RAG
Recombination-activating gene
RISC
RNA-induced silencing complex
RNA
Ribonucleic acid
RORc
Retinoic acid related orphan receptor
RT-PCR
Reverse transcriptase polymerase chain reaction
RUNX
Runt-related transcription factor
SDS-PAGE
Sodium dodecyl sulfate polyacrylamide gel electrophoresis
SEFIR
SEF/IL-17 receptor
siRNA
Small interfering RNA
SIV
Simian immunodeficiency virus
STAT
Signal transducer and activator of transcription
T-bet
Th1-specific T box
TCR
T cell receptor
TGF β
Transforming growth factor-β
Th
CD4+ T helper cell
TILL
TIR-like loop
TIR
Toll/IL-1R receptor
TLR
Toll like receptor
TNF
Tumor necrosis factor
TRAF
TNF receptor-associated factor 6
Treg
Regulatory T cell
TTP
Tristetraprolin
μg
Microgram
μl
Microlitre
μM
Micromolar
xi
Chapter 1
Introduction
The body defends against pathogens through the coordination of the innate and
adaptive immune responses via cytokines. Cytokines are soluble proteins produced by
immune cells that play a prominent role in the regulation of immune responses. Cytokine
mediated effects range from impacting immune cell migration to sites of injury, to
regulating the inflammatory responses, and to determining the differentiation of immune
cells. A key player in the adaptive response is the CD4+ T helper (Th) cell. These cells
are crucial in mediating specific pathogen responses that come later than the innate
response, but are more robust and specific to the pathogen. In 1986, Mossman and
Coffman first proposed the model of two distinct species of Th cells: Th1 and Th2[1-2].
It is now known that when a naïve T cell (T0) first engages an antigen offered by an
antigen presenting cell via the T-cell receptor (TCR), it can differentiate either to Th1 or
Th2 depending on the cytokine milieu. Interleukin (IL)-12 induces transcription factor Tbet for differentiation to Th1 cells, which are involved in cell mediated responses,
whereas IL-4 induces GATA 3 transcription factor for production of Th2 cells, which are
involved in antibody mediated responses[3]. Additionally, there is a T cell population
termed regulatory T cells (Treg) that is immunomodulatory, which is important in
maintaining immune system homeostasis and tolerating self-antigens.
IL-10 and
transforming growth factor β (TGF-β) upregulate Foxp3 transcription factor for Treg
1
differentiation[4]. Recently, a new subset of T cells has emerged, Th17, which is termed
after its main effector cytokine IL-17 (Figure 1). IL-17/Th17 cells are drawing attention
due to their crucial role in inflammation and autoimmune diseases.
IL-17 mediates a stronger inflammatory response than either Th1 or Th2
cytokines through several ways that will be reviewed below. Cellular response to IL-17
is mediated by ligand binding and activation of IL-17 receptor (IL-17R), which initiates
the downstream signaling cascade.
During infection, monocytes are one of the main
mediators of inflammation and these cells are also one of the main immune cells that
respond to IL-17. Currently, there is much unknown about IL-17R such as its structure
and functional domains, recruitment of signaling molecules and its expression levels
during infection. The focus of this thesis is the characterization of IL-17R levels and the
post-translational regulatory mechanisms of IL-17R in monocytes, the main immune cell
responders to IL-17, in response to LPS.
2
Figure 1: Different T cell lineages from naïve CD4+ T cell engagement with an
antigen presenting cell. Th1 and Th2 were the first Th cell subsets to be classified,
later followed by the Treg, and finally the Th17 cells. IL-12 which consists of p40
and p35 subunits binds IL-12Rβ1 and IL-12Rβ2 receptor subunits, respectively on
naïve T cells to induce Th1 cell differentiation by upregulating the transcription factor
T-bet. Th1 cells specialize in cellular immunity and secrete classical Th1 cytokines
such as IFN-γ and IL-12. IL-4 drives Th2 cell population differentiation by
upregulating the GATA3 transcription factor. Th2 cells secrete IL-4 and IL-5, and
specialize in humoral immunity by recruiting B cells and promoting antibody
production. IL-10 and TGF-β drive Treg differentiation by inducing the Foxp3
transcription factor. Tregs suppress immune response by secreting anti-inflammatory
cytokines such as IL-10, and TGF-β. Finally, Th17 differentiation is driven by the
presence of both TGF-β and IL-6. IL-23, which consists of p40 and p19 subunits,
binds IL-23 receptor subunits IL-12Rβ1 and IL-23R, respectively, to act as a
maturation factor. These cytokines signal through RORc, STAT3, and RUNX-1 to
drive Th17 development and increase production of IL-17, the prototypic Th17
cytokine, as well as IL-22 and TNF-.
3
Chapter 2
Literature Review
2.1 IL-17/Th17 discovery:
IL-17 was first identified in 1993 as CTLA8, a rodent cDNA transcript[5].
Initially, it was not recognized as a cytokine due to its unusual amino acid sequence,
which showed 58% homology to an open reading frame in Herpesvirus saimiri[5-7]. The
functional significance of viral IL-17A is unknown. Evidence that suggested IL-17 was
an interleukin came when it was found to promote the production of other cytokines and
chemokines, such as IL-6, IL-8, and granulocyte colony stimulating factor (G-CSF) from
various cell types including cells such as epithelial, endothelial cells, and fibroblasts [89].
While IL-17 was first discovered in 1993, focus on the cytokine did not come
until 2003 when the Th17 cell population was first characterized and found to be
involved in autoimmune diseases. The discovery of this Th17 subset came from studies
on experimentally induced multiple sclerosis (MS) - experimental autoimmune
encephalomyelitis (EAE).
Both diseases are characterized by the demyelination of
neurons, which leads to physical and cognitive impairment [10]. These studies expanded
our understanding of T cell mediated immunity, leading to a revision of the classical
model of T cell populations.
Initially, Th1 cells were thought to be the culprit of autoimmunity, with
incriminating evidence linking the characteristic Th1 cytokines, interferon (IFN)-γ and
4
IL-12, to the induction of EAE [11-14]. Expression of IFN-γ, a hallmark Th1 cytokine,
has been shown to play paradoxical roles in EAE. While IFN-γ levels were observed to
increase with the onset of EAE and to decrease with disease remission[12], other research
showed mice with decreased IFN-γ production still suffered from EAE[15]. Moreover,
IFN-γ depletion, either through genetic or antibody-mediated manipulation, actually
enhanced EAE[16]. For example, mice that failed to produce IFN-γ were not protected
from EAE, rather they developed more severe diseases [17-18]. Furthermore, IFN-γ
injection in Lewis rats has been observed to block EAE[19]. This apparent contradictory
role of IFN-γ challenged the traditional view of the role of Th1 cells in autoimmunity in
that blocking Th1 responses did not provide immunity to EAE. This suggested that Th1
cells act as regulator cells rather than promoters of chronic inflammation. The inability
of IFN-γ to account for the appearance of EAE in mice with blocked Th1 functions
suggested the involvement of another subset of cells, eventually identified as CD4 Th17
cells.
Identification of this new subset of T cells came about through studies of EAE in
IL-12-deficient mice. IL-12 consists of p40 and p35 heterodimer. EAE failed to develop
in p40 deficient mice, but not in p35-deficient mice[20]. In 2000, the p40 subunit of IL12 was observed to pair with a unique p19 subunit to form a novel cytokine termed IL23[21]. The importance of IL-23 and IL-17 in EAE development was demonstrated in
IL-23p19 deficient mouse models, which showed decreased levels of IL-17 producing T
cells due to failure of receptor activation and further downstream signaling of IL-23 [22],
5
thereby protecting mice from EAE.
This receptor was later discovered to be a
heterodimer that consisted of IL-12Rβ1, the docking site for the common p40 subunit,
and a unique receptor subunit termed IL-23R that bound p19[21].
IL-23 was
demonstrated to promote and expand a T cell population producing IL-17, a
proinflammatory cytokine. Due to the unique cytokine profile that IL-23 induced, these
T cells were determined to be distinctive from either Th1 or Th2 and thus termed Th17
after its major effector cytokine IL-17 [22-23].
2.2 IL-17 family members:
Sequencing of vertebrate species’ genomes revealed that there are at least six IL17 members: IL-17A to IL-17F [24-25]. In order to better understand the characteristics
of IL-17, the crystal structure of IL-17F was determined. It revealed a tertiary protein
structure that is distinct from other interleukins. Although IL-17F adopts a fold similar to
that of the cystine knot superfamily of proteins[26], such as platelet-derived growth
factors (PDGFs) and the TGF-β family, there is deviation from the typical cystine knot
structure. Specifically, IL-17F contains only two of the three distinctive cystine linkages
that lend the family its name[26]. This distinctive folding is likely to be present in other
IL-17 members as well. It also hints at a unique receptor structure that is needed to
accommodate the ligand.
6
IL-17A and IL-17F
Of the six members of the IL-17 family, IL-17A and IL-17F are the best
characterized. These two may also be the closest related since they are the only members
that are encoded adjacent to each other on the same chromosome, while others are
encoded on different chromosomes. Specifically, Il17a and Il17f are encoded on mouse
chromosome 1 and human chromosome 6 [27] . The two members bear 44% homology,
compared to other members that are limited to 15-27% homology [28]. IL-17A is the
dominant product of Th17 cells and is commonly referred to as IL-17.
IL-17A and IL-17F exist as homodimers but heterodimers of IL-17A-IL-17F have
also been observed [29]. These heterodimers are present at higher levels than IL-17A
homodimers in human peripheral blood mononuclear cells (PBMC) in vitro, but the in
vivo dominant form is undefined [30]. While both are pro-inflammatory, IL-17A and IL17F do vary subtly in their immunological roles. From studies of Il17a-/-and Il17f-/-, IL17A is shown to be the major player in autoimmunity[30-31]. This may be due to more
potent and sustained signaling of IL-17A compared to IL-17F. IL-17F induced responses
were 10-30 times weaker in terms of downstream gene activation than IL-17A[29].
IL-17B, IL-17C, IL-17D and IL-17E
As for the rest of the family members, their roles are less well defined. However,
they all have been shown to stimulate transcription of similar proinflammatory genes as
those stimulated by IL-17A and IL-17F[32-33]. Additionally, experimental evidence
suggests a similar involvement of these cytokines in autoimmunity.
7
For example,
increased expression of IL-17B and IL-17C exacerbated collagen-induced arthritis (CIA),
while antibodies against IL-17B partially suppressed CIA[34]. IL-17E also has been
shown to induce pathological changes such as inflammatory cell infiltration, epithelial
hyperplasia and hypertrophy of the liver, heart and lung [28].
However, IL-17E, also known as IL-25, is somewhat different from IL-17A in
that it is produced by Th2 cells, not Th17 cells[7, 35]. Transgenic overexpression of IL17E promotes Th2 type cytokines, such as IL-4, IL-5, IL-10, and IL-13 [28], in addition
to inducing cells and antibodies specializing in allergic responses. The implication of this
link to Th2 cells is unknown. These IL-17 family members may become better defined in
the future using gene knockouts and characterization of the function of the receptors.
2.3 Sources of IL-17:
Th17 cells are not the sole source of IL-17. While Th17 cells are the main
producers of IL-17, innate IL-17 producing cells have also been found in recombination
activating gene (RAG) deficient mice [36]. Innate sources of IL-17 include γδ T cells,
lymphoid-tissue inducer (LTi)-like cells, natural killer (NK) cells and myeloid cells[37].
These cells play important roles in tissue surveillance in the gut, lung and skin. Their
ability to produce IL-17 independent of memory T cell formation is important for early
inflammatory response and host defense. The regulation of innate sources of IL-17 is
different from that of Th17 cells. A comparison of the development of these IL-17
producing cells is shown in Figure 2.
8
A) Th17 cell differentiation
B) IL-17 producing innate cell development
Figure 2: Comparison of CD4 positive Th17 and IL-17 producing innate γδ T cell
development. IL-17 can be produced from the CD4 positive Th17 cells or the innate
 T cells. A) Development of Th17 cells from naive T cells requires engagement
with antigen presenting cell, and presence of TGF-β and IL-6, with IL-23 as a
maturation factor to upregulate transcription factors RORc, STAT3, and RUNX1.
After differentiation and proliferation, Th17 cells migrate from lymph node to the sites
of infection, which may take up to five days in vivo. B) IL-17 production from innate
sources such as γδ T cells requires the presence of IL-1β and/or IL-23 secreted from
antigen presenting cells stimulated with PAMPs or pathogen metabolites. These
PAMPs and pathogen metabolites may also act directly on the innate cells that in
combination with IL-1β and IL-23, upregulate RORc, STAT3, and RUNX1 to induce
production of IL-17. Innate cells may produce IL-17 within 8 hours of induction.
9
IL-17 production from Th17 cells is highly regulated, requiring developmental
factors IL-6, TGF-β, IL-21, and IL-23, and various transcription factors such as RUNX-1,
STAT3, and RORc. The combination of IL-6 and TGF-β is necessary to provide the
primary driving force in Th17 differentiation. In the early stages of differentiation, Th17
cells produce IL-21 that acts in an autocrine fashion to further amplify this population
[27, 38-39]. In addition, IL-23 acts as a maturation factor that stabilizes and maintains
Th17 cells. IL-23 is essential for the expansion and survival of Th17 effector memory
cells[40]. Upon reinfection, these memory cells can rapidly be recruited and amplified
for IL-17 production to quickly control infection.
On the other hand, innate sources of IL-17 can produce IL-17 independent of the
presence of IL-6, a key differentiating factor for Th17 cells. IL-17 producing cells were
observed in IL-6 knock out (KO) mice, which cannot produce Th17 cells [41].
These
innate cells can be activated by IL-23 and IL-1β, alone or in combination with pathogenassociated molecular pattern (PAMP) binding to pattern recognition receptors (PPRs) or
through TCR activation[37].
Many of these innate IL-17 producing cells also
constitutively express IL-23R and IL-1R1 [42-44], both of which are crucial in Th17 cell
development. γδ T cells stimulated with IL-1β or IL-23, rapidly secrete IL-17 [45]. This
response was also observed in LTi and NK cells. Innate cell secretion of IL-17 is very
important in early inflammatory response to sequester and eliminate pathogens.
Of the innate sources, the γδ T cell subset is the main source of IL-17 [37, 45]. It
is an intraepithelial lymphocyte found mainly at the mucosal barrier [37].
10
The exact
functional role of these cells has not yet been elucidated. These γδ T cells can be sorted
based on cell surface markers and ability to produce IFN-γ or IL-17. It is thought that the
differentiation of γδ T cells is based on the strength of the signal from TCR engagement
within the thymus. A strong interaction favors the IFN-γ production lineage, whereas a
weak or lack of interaction favors the IL-17 production lineage [37]. CD27 surface
expression marks cells as IFN-γ producing γδ T cells [46], whereas CC-chemokine
receptor 6 (CCR6) are expressed by IL-17 producing γδ T cells.
2.4 IL-17 function:
The primary function of IL-17 is mediating inflammation not adequately handled
by cytokines from the Th1 and Th2 subsets. IL-17 protect against extracellular bacterial
infections such as Klebsiella pneumoniae and fungal infections such as Candida
albicans[27, 47]. IL-17 mediates an adaptive response against pathogens through the
recruitment of cells primarily involved in innate responses such as neutrophils, and
monocytes and macrophages (M/M). Like IL-17, M/M coordinate the immune system
between the innate and adaptive branches of immunity. They are one of the first cells to
arrive at the site of injury, where they engulf microbes and present the microbial peptides
to the T cells. M/M also release cytokines such as IL-6, IL-1β, and tumor necrosis factor
α (TNF-α) at sites of injury to promote inflammation and sequester pathogens at the site
of injury. M/M were shown to be responsive to IL-17A, in that upon IL-17A binding,
human macrophages have been shown to produce IL-1β and TNF-α [48]. Furthermore,
11
IL-17R is expressed in airway smooth muscle that upon binding to IL-17 induces CXCL8
expression which enhances integrin expression in monocytes and adherence to
endothelial cells[49].
IL-17 mediates a strong proinflammatory tissue response through several
mechanisms. Firstly, it induces the production of chemokines such as IL-8[50], monocyte
chemoattractant protein-1 (MCP-1)[51], and growth-regulated oncogene α (Groα)[52]
from target cells such as epithelial cells, fibroblasts and endothelial cells. Secondly, IL17 stimulates local production of IL-6 and PGE2, which further enhances
inflammation[53]. Thirdly, it increases the proliferation of M/M from local stromal cells
through stimulating the production of hematopoietic cytokine G-CSF and granulocyte
macrophage (GM)-CSF in target cells to perpetuate the inflammatory responses [28, 54].
Chemokines, proinflammatory cytokines and M/M and neutrophils, together, act in a
positive
feedback
loop
that
amplifies
the
overall
inflammatory
response.
Understandably, deregulation of such a potent cytokine could lead to chronic
inflammation and induction of autoimmune diseases.
IL-17 produced from innate sources can also induce secretion of G-CSF from
stromal cells and recruitment of neutrophils. IL-17 synergizes with other cytokines such
as IL-6 and TNF to promote neutrophil infiltration for elimination of extracellular
pathogens[37]. In the lung during Mycobacterium tuberculosis infection, γδ T cells
produce IL-17, which enhances adaptive immunity by recruiting Th1 cells and inducing
IFNγ production[47].
12
IL-17 also plays a role in maintaining intestinal integrity by enhancing production
of tight junction proteins such as claudin and zona occludens 1[37].
These proteins
promote formation of interconnecting structures between epithelial cells to keep out
luminal content and infectious agents from entering the bloodstream. IL-17 can also
promote antimicrobial protein production such as defensins and S100 proteins from
epithelial cells [37].
2.5 The IL-17 receptor family:
As there are multiple members of the IL-17 family, so are there multiple subunits
comprising the IL-17R family, which consists of five receptor members: IL-17RA to IL17RE[28]. IL-17RA is the largest member of the family and is the most defined in
structure and signaling. IL-17RA is indispensable in mediating the inflammatory effects
of IL-17. For example, IL-17RA KO mice are predisposed to K. pneumoniae[55] and C.
albicans infection [56]. IL-17RA KO mice also have increased mortality rates with
Toxoplasma gondii infection due to lack of neutrophil trafficking to infection site[57]. It
is a signaling subunit used by at least four members of IL-17 family: IL-17A, IL-17F, IL17D and IL-17E[58]. Binding assays using radiolabeled iodide IL-17 showed that IL-17
binds to IL-17RA with low affinity [59]. This was surprising since IL-17 is capable of
inducing biological activity at low concentrations, suggesting that probably other
subunits associate with IL-17RA to increase affinity towards the ligand. Indeed, further
experiments confirm this.
IL-17RA was shown to complex with IL-17RC using
13
fluorescence resonance energy transfer (FRET) [60] and co-immunoprecipitation
studies[61]. The exact mechanism of how these receptor subunits interact to form a
functional receptor for signaling has not been clarified. However, it does seem that IL17A behaves like other cytokine receptors, where subunits exist as monomers within the
membrane and oligomerize with other subunits upon ligand binding, bringing signaling
domains to close proximity to initiate downstream cascades.
Expression of IL-17R members differ depending on the tissue type. While the
main production of IL-17 is limited to Th17 cells, IL-17 receptors are expressed
throughout the body on cells[62]. For instance, IL-17RB is expressed on organs such as
the liver and kidneys, as well as Th2 cells, to bind IL-17E[24]. Meanwhile, IL-17RA is
highly expressed on hematopoietic cells and poorly expressed on non-hematopoietic cells
such as osteoblasts, fibroblasts, endothelial cells and epithelial cells [27]. In contrast, IL17RC is poorly expressed on hematopoietic cells and highly expressed on nonhematopoietic cells. This differential expression of IL-17R subunits could provide tissue
specific signaling of IL-17.
2.6 IL-17 receptor structure
IL-17 has been shown to assume a distinctive structure that deviates from the
cystine knot family. IL-17R, unsurprisingly, also has distinguishing domains that lend to
the unique functions of IL-17.
All of the receptor subunits are type I single span
transmembrane proteins[27, 58]. They consist of conserved structural motifs, such as an
14
extracellular fibronectin III-like domain and a cytoplasmic SEF/IL-17R (SEFIR) domain
[7]. The SEFIR domain was discovered through bioinformatics analysis, which revealed
that a conserved motif in the cytoplasmic tail of IL-17R was markedly homologous to the
already known Toll/IL-1R (TIR) domain[63]. The TIR domain is essential for further
downstream adaptors such as MYD88, which play important roles in Toll-like receptor
signaling[64]. SEFIR similarity to TIR domain suggests similar downstream effects in
upregulating pro-inflammatory mRNA transcripts.
SEFIR was shown to play an
important role in IL-17RA signaling as its deletion impairs the activation of NF-κB, a
critical transcription factor, downstream of IL-17RA[65-66]. Although SEFIR bears
some resemblance to TIR, it lacks certain elements present in the TIR domain, such as
the TIR box 3 subdomain and the BB-loop, both of which are essential in determining
specificity in TIR protein-protein interactions [67-68]. This difference suggests that
SEFIR does not bind the same adaptor proteins as TIR, rather SEFIR would recruit a
unique set of downstream molecules.
Exactly what these molecules are and what
functions they modulate require further research.
A region at the carboxy-terminal side of the SEFIR domain is homologous to BBloops and is essential to IL-17RA function. IL-17RA is non-functional with mutations in
this region which was termed TIR-like loop (TILL)[66]. This domain is unique to IL17RA, which may explain why IL-17RA is a common subunit shared by other receptors
in the family. Through TILL, IL-17RA likely recruits essential downstream signaling
15
molecules in order to perpetuate the pro-inflammatory effects of various IL-17 family
members.
A third functional domain exists at the carboxy-terminal region and is not
required for NF-κB and MAPK pathways activation. However, this region is essential for
the downstream expression of CCAAT/enhancer binding protein (C/EBP) β, and was
thus termed the C/EBPβ-activation domain (CBAD)[7]. C/EBP is another transcription
factor IL-17A directly activates.
2.7 IL-17 signaling:
Currently there is no clear outline of the IL-17 signaling pathway. Unlike other
cytokines such as IL-6 and IL-12 where the Janus kinase/signal transducers and activators
of transcription (JAK/STAT) pathway is strongly induced for cellular response, IL-17
poorly induces JAK activation. Weak activation of STATs 1, 2, 3, and 4 have been
reported, but may be due to secondary effects from IL-17 induced production of IL-6 that
acts in an autocrine manner to upregulate STAT activation[69].
However, several signaling proteins have been identified (Figure 3). Through coimmunoprecipitaiton studies, it was shown that one of the upstream molecules that
associates with IL-17RA is Act1, an adaptor protein that can lead to the activation of NFκB[65, 67]. Deficiency of Act1 using either knockout mice or siRNA addition led to
inhibition of NF-κB induction upon IL-17RA signaling[70-71] . Act1 was also shown to
16
Figure 3: The IL-17A homodimer binds to a heteromeric receptor composed of IL-17RC
and IL-17RA subunits whose cytoplasmic tail consists of three unique functional
domains: SEFIR, TILL and CBAD. SEFIR is important for recruitment of downstream
adaptor protein Act1, which in turn recruits TRAF6, a crucial upstream factor of the NFκB pathway. Act1 recruitment also activates all three MAPK members, with ERK being
the most strongly and rapidly phosphorylated. TILL has a sequence similar to the
Toll/IL-1R (TIR) BB loop that recruits Myd88 in TLR. The exact function of TILL is
not well defined, however, it is expected that it provides unique docking sites for
downstream signaling molecules. CBAD is essential for phosphorylation of C/EBPβ,
which downregulates transcription of IL-17A induced genes.
17
play a role in stabilizing target mRNAs of cytokines and chemokines. For example, Act1
is essential in stabilization of Cxcl1 (CXC-chemokine ligand 1) mRNA[72]. Therefore,
from this experimental evidence, Act1 appears to be an important element in the
downstream cascade of IL-17RA.
Act1 recruits TNF receptor-associated factor 6
(TRAF6), which is also important in mediating IL-17A signaling. Act1 contains binding
domains for TRAF6 and TRAF3 which are adaptor proteins and required upstream
factors in the canonical NF-κB signaling pathway[65].
TRAF6 knockout mouse
embryonic fibroblasts failed to exhibit IL-17A signaling[73].
IL-17 has also been shown to activate all three subtypes of MAPK, which are Jun
NH-terminal kinases (JNK), p38, and ERK[62], the last of which is the most rapidly
phosphorylated and activated[58]. Like Act1, MAPKs also serve to stabilize mRNA
through inhibition of destabilizing proteins such as tristetraprolin (TTP).
These
destabilizing proteins bind AU-rich elements (AREs) in mRNA transcripts, which are
typically present in cytokine and proto-oncogene transcripts, and target them to exosome
complexes for degradation[58]. TTP phosphorylation via MAPKs increases mRNA halflife by blocking its trafficking to the degradative machinery. Studies show that MAPKs
increase the concentration of chemokine and cytokine gene transcripts induced by IL-17
[69], marking this class of signaling molecules as a positive contributor to IL-17 function.
Through microarray screenings for IL-17A induced genes, it was shown that in
addition to NF-κB, C/EBP transcription factors are also involved[74]. Two variants,
C/EBPβ and C/EBPδ, are induced downstream of IL-17A. As with most signaling
18
molecules, phosphorylation serves as an important regulatory mechanism of IL-17A
signaling. IL-17A signaling triggers dual, sequential phosphorylation of a regulatory site
within C/EBPβ [75], the first of which is mediated by ERK [71] (Figure 4).
Phosphorylation of C/EBPβ downregulates transcriptional activity, suggesting
that it is an inhibitory signal of IL-17RA[71]. While C/EBPδ is regulated by IL-17RA
through the canonical NF-κB pathway to upregulate IL-17A target genes, there is a
simultaneous induction and phosphorylation of C/EBPβ that downregulates the target
genes[76].
This could mean that even as the cell is trying to respond to IL-17, it is
simultaneously upregulating inhibitory signals to prevent an over-response. The complex
interplay between C/EBPβ and C/EBPδ could allow fine tuning of transcriptional control
of C/EBP-dependent genes. However, there remains much to be understood about how
C/EBP and other transcription factors interact with each other to coordinate a controlled
increase of IL-17 target genes.
2.8 Receptor regulatory mechanisms
At the receptor level, the regulation of IL-17RA is highly dynamic. For example,
IL-21, an inducer of Th17 development, upregulates IL-17RA expression by CD8+ T
cells[77], while phosphoinositol 3-kinase (PI3K) from IL-2 induction in T helper cells
limits IL-17RA expression[78]. The regulation of IL-17RA is important because levels
of IL-17RA expression correlate with IL-17A signaling strength. Cellular response to IL17 is dependent on high levels of IL-17RA [66]. Therefore, even during IL-17 increase,
19
Figure 4: CCAAT/enhancer binding protein(C/EBP) is a transcription factor induced
by IL-17. C/EBP upregulates pro-inflammatory cytokine gene transcripts that are
stabilized by the addition of poly A tails in posttranscriptional modification, possibly
mediated by p38. Activated ERK can phosphorylate C/EBPβ, which inhibits C/EBPβ
binding to the promoter and therefore downregulates transcription.
20
receptor regulation can prevent hyper-immune responses and damage to the tissues.
Receptors can be regulated by several mechanisms. In the following paragraphs,
mechanisms that have been found to be related to IL-17 receptors will be discussed.
Generation of soluble cytokine receptors is a common way for cells to control ligand
binding and signaling.
Soluble cytokine receptors are important in regulating
inflammation and immunity. There are many soluble isoforms of cytokine receptors,
such as soluble IL-6 receptor (sIL-6R) and TNF receptors[79]. sIL-6 is derived either
from
proteolytic
cleavage
of
the
extracellular
domain
via
disintegrin
and
metalloproteinase domain-containing protein (ADAM) or by alternative splicing[79].
Soluble isoforms can either act as signaling agonists, for example, sIL-6[80] or signaling
antagonists, for example sgp130 and IL-1R type II [81]. Soluble isoforms of IL-17RB
and IL-17RC with conserved ligand binding capacity have been predicted[27]. At least
90 splice variants of IL-17RC has been found compared to IL-17RA which is not
alternatively spliced[82]. These soluble isoforms can serve as decoys that bind IL-17
without causing signaling.
Another mechanism that regulates IL-17R is receptor internalization. Upon IL-17
binding, IL-17RA surface expression was shown to be rapidly decreased[78], which
potentially serves as a negative feedback system to limit IL-17 signaling. The exact
receptor internalization pathway has not been investigated; however, receptor
internalization is a well known way used by cells to control signaling. There are two
endocytic pathways- clathrin dependent, which is used in uptake of IL-5R[83] and TGF-β
21
receptors [84], and caveolae dependent, which is utilized in uptake of IL-2Rβ [85]. In
clathrin mediated endocytosis, soluble clathrin is recruited from cytoplasm to the plasma
membrane, where clathrin proteins assemble into a polygonal lattice that buds and
pinches off from the membrane. This is facilitated by dynamin, a GTPase, with the aid of
adaptor protein-2 (AP2) to release clathrin coated vesicles [86]. Clathrin then dissociates
from the vesicle that fuses with the early endosome, which serves as a key control point
for sorting receptors. At this point, receptors can be directed to the recycling endosome
and back to the cell surface or shunted to multivesicular bodies (MVBs) to the lysosome
for degradation, depending on intracellular signals such as the Rab proteins[86]. With
respect to the caveolae dependent pathways, a clear delineation of the cellular
mechanisms is unknown. However, once internalized, the vesicles would probably traffic
to similar intracellular compartments as during clathrin mediated endocytosis.
Intracellular trafficking has been studied with the vacuolar-type H(+)-ATPase inhibitors
bafilomycin and the lysophilic weak base chloroquine, which inhibits lysosomal
acidification[87-88].
Ubiquitination is another way that the cells control cell signaling. Ubiquitin is a
highly conserved 76-amino acid polypeptide that can be attached covalently to lysines in
target proteins in an enzyme dependent manner[89]. First, E1 activates the ubiquitin by
hydrolyzing ATP to add an adenyl to an ubiquitin molecule. The activated ubiquitin is
transferred to a conjugating enzyme, E2. Finally, E3, the ubiquitin ligase, catalyzes the
transfer of ubiquitin from E2 to the target protein[90]. Ubiquitination was thought to be a
22
signal for protein degradation by proteasomes. However, subsequently it has also been
shown to serve as a signal for endosomal trafficking, depending on whether it is
monoubiquitinated or polyubiquitinated[90].
Polyubiquitination is the sequential
addition of at least four ubiquitin residues to lysine 48 on the target protein. This signals
the protein to be targeted to the proteosome for degradation[90]. Monoubiquitinated
proteins are targeted to vesicles by endosomal sorting complexes required for transport
(ESCRT) machinery to form MVBs that eventually fuse with lysosomes (Figure 5) [89].
It has been shown that multiubiquitination, which is the addition of several
monoubiquitin molecules to a target protein, is a key signal for degradative sorting[86].
One study showed IL-17 can trigger ubiquitination of IL-17RA, which may involve
TRAF6 that acts as E3 ligase[91]. The study showed that with aTRAF6 mutant, IL-17RA
was not ubiquintated. This study also demonstrated that IL-17F but not IL-17A induced
IL-17R ubiquintaiton via TRAF6. However, rather than triggering degradation following
ubiquitination, luciferase reporter activity of an IL-17 driven gene was increased
suggesting that ubiquitination was a positive regulator of cell signaling. Since IL-17A is
the most potent IL-17 member, it calls into question whether ubiquitination is the main
and necessary signaling mechanism. Receptor regulation through intra and extracellular
signaling, soluble isoforms, receptor internalization and ubiquitination are potentially
employed by the cells responsive to IL-17 as ways to control response to IL-17 to prevent
over-activation that could lead to chronic inflammation.
23
KEY:
Figure 5: Receptor internalization can either traffic to recycling endosomes or lysosomes
for degradation. Upon ligand binding (1), a receptor can be activated to induce
downstream signaling.
One way that the cell regulates signaling is via (2)
monoubiquitination which leads to (3) receptor internalization. Vesicles may traffic to
early endosomes that can either fuse with (4) recycling endosomes or to (5) endocytic
intermediate organelles in the lysosomal degradative pathways called multiple vesicular
bodies (MVB), depending on internal trafficking proteins such as RabGTPases. In the
recycling endosome, ubiquitin molecules are removed to allow receptors to traffic to
plasma membrane. When fused with MVB, receptors are targeted to lysosomal
degradation, which would further inhibit signaling. Bafiloymcin and chloroquine (6) act
on lysosome and endosome structures to prevent protein degradation. Bafilomycin is a
specific inhibitor of vacuolar-type H(+)-ATPase. Chloroquine is a lysophilic weak base
that rapidly becomes protonated within the endocytic vesicles, thereby neutralizing the
acidic environment. With the pH change, enzymes in endosome compartments are
denatured and lose bioactivity. By inhibiting degradation, both drugs cause protein
accumulation.
24
Response to IL-17 is tightly regulated due to the strong inflammatory reaction that
IL-17 induces, from its production to its binding to receptors and signaling to the nucleus.
Currently, there are still unanswered questions to ligand-receptor interactions of IL-17
and receptors, IL-17 signaling and in vivo function of IL-17. Of particular interest is the
IL-17 receptor and signaling molecules. Regulation of IL-17R is important as receptors
provide the first level of control in cellular response. By better understanding ligandreceptor and receptor activation of downstream signaling, effective treatments may be
developed against receptors involved in autoimmunity while preserving necessary IL-17
inflammatory effects.
2.9 Role of IL-17 in diseases:
Th17 cells are now well recognized to be major players in autoimmune diseases
such as MS, colitis, psoriases, and rheumatoid arthritis (RA). As the major effector
cytokine of Th17, IL-17 is implicated in chronic inflammatory diseases and organ
transplant rejection[62]. While the cytokine is important in controlling some pathogen
types, certain pathogens that do not need IL-17 to be cleared, still induce its production.
For example, bacteria such as Pseudomonas aeruginosa[92] and fungi such as
Aspergillus fumigates[93] induce IL-17 production, while both type of infections can be
cleared without strong neutrophil recruitment[94]. In such cases, IL-17 driven
inflammation may not be protective but rather increases the risk of chronic inflammation.
25
Monocytes and macrophages are important in mediating IL-17 pro-inflammatory
effects. Although the half-life of a macrophage varies depending on the organ, it is
known that in chronically inflamed organs such as in asthmatic lungs, macrophage
survival is enhanced [95]. This may be associated with survival factors that IL-17
produces such as IL-1β, TNF-α, and GM-CSF[96]. Recently, IL-17 has been shown to
induce airway macrophage migration and survival [97] as well as monocyte migration in
synovial fluid of RA patients[98], leading to tissue destruction. Neutralization of either
IL-17 or its receptors significantly reduced monocyte migration[98].
RA is a chronic inflammatory disease that leads to the destruction of bone and
cartilage. IL-17 is found in synovial fluids of RA patients, where it stimulates production
of catabolic enzymes in human chondrocytes that results in decreased chondrocyte
proliferation[99].
IL-17 along with IL-1β and TNFα, stimulate secretion of further
growth factor and pro-inflammatory cytokines such as GM-CSF and IL-6. Additionally,
IL-17 induces matrix metalloproteinases in synoviocytes, which leads to proteolytic
degradation of cartilage [100]. In these cases, IL-17 is a double edged sword. The same
functions that IL-17 mediates to control infections become damaging to the host through
the release of cytokines such as IL-6, IL-8 and IL-1β.
While IL-17 deregulation is associated with autoimmune diseases, more recently
it has also been linked to human immunodeficiency virus (HIV) infection. This virus
impairs the immune system by targeting immune cells such as T cells and monocytes,
leading to an increased risk of opportunistic infections. Whereas IL-17 function is
26
exaggerated in autoimmunity, suppression of IL-17 by HIV infection could be one
mechanism that increases susceptibility to infections.
Th17 cells play important roles in mucosal immunity, as they are found in high
concentration in the lamina propria of the GI tract[101]. Th17 cells prevent microbial
translocation across mucosal surfaces by enhancing expression of antimicrobial peptides
and mobilizing neutrophils to the infected site. Gut-associated lymphoid tissue (GALT) is
also a major reservoir for CD4+ T cell, the source of Th17 cells, and a key site of HIV
replication[39]. Mucosal surface transmission of HIV is one major route of entry and site
of viral infection. Therefore, understanding how Th17 cells are dysregulated by HIV
infection is crucial to restoring Th17 population and function. Dysregulation of IL-17
function and Th17 cells at the mucosal surface during HIV infection may increase
opportunistic infections that Th17 cells normally protect against.
Current literatures do not agree on how IL-17 is affected by HIV infection. The
first report that associated HIV infection with IL-17 showed an increase of IL-17
production by CD4+ T cells in the peripheral blood of HIV patients[102]. However, this
was contradicted in a later report that showed HIV-1 infected children with a plasma viral
load below 50 copies/ml had detectable IL-17 production, in contrast to those with
detectable viremia who had no observable IL-17 production[103]. This suggested viral
mediated impairment of Th17 cells, which led to decreased levels of IL-17. Additionally,
Yue et al, demonstrated that IL-17 producing T cells were detectable only in early HIV-1
infection[104]. These data suggest that IL-17 production is likely to be negatively
27
correlated with the progression of disease, which increasingly deregulates the immune
system. IL-17 may initially increase to fight viral infection, but is later suppressed as
Th17 cells are depleted towards end stage disease.
Current research on HIV and Th17 has focused on the involvement of the T cell
itself, which is the primary target of HIV infection. However, M/M are also major targets
of HIV infection. They serve as the main reservoirs for HIV to replicate and contribute
to persistent viral infection. Upon HIV infection, M/M become functionally impaired,
leading to deregulation of cytokine production and function[105] and consequently, a
decrease in inflammatory response against pathogens. Because monocyte is one of the
first responders to an injury, it is important to understand how IL-17 signaling is
deregulated in these cells, so that pharmacological therapies may be developed. Drugs
targeting specific molecules in the signaling cascade can preserve the important proinflammatory function of IL-17 while prevent against the diseased state.
2.10 Rationale, Objectives and Hypothesis
Rationale:
During extracellular bacterial or fungal infections, Th17 cells produce IL-17,
which enhances inflammation primarily through the recruitment and induction of
proliferation of monocytes [51, 54]. Monocytes are one of the first responders during
infection. They are important in processing and presenting microbial peptides to T cells
to mount a robust adaptive immune response. They are also one of the major mediators
28
of inflammation [106-107].
Both IL-17 and monocytes have been implicated in chronic
inflammatory diseases such as RA [98] and allergic airway inflammation[97].
Since monocytes respond to IL-17 to amplify inflammation, it is important to
understand the signaling process in these cells. Monocytes must first express IL-17R to
prepare for IL-17 binding later during infection. Therefore, before we can understand
how monocytes respond to IL-17, we must first characterize the IL-17R levels in these
cells during inflammatory responses. To this end, we used lipopolysaccharide (LPS), a
well-characterized pro-inflammatory signal. LPS found in the cell membrane of Gram
negative bacteria, is a pyrogen that activates monocytes and upregulates the inflammatory
properties of these cells[108]. LPS was used to simulate a bacterial infected state, during
which IL-17R levels in monocytes was measured. Understanding the IL-17R response
towards LPS is important because IL-17R initiates the downstream signaling responses
leading to upregulation of pro-inflammatory cytokines and chemokines.
By better
understanding regulation of IL-17R in human monocytes, monocyte signaling in response
to IL-17 may become better elucidated.
Overall Aim: To understand the mechanisms which influence IL-17R levels in human
monocytes in response to LPS
Specific aims:
1) Are IL-17RA and IL-17RC expressed in human monocytes?
29
2) What are the post-translational regulatory mechanisms regulating IL-17RA levels
in response to LPS in human monocytes?
Hypothesis: LPS induces upregulation of IL-17RA and IL-17RC levels in human
monocytes.
30
Chapter 3
Material and Methods
Cell Culture and Reagents:
THP-1 cells stably transfected with a plasmid containing CD14 cDNA sequences
(CD14 THP-1) were provided by Dr. R. Ulevitch (The Scripps Research Institute, La
Jolla, CA) [109]. CD14 THP-1, human peripheral blood mononuclear cells (PBMC), and
primary monocytes were cultured in Iscoves’ Modified Dulbecco Medium (IMDM) with
10% fetal calf serum at 37°C with 5% CO2. CD14 THP-1 and primary cells, were
stimulated with lipopolysaccaride (LPS) from Escherichia coli 0111:B4 at 1 μg/ml
(Sigma), or IL-27 at 120ng/ml, or phorbol myristate acetate (PMA) at 20ng/ml over
indicated time periods. Bafilomycin (Sigma Cat #B1793), an ATPase inhibitor and
chloroquine, a lysophilic weak base, (Sigma Cat# C6628) were used to inhibit protein
degradation.
Isolation of Primary Monocytes:
Primary human monocytes were isolated from healthy whole blood obtained as
per Queen's University Research Ethics Board approval. Whole blood was diluted 1:1
ratio with PBS-EDTA-2% FCS and overlayed onto Lympholyte (Cedarlane Laboratories)
in a 4:3 ratio of diluted blood to Lympholyte. Overlay tubes were centrifuged for 20min
at 1200g, at room temperature with the brake off. The PBMC fraction was washed twice
with PBS-EDTA-2%FCS and used to isolate primary monocytes using the protocol of
31
negative selection from the Human Monocyte Enrichment Kit without CD16 Depletion
[Cat #19058, Stem Cell Technology]. Briefly, washed PBMC were resuspended in PBSEDTA-2% FCS at 5x107cells/ml.
Antibody cocktail was added to PBMC at a
concentration of 50 μg/ml and incubated for 10 minutes at room temperature. Antibody
cocktail contains a combination of mouse monoclonal IgG1 antibodies and an FcR
blocker of class IgG2b to prevent non specific binding to monocytes. Dextran coated
magnetic beads used for labeling unwanted cells using Tetrameric Antibody Complexes
(TAC) were vortexed for 30 seconds for homogenization and added at 50 μg/ml to
PBMC and incubated for 5 minutes at room temperature. The PBMC suspension was
brought to a total volume of 5ml with PBS-EDTA-2% FCS, and inserted with the cap off
into a magnet for 2 minutes and 30 seconds to allow for separation of unlabeled target
cells from magnetically labeled cells. The purified monocytes were poured into a fresh
conical tube and were cultured as described above.
RNA isolation:
Total RNA was isolated from cells using the Tri Reagent method (Sigma).
Briefly, pellets were lysed in 1 ml of TRI reagent per 5-10 x 106 cells. The homogenate
was supplemented with 50μl of 4-bromoanisole (Sigma) per ml of TRI reagent. The
samples were vortexed for 15 seconds and centrifuged at 12,000g for 15 minutes at 4°C.
The upper aqueous phase was collected and transferred to fresh tubes.
0.5ml of
isopropanol (BioShop Canada) was added to precipitate RNA and the samples were
32
incubated for 10 minutes and centrifuged at 12,000g for 5minutes at 4°C. Supernatant
was discarded and the RNA pellet was washed with 1ml of 75% of ethanol by vortexing
and subsequent centrifugation at 12000g for 5minutes at 4°C. The ethanol was removed
and RNA pellet was dissolved in 50μl of RNase free water.
RT-PCR analysis:
RNA OD was measured using an ND1000 spectrophotometer (Fisher Scientific).
RNA samples were diluted using RNase free dH2O to obtain 1μg of RNA. RNA(1μg)
was reverse transcribed with random primers, dNTP, 5X buffer and Moloney Murine
Leukemia Virus Reverse Transcriptase Enzyme (Invitrogen Cat. #28025-013). The RTPCR cycling condition was 25°C for 15 minutes, 42°C for 1 hr, followed by 95°C for 5
minutes. cDNA was added to specific primers: IL-17RA, IL-17RC, IL-6 or TNFα, or 18s
primer sets, with Taq Polymerase 5X master mix (New England Biolabs Cat #M0285L)
containing dNTPs, MgCl2, KCl and stabilizers. Sequences are shown in Table 1.
Primer cycling parameters were optimized on a Px2 Thermal Cycler (Thermo
Electron Corporation) and their expected sizes were calculated using BLAST (Basic
Local Alignment Search Tool). Cycling conditions for each primer set are shown in
Table 2. PCR products (12μl) were loaded with 2μl of 6X loading dye and run on a 1.2%
agarose gel with ethidium bromide in 0.5X TBE buffer at 75V until bands of desired size
were separated. Gels were imaged on an HD2 Alpha-Innotech imager (Fisher Scientific).
33
Table 1: Sequences of primers and their expected sizes.
Primer
Forward Sequence
Reverse Sequence
Expected
Size
18s
5’
5’ CCA GAC AAA TCG CTC 200
ACTCAACACGGGAA
CAC CAAC 3’
ACCTCAC 3’
IL-17RA
IL-17RC
IL-6
TNF-α
5’
5’
TGACAGCTGGATTC
TGGTGTTCAGCTGCAGGACAG
ACCCTCGAAA 3’
ATA 3’
5’
5’
AGGTTCTCGAGTTC
TGAAGTACAGCCACTGGGTTC
CCATTGCTGA 3’
CAA 3’
5’
5’
GAACTCCTTCTCCA
GAATCCAGATTGGAAGCATCC
CAAGCG 3’
3’
5’GAGTGACAAGCCT
5’GGCAATGATGATCCCAAAG
GTAGCCCATGTTGT
TAGACCTGCCCAGACT 3’
187
196
300
AGCA 3’
34
440
Table 2: Cycling conditions for primers
Primer
Cycling Conditions
Number of cycles
18s, IL-17RA, IL-6
95°C for 10 min
40 cycles
95°C for 45 sec
55°C for 60 sec
72° C for 45 sec
72° C for 10 min
IL-17RC
95°C for 10 min
50 cycles
95°C for 45 sec
54°C for 60 sec
72° C for 45 sec
72° C for 10 min
TNF-α
95°C for 10 min
95°C for 60 sec
65°C for 60 sec
72° C for 60 sec
72° C for 10 min
35
30 cycles
Concentrating Supernatant Protein:
PBMC were stimulated with LPS for 24h and cell supernatants were collected.
Proteins in the supernatant were concentrated using the Total Protein Concentration Kit
(Norgen Cat #22000).
Briefly, a spin column was assembled with the collection tube
and 400μl of Column Activation and Wash Buffer. The tubes were centrifuged for 2
minutes at 7000 rpm, and flowthrough was discarded. The column activation step was
repeated two more times.
Supernatant (500μl) was diluted in 500μl of PBS and
supplemented with 40μl of pH Binding Buffer that was provided.
Protein solution
(500μl) was added to column and centrifuged for 2 minutes at 7000 rpm. This was
repeated once more with remaining supernatant dilution. Column was washed with 400μl
of Column Activation and Wash Buffer and centrifuged for 2 minutes. This was repeated
once more. Neutralizer (9.3μl) was added to a fresh 1.7ml Elution Tube. The spin
column was transferred into the Elution Tube and 100μl of Elution Buffer was applied to
the column and centrifuged for 2 minutes to elute bound proteins. Concentrated proteins
were separated by SDS-PAGE and analyzed by Western blot as described in the
following section. Media alone and media with FCS were also concentrated down using
the same procedure as control.
Cell lysis for whole cell protein:
Cells were collected and lysed in lysis buffer [1M HEPES, 0.5M NaF, 0.5M EGTA,
2.5M NaCl, 1M MgCl2, 100% glycerol, 100% Triton-X-100], containing a protease
36
inhibitor cocktail (serine and cysteine, and calpain protease inhibitors) (Pierce #78410).
The Bradford Assay was used to determine protein concentration. Absorbencies were
measured with Varioskan Rev. 2.0 (Thermo Electron Corporation) 96-well plate reader.
Negative control cell lysate from bone, heart and skeletal muscles were obtained from
ProSci.
SDS-PAGE and Western blot analysis:
IL-17 RA and IL-17RC protein levels were measured by Western blot analysis.
50μg of total protein were resolved on 10% polyacrylamide gels and were transferred to
polyvinylidene fluoride membranes (Millipore) and blocked for 1hr with 2.5% bovine
serum albumin (BSA) at room temperature. Membranes were probed with IL-17RA Nterminus (Santa Cruz Cat # 30175) diluted 1:1000 in BSA, IL-17RC (R&D Cat AF2269)
diluted at 1:1000
overnight at 4°C with gentle agitation.
Appropriate secondary
antibody (horseradish peroxidase-conjugated rabbit anti-goat, goat anti-rabbit, or goat
anti-mouse polyclonal antibody [Santa Cruz Biotechnology]) were added to the
membranes at 1:10000 for 1 hour and washed with TBST buffer (150 mM Tris-HCl, 1 M
NaCl, and 1% Tween 20). Blots were visualized with Enhanced Chemiluminescence
(ECL) (Amersham Biosciences) on an HD2 Alpha-Innotech imager. Membranes were
stripped (1 M Tris-HCl (pH 6.8), β-mercaptoethanol, 2% SDS, and 0.7 mM
dithiothreitol) at 50 °C and washed with TBST buffer seven times followed by re-probing
37
with 1:5000 alpha-tubulin (Sigma) or 1:1000 heat-shock protein 90 antibody (Santa Cruz
Cat #7947) as loading controls.
ELISA:
PBMC were stimulated with LPS for 24hr and the cell supernatants were
collected.
96 well microplates were coated overnight at 4°C with 50μl of capture
antibody IL-17R (R&D Cat #: MAB 1771) at 2μg/ml diluted with coating buffer A (8.0g
NaCl, 1.13 g Na2HPO4, 0.2g KH2PO4, 0.2g KCl, and 0.1% ProClin in 1L of dH2O, pH
7.4). Plates were washed and blocked for 1hr at room temperature with 300μl of assay
buffer (8.0g NaCl, 1.13 g Na2HPO4, 0.2g KH2PO4, 0.2g KCl, 5.0g bovine serum albumin,
1ml Tween 20 and 0.5% ProClin in 1L of dH2O, pH 7.4). Standard recombinant human
IL-17R protein (R&D Cat #: 177-IR) was diluted to 1000 pg/ml and serially diluted two
fold in 450μl of assay buffer. Standards or stock sample supernatant was added for 2hrs
before addition of 25μl of biotinylated IL-17R antibody (R&D Cat #: BAF177) at
0.1μg/ml diluted with assay buffer.
This was incubated for 2hrs more at room
temperature with continual shaking. The plate was washed with 300μl of 1X washing
buffer (Wash buffer 25X: 0.2g KH2PO4, 1.9g K2HPO4- 3H2O, 0.4g EDTA, 0.5ml Tween
20 in 1L of dH2O, pH to 7.4), incubated with 50μl of streptavidin-HRP, washed again
before addition of TMB Stabilized Chromogen (Biosource). 100μl of 1.8N H2SO4 was
added to stop the reaction and absorbencies were immediately measured on BioTek
ELx800 Absorbance Microplate Reader at 595nm.
38
Detection of IL-6 (Biosource CHC1263) and TNF-α (Biosource CHC1753)
followed the manufacturer’s protocol. Briefly, plates were coated with capture IL-6 at 1
μg/ml, or TNF-α at 2μg/ml. Plates were washed and blocked for 1hr, followed by
addition of standards or samples, 1:50 dilution for IL-6, and stock sample for TNF-α.
Detection antibody was added immediately to microplates (IL-6: 0.16 μg/ml, or TNF-α:
0.32 μg/ml) and incubated for 2 hr with continual shaking. The plate was washed with
300μl of 1X washing buffer (Wash buffer 25X: 0.2g KH2PO4, 1.9g K2HPO4- 3H2O, 0.4g
EDTA, 0.5ml Tween 20 in 1L of dH2O, pH to 7.4), incubated with 50μl of streptavidinHRP, washed again before addition of TMB Stabilized Chromogen (Biosource). 100μl
of 1.8N H2SO4 was added to stop the reaction and absorbencies were immediately
measured on BioTek ELx800 Absorbance Microplate Reader at 595nm.
39
Chapter 4
Results
4.1 IL-17R response to LPS
The expression of IL-17RA is ubiquitous throughout tissues in the body, with
higher expression on hematopoietic cells. In order to respond to IL-17, IL-17RA must
complex with IL-17RC, which is expressed poorly on hematopoietic cells, to form
functioning signaling receptor [7, 61].
IL-17 promotes monocyte recruitment and
proliferation [54]. These cells are precursors of macrophages and are the first responders
during infection.
Currently levels of IL-17R in monocytes, in particular during
inflammatory responses, are not well characterized. Therefore, in this study we focus on
the regulation of IL-17 receptor components in response to inflammatory signals given by
LPS in human monocytic cells.
4.1.1 LPS induces IL-17RA mRNA in primary human immune cells
Here, we determined mRNA levels of IL-17RA and IL-17RC in CD14 THP-1
cells, PBMC, and monocytes. We hypothesized that LPS, which upregulates a variety of
cytokines such as IL-6, IL-12, and TNF-α [110-111], will also enhance mRNA levels of
IL-17R. All three types of cells were stimulated with LPS for a time course of 0 to 24
hours to measure mRNA expression of IL-17RA using primers directed at the coding
sequence for the extracellular region.
40
mRNA expression of IL-17RA was observed to
increase over 24 hours in
PMBCs and monocytes (Figure 6A). IL-17RA mRNA expression increased significantly
at 16hr in PBMC whereas in primary monocytes, increased transcript levels were
observed at 8hrs. However, no increase in mRNA expression was observed in the CD14
THP-1 cell line. It is interesting to note that the kinetics of increased IL-17RA transcript
level differed between PBMC and monocytes. This may be because monocytes only
constitute up 10-20% of PBMC, and the responses observed in PBMC may be
contributed more by lymphocytes such as T cells that constitute up to 50% of PBMC.
Since levels of IL-17RA mRNA are upregulated relatively late in response to
LPS, we wanted to ensure that the cells were able to respond to LPS at earlier time
points. Therefore, we examined IL-6 and TNF-α expression in primary cells. In PBMC,
both cytokine transcript levels were shown to increase over the 24hr period with maximal
induction at 4hr (Figure 6C).
A similar trend was observed in monocytes over a 16hr
period.
4.1.2 LPS induces IL-17RC mRNA in CD14 THP-1 cells, but only weakly in PBMC
and monocytes
IL-17RC is a crucial partner to IL-17RA in mediating cellular response to IL-17A
in humans.
cells[27].
Unlike IL-17RA, IL-17RC is only weakly expressed in hematopoietic
Thus, it is important to measure IL-17RC mRNA and protein levels in
monocytes as the level of IL-17RC will determine cellular responses to IL-17.
41
A)
B)
C)
PBMCs
--------LPS-------0 4h 8h 16h 24h
IL-6
Monocytes
-----LPS----0 4h 8h 16h
TNF-α
18srRNA
Figure 6: LPS enhances IL-17 receptor transcript levels in PBMC and human monocytes.
PBMC were collected from healthy subjects. Primary monocytes were isolated from
PBMC using negative selection. Cells were treated with or without LPS (1μg/ml) for
times ranging from 0 to 24hr. Cells were harvested and RNA was extracted for RT-PCR
analysis of either IL-17RA (A) or IL-17RC (B). Positive controls of IL-6 and TNF-α
expression were shown for both PBMC and monocytes (C). 18srRNA was included as a
loading control. Gels are representative of at least five separate experiments.
42
As with IL-17RA, we hypothesize that IL-17RC mRNA levels will increase in response
to LPS to facilitate for IL-17 binding. From RT-PCR analysis, transcript levels of IL17RC increased in all three types of cells (Figure 6B). However, IL-17RC mRNA levels
in PBMC and monocytes were significantly weaker compared to CD14 THP-1 cells. The
kinetics of IL-17RC mRNA upregulation were similar in both CD14 THP-1 cells and
PBMC, with a significant increase at 16hr. In monocytes, IL-17RC was only weakly
upregulated at 24hr.
4.1.3 LPS decreased levels of IL-17RA protein levels in primary cells
Since we observed LPS-mediated induction of IL-17RA and IL-17RC mRNA
expression, we wanted to confirm this result at the protein level. Therefore, levels of
protein expression of IL-17RA and IL-17RC were measured using SDS PAGE and
Western blot analysis. IL-17RA is approximately 120kDa and a type I single span
transmembrane protein with variable extracellular glycosylation at the N-terminus. To
detect changes in levels of IL-17RA, an antibody directed against the extracellular Nterminus of the protein was used. It is expected from the increase in mRNA transcription
in RT-PCR that IL-17RA protein levels will also increase in response to LPS treatment.
Interestingly, IL-17RA protein levels were significantly decreased under the same
conditions at 16 hrs in primary cells (Figure 7A). This drastic discrepancy between IL17RA mRNA and protein levels raised the question of what mechanisms may be leading
to the decrease of IL-17RA protein levels. Furthermore, IL-17RA was only weakly
43
A)
B)
Figure 7: LPS downregulates IL-17RA protein levels in PBMC and Monocytes. PBMC
were collected from healthy subjects. Primary monocytes were isolated from PBMC
using negative selection. Cells were treated in presence of LPS (1μg/ml) for 24hr. A)
50μg or 100μg of total cell lysate or B) 5μl of cell lysate from negative controls of tissue
cells where IL-17A is poorly expressed, were run on SDS-PAGE and membranes were
blotted with IL-17RA. Membranes were later probed with hsp90 antibodies as loading
control. Blots shown are representative of at least five separate experiments.
44
detected in CD14 THP-1 cells. Even when running 100μg of CD14 THP-1 total cell
lysate on SDS-PAGE, protein levels of IL-17RA was decreased compared to primary
cells with only 50μg of protein (Figure 7A). Kinetics of IL-17RA in CD14 THP-1 cells
also did not exhibit a similar trend to what was observed in primary cells. In the cell line,
IL-17RA was still weakly detectable at 16hr.
To demonstrate IL-17RA antibody specificity, negative controls of bone, heart
and skeletal muscle tissues were used since IL-17RA is poorly expressed in these tissues.
Indeed, from the Western blot, no IL-17RA was detected, while hsp90 antibody shows
presence of proteins (Figure 7B).
In order to determine if IL-17RA response to cell activation is LPS-specific,
PBMC were stimulated with two different stimulants: IL-27 (120 ng/ml) or PMA
(20ng/ml).
IL-27 has been shown to act on monocytes to upregulate various pro-
inflammatory cytokines [112], and PMA is a known tumor promoter that strongly
activates the signaling molecule protein kinase C (PKC) to upregulate proinflammatory
cytokine expression [113]. With both stimuli, IL-17RA levels over 24hrs exhibited a
similar trend as LPS stimulation (Figure 8). This suggests that IL-17RA response to LPS
is not specific, but rather a general response to pro-inflammatory stimuli.
4.1.4 IL-17RC protein level is not affected by LPS
While IL-17RC mRNA expression increased at 24hr, like IL-17RA, the protein levels
over 24hrs did not correspond to transcript levels. Since IL-17RA complexes with RC to
45
Figure 8: IL-27 and PMA downregulates IL-17RA protein levels in PBMC. PBMC were
collected from healthy donors. Cells were treated with either IL-27 (120ng/ml) or PMA
(20ng/ml). 50μg of total cell lysate were run on SDS-PAGE and membranes were blotted
with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control.
Blots shown are representative of at least five separate experiments.
46
induce signaling, we would expect IL-17RC to respond to LPS in a similar way as IL17RA, and decrease in response to LPS treatment. However, protein levels of IL-17RC
in THP-1 cells and PBMC showed no change (Figure 9). In THP-1 cells, only one band
was detected compared to two bands found in PBMC, one at the 86kDa mark, which is
the molecular weight of IL-17RC, the other in the range of the 110kDa marker. In
PBMC 0-8hr, multiple weak bands near the 110 kDa was observed, possibly due to
glycosylation. Due to weak mRNA levels of IL-17RC in monocytes and protein levels in
PBMC, protein levels of IL-17RC in monocytes were not further investigated.
4.1.5 IL-6 and TNF-α production increases in response to LPS treatment
To show that primary cells were responding to LPS at 24hr, IL-6 and TNF-α
production from LPS stimulation were quantified by ELISA (Figure 10). Addition of
LPS to PBMC increased IL-6 and TNF-α levels to 6500pg/ml and 1000pg/ml
respectively, from non-detectable levels. IL-6 production increased significantly from 4hr
to 24hr of incubation with LPS, whereas TNF-α levels increased the most from untreated
to 4hr with LPS. Similarly in monocytes, IL-6 production increased over 24hr.
4.2 IL-17RA is not cleaved or secreted in response to LPS stimulation
To investigate the discrepancy between mRNA and protein IL-17RA levels, two
possibilities were considered: cleavage and secretion of the extracellular domain of IL17R or receptor internalization and degradation. Many cytokine receptors, such as soluble
47
Figure 9: LPS does not significantly affect IL-17RC protein levels in PBMC and THP-1
cells. PBMC collected from healthy donors and THP-1 cells were treated with LPS
(1μg/ml) over 24hrs. 50μg of cell lysate were loaded in SDS PAGE for Western blot
analysis. Membranes were blotted for IL-17RC and later hsp 90 for loading control.
Blots shown are representative of at least five separate experiments.
48
A)
8000
7000
IL-6 (pg/ml)
6000
5000
4000
3000
2000
1000
N.D
0
.
untreated
4h LPS
24h LPS
1200
TNF-α (pg/ml)
1000
800
600
400
200
0
N.D
.
untreated
4h LPS
24h LPS
B)
30000
IL-6 (pg/ml)
25000
20000
15000
10000
5000
N.D.
0
untreated
4h LPS
24h LPS
49
Figure 10: IL-6 and TNF-α protein levels in PBMC and monocytes detected by ELISA
show that cells are still responding properly to LPS at 16hr and 24hr. PBMC were
collected from healthy donors and monocytes were isolated using negative selection.
PBMC (A) or monocytes (B) were stimulated with LPS (1μg/ml) and supernatant was
collected for IL-6 or TNF-α quantification by ELISA. Error bars represent standard
deviation. N.D: not detected. Data is representative of two different individuals.
50
gp130 and soluble IL-1R type II [114], have been observed to use soluble isoforms as a
means to limit membrane bound receptor activation and signaling[81]. Soluble forms of
IL-17RB and IL-17RC have been predicted but not investigated [27]. Soluble isoforms
may be generated by several mechanisms, one of which is cleavage and secretion of the
extracellular region of receptor.
In order to determine if IL-17RA is either cleaved and/or secreted, an ELISA was
performed to detect soluble isoforms of IL-17RA. It was expected that if IL-17RA was
cleaved or released as a soluble receptor, then sIL-17RA levels should increase at 16hr,
corresponding to the decrease in cellular protein levels. However, no soluble isoforms of
IL-17R in the PBMC supernatant were detected (Figure 11A). IL-17RA concentration in
supernatant was below the lowest standard concentration and no significant trend was
observed. A positive control of standard IL-17R was included, and IL-17RA protein was
detected confirming that the antibodies and protocol were working.
To confirm that there were no soluble isoforms of IL-17RA as detected by
ELISA, protein in the supernatant was concentrated for SDS PAGE and Western blot
analysis (Figure 11B). Given that the average weight of one a.a is 135 Da, and there are
approximately 320 a.a in the extracellular domain, with seven potential sites of N-linked
glycosylation [115], if IL-17RA was cleaved, then the extracellular domain would be
around 90kDa. However, no band at the 90kDa marker was observed. Multiple bands at
245, 120, 20 kDa mark were observed, however, these bands were also present in the
51
A)
IL-17RA expression in PBMC supernatant
3.5
Absorbancy
3
2.5
2
1.5
1
0.5
0
1000
pg/ml
500
pg/ml
250
pg/ml
125
pg/ml
62.5
ug/ml
---------------standard rIL-17RA------------
B)
52
0
4h LPS 8h LPS 16h LPS 24h LPS
----------PBMC supernatant-------------
Figure 11: Extracellular domain of IL-17RA is not cleaved and secreted as detected by
ELISA and Western blot of concentrated supernatant protein. PBMC were collected
from healthy donors and monocytes were isolated using negative selection. A)
Supernatants from PBMC or monocytes treated with LPS (1μg/ml) were collected to
quantify cleaved isoforms of IL-17RA. Standard rIL-17R was diluted to 1000pg/ml and
serially diluted two fold to generate standard curve. B) Western blot of concentrated
supernatant protein using Total Protein Concentration Kit confirmed negative result
found in ELISA. There was no significant difference in supernatant protein when
compared to media with FCS control. Graphs are representative of at least five separate
experiments. Western blot of concentrated protein in supernatant is representative of at
least three separate experiments.
53
media control with fetal calf serum (FCS) which contain growth factors to help cells
grow [116], suggesting that these bands were due to nonspecific binding of antibody. No
bands were observed in the medium alone, suggesting the source of these proteins came
from the FCS.
4.3 IL-17RA is degraded in response to LPS stimulation
From previous experiments, it is unlikely that IL-17RA is cleaved and secreted, as
both ELISA and Western analysis of concentrated supernatant proteins failed to detect
IL-17RA. Receptor internalization and degradation is another mechanism by which cells
control signaling.
For example, IL-5R was demonstrated to undergo receptor
internalization via both clathrin and lipid raft mediated endocytosis to both positively and
negatively control signaling, respectively[83]. To explore the possibility of receptor
degradation that may account for the decrease of IL-17RA levels at 16hr as detected by
Western analysis, cells were pretreated with bafilomycin or chloroquine to prevent
protein degradation.
4.3.1 Bafilomycin and chloroquine dose optimization
Bafilomycin is an ATPase inhibitor, whereas chloroquine is a lysophilic weak
base that neutralizes the acidic compartment of lysosome[87-88]. Both drugs are able to
inhibit receptor recycling and degradation. Receptor levels were expected to increase
with drug treatment if receptor internalization and degradation was occurring. First,
54
PBMC were treated with the drug at various doses to optimize drug dosage. Doses used
for optimization were selected based on literature that studied drugs effect on monocytes
or closely related immune cells. Bafilomycin concentrations of 10nM to 100nM, were
within range of what is used in the literature for monocytes [117-120]. Chloroquine
concentrations of 5μM to 100μM were also selected based on experiments on monocytes
from the literature [121-122].
Based on the Western blot and other experiments, the
dosage that increased IL-17RA levels the most without causing cell death was selected.
Specifically, bafilomycin 100nM and chloroquine at 50μM was selected (Figure 12).
It is also interesting to note that in CD14 THP-1 cells, chloroquine was able to
increase IL-17RA protein levels (Figure 13B).
Compared to CD14 THP-1 cells
stimulated with only LPS (Figure 13A), IL-17RA was significantly increased by
chloroquine overnight pretreatment at all doses followed by addition of LPS. Total
protein of 100μg was run on SDS-PAGE showed weak bands for IL-17RA in the absence
of the drug, compared to only 50μg of total protein from THP-1 cells treated with
chloroquine.
Moreover, 50μM and 100μM of chloroquine also increased IL-17RA
protein levels at 16hrs. However, it should be noted that IL-17RA levels did not decrease
at 16hr in these cells with LPS treatment alone. Therefore, further experimentation in
primary cells was conducted to confirm a similar trend and mechanism. In CD14 THP-1
cells, 50μM of chloroquine was able to increase IL-17RA protein levels at 16hr,
therefore, this dose was selected for further experiments.
55
Figure 12: Bafilomycin and chloroquine treatment of PBMC at 10nM and 100nM, and
5uM and 50uM respectively. PBMC collected from healthy donors were treated with LPS
alone or either drug alone to optimize drug concentration and drug effect on IL-17RA
levels. 50μg of total cell lysate were run on SDS-PAGE and membranes were blotted
with IL-17RA. Membranes were later probed with hsp90 antibodies as loading control.
Doses for further experiments were chosen based on which doses had the highest effect
on IL-17RA protein levels without affecting cell viability. Bafilomycin 100nM and
chloroquine 50uM were chosen for later experiments. Western blot is representative of
three separate experiments. BAF: bafilomycin, CLQ: chloroquine.
56
A)
B)
Figure 13: Chloroquine pretreatment of THP-1 cells increased IL-17RA protein levels.
50μg of total cell lysate were run on SDS-PAGE and membranes were blotted with IL17RA. THP-1 cells were pretreated with increasing doses of chloroquine overnight,
25μM, 50μM and 100μM, followed by LPS treatment of indicated times. Membranes
were later probed with hsp90 antibodies or alpha tubulin as loading controls. Western
blot is representative of three separate experiments. CLQ: chloroquine.
57
4.3.2 Bafilomycin and chloroquine time course optimization
In order to optimize the drug effect on IL-17RA protein levels, PBMC were
incubated with either drug under three conditions: 1) pretreatment of either drug for 2hr,
followed by addition of LPS for 0 to 16hr, 2) simultaneous incubation of LPS and drug,
or 3) LPS pretreatment followed by drug.
Bafilomycin alone increased IL-17RA protein levels (Figure 14).
The third
treatment option did not yield significant increase of IL-17R (Figure 14), and this option
was further tested in monocytes. In monocytes, LPS pretreatment of 12hr, followed by
increasing duration of bafilomycin treatment showed that with increasing time of the
drug, there was a decrease in IL-17RA protein levels, suggesting a decrease in drug
efficacy (Figure 15). However, stock bafilomycin may have lost its efficacy during
monocyte treatment.
This is based on the observation that previous bafilomycin
treatment affected hsp90 levels (Figure 14).
However, hsp90 was not significantly
affected in bafilomycin treatment on monocytes.
Simultaneous treatment of bafilomycin and LPS did not increase IL-17RA but IL17RA protein levels at 16hr were preserved compared to 4hr (Figure 14). Results from
bafilomycin 2h pretreatment were surprising, since pretreatment for 2hr in other studies
was effective for protein inhibition.
However hsp90 was significantly affected,
suggesting cell death. Therefore, simultaneous treatment of LPS and bafilomycin or
pretreatment of bafilomycin were investigated in further experiments in monocytes.
58
Figure 14: Time optimization of bafilomycin and chloroquine treatment in PBMC.
PBMC collected from healthy donors were stimulated with LPS, drug alone, or together
in three different combinations: 1) pretreatment with drug for 2hr, followed by LPS 2)
simultaneous LPS and drug treatment, or 3) pretreatment with LPS followed by drug
treatment. For LPS pretreatment (data not shown unless indicated), three different time
points were tested: 1) LPS for 12hr, followed by drug for 4hr, 2) LPS for 8hr, followed
by drug 8hr (data shown), or 3) LPS for 4hr, followed by drug for 12hr. 50μg of total
cell lysates were run on SDS-PAGE and membranes were blotted with IL-17RA.
Membranes were later probed with hsp90 antibodies as loading control. Western blot is
representative of at least three separate Western blots. BAF: bafilomycin, CLQ:
chloroquine. p2h: pretreated for 2hr.
59
Figure 15: Bafilomycin treatment of monocytes following LPS pretreatment of 12hr did
not increase IL-17RA levels. Monocytes negatively isolated from healthy PBMC were
treated with LPS alone, bafilomycin alone or pretreated with LPS for 12hrs followed by
bafilomycin for the indicated times. 50μg of total cell lysate were run on SDS-PAGE and
membranes were blotted with IL-17RA. Membranes were later probed with hsp90
antibodies as loading control. Blots shown are representative of at least five separate
Western blots. BAF: bafilomycin. p12h: pretreated for 12hr.
60
In contrast to bafilomycin, chloroquine alone did not increase IL-17RA protein
levels at 16hr (Figure 14). It is likely, looking at the hsp90, that chloroquine induced cell
death, therefore explaining the absence of IL-17RA at 16hr. However, pretreatment of
chloroquine for 2hrs followed by LPS treatment significantly increased IL-17RA levels at
all time points. IL-17RA levels at 16hr in the presence of chloroquine were significantly
increased compared to no drug treatment. This effect may be due to presence of LPS that
induced IL-17RA and rescued cellular response. Simultaneous treatment of LPS and
chloroquine did not significantly increase IL-17RA levels. Similar to bafilomycin, LPS
pretreatment followed by chloroquine did not significantly increase IL-17RA levels.
Overall, chloroquine had a stronger effect on IL-17RA levels than bafilomycin.
4.3.3 Bafilomycin and chloroquine pretreatment of cells stimulated with LPS in
monocytes increased IL-17RA protein levels
In monocytes, both simultaneous incubation of LPS and bafilomycin, and
bafilomycin pretreatment resulted in increased IL-17RA protein levels compared to no
drug treatment (Figure 16). As in PBMC (Figure 13), bafilomycin alone increased IL17RA protein levels.
In contrast to PBMC (Figure 13), in monocytes, chloroquine treatment alone
increased IL-17RA levels after 16hr. Pretreatment of 2hrs and overnight chloroquine
treatment increased IL-17RA levels at all time points compared to no drug addition. As
in PBMC, in monocytes, chloroquine more strongly increased IL-17RA protein levels
61
A)
B)
Figure 16: In primary monocytes, drug pretreatment followed by LPS increased IL-17RA
protein levels. Primary monocytes were negatively selected from healthy PBMCs and
were treated with LPS or drug alone, or pretreated with drug followed by LPS. A)
Monocytes were pretreated with chloroquine for 2hrs. Additionally, cells were also
treated simultaneously with bafilomycin and LPS. B) Monocytes were pretreated with
chloroquine overnight at a concentration of 50μM. 50μg of total cell lysates were run on
SDS-PAGE and membranes were blotted with IL-17RA. Membranes were later probed
with hsp90 antibodies as loading control. BAF: bafilomycin, CLQ: chloroquine. p2h:
pretreated for 2hr.
62
than bafilomycin. Taken together, this data indicates that IL-17RA may be degraded in
response to LPS treatment.
63
Chapter 5
Discussion
There is disparity between levels of transcript and protein of IL-17R in PBMC
and monocytes treated with LPS.
LPS decreases IL-17RA protein levels while
upregulating IL-17RA transcript levels. IL-17RC mRNA and protein levels also differ.
Cellular mechanisms that may account for the decrease in IL-17RA protein at 16hr was
investigated further and IL-17RA was found to undergo receptor degradation with LPS
treatment. This control mechanism is crucial for monocytes, the main mediators of
inflammation, to downregulate IL-17RA as one way to prevent overactivation of cells by
IL-17.
5.1 Differential IL-17R mRNA upregulation in PMBC, monocytes, and CD14 THP1 cells
RT-PCR of IL-17RA revealed upregulation of transcript levels in the presence of
LPS only in PBMC and monocytes, but not in CD14 THP-1 cells. This points to the
differential response between freshly isolated primary cells and a cell line. Transfected
CD14 THP-1 cells are marked by surface membrane CD14 that functions as a co-receptor
to TLR4 in response to LPS to upregulate proinflammatory cytokines such as IL-6 and
TNF-α [123-124].
However, these transformed leukemic cells differed in responses
from primary cells. In CD14 THP-1 cells, IL-17RA surface levels may already be
maximally saturated and thus cells can no longer increase IL-17RA. Another possibility
64
is that downstream signaling is changed in CD14 THP-1 cells, so that slight variations in
the combination of downstream factors would lead to failure to bind promoter of Il17ra
and upregulate transcription. This difference in response demonstrates the limitations of
using a cell line and the importance of using primary cells.
In contrast, the IL-17RC mRNA transcript levels were increased in all three types
of cells, with varying kinetics in response to LPS treatment. IL-17RC transcript in CD14
THP-1 cells did not reach the same level of expression as 18srRNA, whereas, IL-17RA
and 18srRNA levels were expressed at equal intensity in CD14 THP-1 cells. This
suggests then, that the level of transcript may be what is determining if IL-17R can be
upregulated further. In a transformed cell such as CD14 THP-1, control of basal levels of
Il17ra may be lost. Therefore, in the presence of further stimulus, Il17ra cannot be
upregulated because it is already maximally transcribed. In CD14 THP-1 cells, loss of
tight regulation and basal expression of IL-17RC transcript may explain the strong
induction of IL-17RC.
Overall regulation of IL-17R transcript levels is crucial in
controlling cellular responses to IL-17, as mRNA levels predict protein levels which
determine surface levels of receptors to IL-17, a potent pro-inflammatory cytokine.
Comparison between monocytes and PBMC reveals a difference in kinetics of IL17R mRNA upregulation. In PBMC, there is a stronger expression and earlier
upregulation of both Il17ra and Il17rc. This may be because monocytes only constitute
up to 10-20% of PBMC [125]. Therefore, the response observed in PBMC may be
contributed more by lymphocytes such as T cells, which also express IL-17RA, and
65
constitute up to 50% of total PBMC population[126]. In order to understand how IL-17R
is regulated in monocytes, it is important to first measure IL-17RA in a pure monocyte
population. Therefore, primary monocytes were isolated to measure IL-17RA transcript
levels in these main mediators of inflammation.
Since IL-17RA is a subunit shared by other IL-17R family members, such as IL17RB to bind IL-17RE, it is not surprising the IL-17RA mRNA transcript is expressed at
a higher level than IL-17RC. An absence of IL-17RC at basal levels in both primary
cells was expected since it is known that IL-17RC is poorly expressed in hematopoietic
cells. Regulating transcript expression levels of IL-17RA and RC, which must complex
together to induce signaling, at different levels is significant.
different tissues to regulate pro-inflammatory responses.
This allows cells in
By limiting one receptor
transcript level, cells can dampen response to IL-17A, while still responding to other IL17 members.
On the other hand, kinetics of both IL-17RA and IL-17RC transcript upregulation
in primary cells were similar.
In PBMCs, both subunit mRNA levels increased
significantly at 16hr, and in monocytes, the strongest induction was at 24hr.
Simultaneous upregulation of both IL-17RA and IL-17RC mRNA levels are important in
that both subunits are required for signaling.
From the RT-PCR, IL-17RC transcript was only upregulated in presence of LPS.
However, poor expression of IL-17RC in monocytes, suggests that LPS alone may not be
sufficient to upregulate IL-17RC. In PBMCs, where there is a mixed population of
66
various innate IL-17 producing cells and T cells, cells can secrete factors such as IL-6
and TGF-β that are necessary to drive IL-17 production to act on monocytes in a
paracrine fashion. With a pure monocyte population, these factors are not present at
sufficient levels to synergize with LPS to upregulate IL-17RC.
5.2 IL-17R mRNA and protein levels dichotomy
Due to variability between individual donors, there were also differences between
IL-17RA protein levels in response to LPS. LPS induced an increase in IL-17RA protein
level between 0 and 4hr in a few individuals, whereas this induction was not observed in
others. However, all donors, Western blot analysis revealed IL-17RA protein levels to be
decreased at 16hrs in PBMC and monocytic cells. This was surprising since in response
to LPS, the transcript levels of the receptor subunits in all three types of cells were
upregulated in contrast to the striking decrease in IL-17R protein levels.
From the positive control of IL-6 and TNF-α, LPS is observed to induce the two
proinflammatory cytokine expression at 2 to 4 hr post-stimulation.
This is early
compared to receptor transcripts that were still seen to be increasing for 16hr. This may
be due to feedback effects from secreted factors and proinflammatory cytokines as result
of LPS stimulation. These factors act in an autocrine and paracrine fashion to increase
IL-17R transcript levels as a secondary effect. Indeed LPS-induced cytokine secretion
may play a role in the decrease of IL-17RA protein at the 16 hr time point.
67
As discussed above, primary cells may differ slightly in responses from
transformed cells as the transformed cells have lost various regulatory networks that keep
growth in check.
One of the main differences between THP-1 cells and primary
monocytes is their differential ability to respond to IL-10.
IL-10 is an
immunosuppressive cytokine that is produced in response to LPS. It functions as an antiinflammatory cytokine that is produced after proinflammatory IL-6 and TNF-α cytokines
generation. Although able to produce IL-10 in response to LPS stimulation, THP-1 cells
are refractory to this cytokine [127]. It is possible that LPS induces IL-10 production in
primary monocytes, which as a secondary LPS-mediated effect, can downregulate IL17RA protein levels. This is supported by the fact that the LPS-mediated downregulation
of IL-17RA protein levels was observed 8 to 16 hr after treatment only in primary cells.
In CD14 THP-1 cells, there was a significant difference between mRNA and
protein levels ofIL-17RA. High protein levels were expected since IL-17RA mRNA
expression was high. While IL-17RA protein levels in CD14 THP-1 cells did not change
significantly with LPS stimulation, following the same trend as the transcript expression,
IL-17RA protein levels were significantly weaker compared to the high transcript levels.
In contrast to IL-17RA, IL-17RC protein levels did not change compared to an induction
in transcript levels in all three types of cells. In addition, IL-17RC protein levels between
PBMC and CD14 THP-1 cells were comparable in that there was no significant change in
protein levels in both types of cells. Clearly IL-17RA and RC are regulated differently.
68
Differences and similarities in responses between the cells may be due to posttranscriptional and post-translational modifications.
Discrepancy between mRNA and protein levels observed in the THP-1 cells may
be due to mRNA post-transcriptional modification, which is one of the most common
ways to regulate gene expression after transcription. Modifications can either increase
transcript stability by the addition of a poly A tail and 5’ cap [128], or it can decrease
transcript levels by destroying the transcript that was just made through mechanisms such
as small interfering RNA (siRNA) and micro RNA (miRNA). Additionally, recruitment
of AU- rich elements (ARE) binding proteins (ARE-BP) can positively or negatively
regulate transcript stability [129]. ARE mediated decay (AMD) regulates a variety of
cytokine transcripts such as IL-1β, IL-6, IFN-γ and TNF [129]. The ability of ARE-BPs
to bind their target sequence is further regulated by phosphorylation via kinases and
phosphatases. P38 MAPK, which IL-17 induces, is a classical regulator of mRNA
stability.
Macrophages activated by LPS increase transcription of ARE-containing
mRNA molecules encoding proinflammatory proteins such as TNF, IL-1β, and IL-6
[130]. Components of the AMD pathway may also associate with the RNA-induced
silencing complex (RISC) to regulate the stability and translation of cytokine transcripts.
RISC can also mediate siRNA–induced mRNA decay and miRNA-induced translational
silencing [129]. miRNA 155, is found to be essential in repressing the expression of IL4, IL-5 and IL-10 in activated T cells [131-132]. All these factors, among others, may
lead to a decrease in IL-17RA and RC in CD14 THP-1 cells.
69
Future studies in
elucidating these possible mechanisms may utilize siRNA and inhibitors of destabilizing
proteins and complexes to study if these are contributing factors to the lack of IL-17RA
protein levels in CD14 THP-1 cells.
In primary cells, there was a dichotomy between the transcript and protein levels.
While the above mechanisms may contribute to the lack of IL-17RA protein observed in
THP-1 cells, the complete abrogation of IL-17RA at 16hr in primary cells compared to a
high level of mRNA expression suggested the possibility of post-translational
mechanisms. IL-6 and TNF-α ELISA showed that cells were still responding to LPS.
Therefore, the decrease in IL-17RA levels is not a result of decreased cell viability at
24hr.
Although it is possible that LPS-induced cytokines such as IL-10 may contribute
to IL-17RA protein downregulation, the decrease of IL-17RA protein levels was shown
to not be specific to LPS. IL-27 and PMA, both inducers of pro-inflammatory cytokine
expression via different mechanisms, also decreased IL-17RA levels.
IL-27 signals
through STAT3 and NF-κB to upregulate proinflammatory cytokines such as IL-6, TNFα and MIP-1 [112], while PMA constitutively activates PKC to induce transcription of
many genes among which are pro-inflammatory cytokines [133]. In the presence of
either two stimuli, IL-17RA protein levels in PBMC exhibited the same downregulation
at 16hr. This suggested that IL-17RA downregulation may be a general response to proinflammatory signals. Therefore, it is possible that IL-17RA levels were decreased due
to negative feedback response as an indirect result of pro-inflammatory cytokines and
70
proteins being upregulated. This decrease in IL-17RA levels is yet to be demonstrated in
vivo during infection. However, decreasing IL-17RA levels may serve as an important
control mechanism to curb the response to IL-17. The data from this section should be
carefully interpreted as the loading control was not equal, therefore IL-17RA levels in
response to these stimuli at 16hr may have been higher than in response to LPS. The
mechanisms for the decrease in IL-17RA levels were investigated in more detail with
further experiments that will be discussed in the next section.
Since IL-17RA must partner with IL-17RC to form a heteromeric receptor to bind
IL-17, low levels of IL-17RC limit the amount of functional receptors. The failure of
LPS to induce IL-17RC levels suggested that supplementary factors may be required in
addition to a pro-inflammatory signal to fully increase IL-17RC levels. These factors
may have effects post-transcriptionally and post-translationally that would lead to more
stable protein and thus, increase protein. Receptors requiring more than one signal are
not novel. For example, CD30 expressed on an activated T cell is a signal transducing
receptor that enhances T cell proliferation in response to CD3 crosslinking [134]. CD30
surface levels are dependent on the presence of CD28 costimulatory signals or IL-4
during T cell activation [134]. Therefore, upregulation of IL-17RC may require the
presence of other cytokines that induce downstream signaling molecules that may
strongly bind Il17rc promoter or stabilize protein product.
It is interesting to note that in PBMC, IL-17RC has a double band compared to a
single band in THP-1 cells. This is also true for IL-17RA, with multiple bands observed
71
in PBMC and monocytes, compared to single weak band from CD14 THP-1 cell lysate.
In the case of IL-17RA, these multiple bands are possibly due to glycosylation. The
relative mobility of IL-17RA on SDS-PAGE is approximately 120kDa protein due to
various N-linked glycosylation modifications[115], which can contribute to multiple
detection of multiples bands. Specific glycosylated IL-17RA isoforms can inducibly
associate with IL-17RC [135]. Therefore, as its partner IL-17RA levels decreased at
16hr, IL-17RC levels remained unchanged due to lack of association. On the other hand,
the cause and effect may be reversed. Multiple weak bands were associated with IL17RC in PBMC, but this phenomenon decreased at 16hr. These bands may be due to IL17RC glycosylation [82]. Since IL-17RA and RC associate, failure of IL-17RC to be
glycosylated may prevent IL-17RA protein to be stably expressed, therefore leading to a
decrease in protein levels in primary cells. This possibility may be explored in the future
by inhibiting glycosylation and observing IL-17RA and RC levels.
The specificity of the antibody to IL-17RC may be tested by knocking down IL17RC through siRNA and using Western blot analysis for IL-17RC analysis. If the
antibody is specific to IL-17RC, the bands observed in Figure 9 would not be expected to
be observed. In addition, a positive control of cells expressing high IL-17RC such as
fibroblasts or cells from the prostate or kidney[136] may be included to verify antibody
specificity.
72
5.3 IL-17R decrease in protein levels
5.3.1 Soluble Isoforms
Two considerations were made in addressing the mechanisms that may be
mediating the decrease of IL-17RA protein levels at16hr: 1) IL-17RA may be cleaved
and secreted, in which case, soluble isoforms of IL-17RA may be detected in the
supernatant, or 2) the receptor was internalized and degraded.
From the IL-17RA ELISA and the Western analysis of proteins concentrated from
supernatant, soluble isoforms of IL-17RA were not detected.
analysis, multiple bands were detected in the supernatant.
In the Western blot
However, the cleaved
extracellular region of IL-17RA is estimated to be around 90kDa, which was not
observed on the membrane. At all time points, bands were observed at 120kDa mark,
which is approximately the size of the IL-17RA. This was not observed in the Media
FCS control lane. This band may be due to the release of full length receptors via
exosome-like vesicles [80]. However, if the decrease in IL-17RA from total cell lysate
was a result of exosomal vesicle release of IL-17RA, we would expect an increase in
protein levels at 16hr.
Instead, the protein level was maintained at similar levels
throughout the LPS time course. This suggests that this is a non-specific band. The
disadvantage of running a SDS-PAGE with supernatant proteins is that control protein
cannot be found. There is no secreted household protein that is expressed at a steady
level with LPS stimulation over 24hr.
73
Soluble cytokine receptors, which can either attenuate or promote cytokine
signaling, are important regulators of inflammation and immunity. They play a key role
in preventing excessive inflammatory responses. One classical example is the autosomal
dominant, TNF receptor-associated periodic syndrome, which is characterized by
mutations in the extracellular domain of the 55-kDa, type I TNFR that impairs receptor
shedding [137]. Viruses also recognize the importance of soluble isoforms by encoding
soluble homologues of mammalian receptors, thereby inhibiting essential cytokines and
evading immunity. For example, poxviruses, such as cowpox, variola, myxoma, and
Shope fibroma viruses, encode TNFR superfamily homologues to prevent TNF signaling
[138].
Soluble cytokine receptors can be generated by several mechanisms. These are
proteolytic cleavage of receptor and release of extracellular portion of receptor or
alternative splicing of mRNA transcripts, both of which are utilized by IL-6R to generate
soluble receptors [80]. They can also be encoded as distinct genes as in the case of
Decoy receptor 3, a TNFR secreted member, that prevents apoptosis by binding to Fas
ligand to inhibit association with Fas [139-140]. Soluble receptors may also be released
in full-length through exosome-like vesicles as exemplified by FasL release from
melanoma cells that promotes apoptosis on Fas-sensitive lymphoid cells resulting in
impaired antitumor responses [141]. Finally, cleavage of GPI-anchored receptors can
also generate soluble receptors as in ciliary neurotrophic factor receptor α which is
74
anchored to cell membranes by a GPI-linkage and released by phosphatidylinositolspecific phospholipase C.
For the IL-17 receptor family, except for IL-17RA, all other IL-17 receptor
subunits have been shown to be alternatively spliced. The double band from IL-17RC
Western blot in PBMC may be due to alternative splicing. IL-17RC has been reported to
have 90 spliced isoforms in a human prostate cancer line [82]. The alternative splicing of
IL-17RC has been shown to create frame-shifts and introduce stop codons that result in
secreted soluble proteins [82]. These soluble proteins are predicted to serve as soluble
decoy receptors. However, these soluble isoforms have yet to be found in vivo, and their
effects confirmed. There is also evidence of alternative splicing of IL-17RE in the EST
database, however their effects are unknown. Alternative transcription start sites are also
observed in the various isoforms of IL-17RD, which produce proteins named IL-17RLM
long and IL-17RLM short.
5.3.2 Receptor degradation
While IL-17RA is not secreted as a soluble isoform, it is not the only explanation
for the decrease in IL-17RA levels at 16hr. To investigate the possibility of receptor
degradation, bafilomycin and chloroquine were used. Drug pretreatment of PBMC and
monocytes increased IL-17RA levels at 16hr compared to LPS treatment alone.
Chloroquine also significantly increased IL-17RA levels in CD14 THP-1 cells, especially
at 16hr. These results together suggest that in the presence of LPS, IL-17RA may
75
undergo receptor internalization followed by degradation to control pro-inflammatory
responses.
In the presence of the drugs alone, chloroquine was more effective than
bafilomycin at increasing levels of IL-17RA. Chloroquine differs from bafilomycin in its
mode of action, and has various uses such as a malarial drug. As a lysophilic weak base,
chloroquine can change cellular pH, thereby affecting various cellular functions.
Chloroquine is also a drug used to treat RA patients. It has been shown to reduce levels
of pro-inflammatory cytokines by blocking TNF-α and IL-6 synthesis in LPS treated
human monocytes [142-143]. Jang et al, showed that chloroquine inhibited TNF-α
maturation mainly by blocking cleavage of cell-associated 26-kDa TNF-α precursor to
the soluble active 17-kDa mature form [122].
Thus, the reason chloroquine had a
stronger effect on increasing IL-17RA levels may be because it was preventing more than
protein degradation.
Furthermore, chloroquine was shown to inhibit LPS-induced
activation of ERK in human PBMCs, thereby blocking transcription of the TNF-α gene.
IL-1β and IL-6 production were also shown to decrease in the presence of chloroquine,
resulting from decreased transcript stability [122]. Similarly, the presence of chloroquine
may prevent post-transcriptional modifications that may lead to increased instability of
Il17ra transcript levels.
Untreated cells collected at 0, 4, and 16 hr showed no difference in IL-17RA
levels (Figure 12). This suggests that the change in IL-17RA levels during LPS treatment
is not an artifact; rather it is a true response towards LPS. In the presence of the drug
76
alone, the basal level of IL-17RA did not increase over the 16hr treatment. This suggests
that receptor degradation is induced only in the presence of LPS.
Chloroquine pretreatment for 2hr or overnight did not appear to make a difference
in increasing IL-17RA levels, except that longer incubation negatively impacted cell
viability. Pretreatment of chloroquine yielded the greatest increase in IL-17RA levels
compared to bafilomycin, which maintained levels at 16hr relative to 4hr with
simultaneous incubation with LPS and pretreatment. Bafilomycin effect on IL-17RA
levels at 16hr was more pronounced in monocytes than in PBMC. For monocytes, the
primary responder to IL-17, receptor degradation is one way to downregulate IL-17RA.
This cellular response is crucial in controlling inflammatory response.
Long incubations of either drug at high concentrations led to cell death as
reflected by a decrease in hsp90. This is normal in that long incubations with these drugs
interfere with regular cellular machinery such as recycling, degradation and other pH
dependent activities necessary for cellular homeostasis.
5.3.3 Ubiquitination and signaling
Changes in IL-17RA levels may also be driven by ubiquitination. IL-17RA has
been shown to be ubiquitinated via TRAF upon IL-17F binding[91]. While Rong et al,
showed ubiquitination as a positive regulator of signaling of IL-17F[91], protein
recycling and degradation through ubiquitination remains a possibility to be explored.
Ubiquitination, while known for protein degradation, is also utilized in cell signaling.
77
Ubiquitination can lead to activation of downstream signaling molecules such as protein
kinases [144]. For example, IL-1R activation leads to the recruitment of TRAF6, which
acts as E3 ligase that activates TGF-beta activated-kinase (TAK1), which in turn
phosphorylates Ikkb. Activated Ikk phosphorylates IkB inhibitory proteins, resulting in
their ubiquitination and subsequent degradation by the proteasome. As a result, NF-kB is
liberated to enter the nucleus to induce target gene expression. TRAF-mediated
polyubiquitination is crucial in the activation of TAK1 and IKK by multiple signaling
pathways, such as those downstream of TNFR, IL-1R, and TCR [144]. Therefore, with
IL-17RA, ubiquitination may play a role both as a positive contributor in signaling
through recruitment of adaptor proteins, and by marking downstream inhibitory proteins
such as Ikkb for degradation to release NF-κB for binding to the promoter, and also
possibly as a negative regulator in marking IL-17RA for degradation.
5.3.4 Therapeutic uses of soluble IL-17R
While detection of in vivo soluble isoforms of IL-17RA is yet to be found, soluble
isoforms of IL-17RA and RC have been designed in laboratories as a means to study the
therapeutic effects of blocking IL-17 signaling. Soluble IL‑17R subunits, such as fusions
to IgG Fc, have already been evaluated in pre‑clinical models [145-146]. The fusion
proteins involve the extracellular region of IL-17RA fused to the Fc portion of the IgG.
Rats with arthritis injected with IL-17R IgG-Fc fusion protein, show reduction in joint
inflammation and bone erosion[145].
Currently, there are already drugs in place using
78
soluble receptors to antagonize ligand effects in order to reduce inflammation. TNF is
another cytokine involved in chronic inflammation and autoimmune diseases such as RA
and MS [147]. Etanercept, generically known as Enbrel, is a recombinant TNF blocker
made from fusing two soluble human 75-kDa TNF receptors to IgG-Fc. Etanercept has
shown a beneficial effect in many clinical conditions including RA, psoriasis, and
ankylosing spondilitis[147]. Abatacept is another soluble fusion protein that consists of
the extracellular domain of human cytotoxic T lymphocyte-associated antigen 4 linked to
the modified IgG Fc portion [147]. The drug blocks costimulatory signals between
antigen-presenting cells and T cells in RA patients.
Another way to inhibit IL-17RA activation is by preventing receptor assembly by
means of soluble peptides containing the pre‑ligand assembly domain (PLAD) of
IL‑17RA [148]. PLAD binding to IL-17RA subunit prevents association with other
receptor subunit to form a functional and signaling receptor. This approach is another
possible avenue for drug development, similar to approaches used with TNFR signaling.
However, receptors not only induce signaling but may be involved in negative
feedback that inhibits cytokine production. Smith et al, shows that IL-17A treatment can
actually inhibit the expansion of IL-17A-producing T cells in mice through a “short-loop”
negative feedback mediated by the IL-17R[149].
In IL-17R deficient mice, systemic
levels of IL-17A and tissue expression of IL-17A were elevated [149]. This finding then
questions the usefulness of anti-IL-17R therapies for autoimmune disease because such
therapies may lead to unwanted expansion of IL-17A producing T cells.
79
Taken together, blocking IL-17R may appear to be an effective way of preventing
IL-17 mediated chronic inflammation.
However, caution must be taken to prevent
adverse affects such as allowing for expansion of IL-17 by interfering with a naturally
occurring feedback loop that needs to be better elucidated. Better understanding of IL17R members and their roles in activation and possibly decreasing levels of IL-17 will
provide for clearer targets for inhibitors.
Furthermore, defining downstream signal
transduction in cells such as monocytes, the main mediators of inflammation, and cells
that IL-17 actively recruits, will also allow for drug therapeutics to block for specific
intracellular pathways.
80
Conclusion and Future Directions:
Control of IL-17R expression at the transcript and protein levels in monocytes are
crucial in limiting response to IL-17, a potent inducer of inflammation. Decreased IL17R protein levels in response to LPS stimulation has not been described before in the
literature. Since both IL-17RA and RC are required to form functional receptor to bind
IL-17, the decrease in IL-17RA prevents formation of a functional receptor.
This
prevents an over response to IL-17, as IL-17 is involved in multiple chronic inflammatory
diseases where this level of control may be lost. Figure 17 summarizes the findings.
Receptor internalization and degradation is one way by which cells can decrease IL17RA protein in monocytes. However, there are other mechanisms such as secretion of
soluble isoforms and ubiquitination, which may be also at work. Receptor degradation
may be a general cellular response to activation by LPS to control further signaling that
could lead to overexpression of pro-inflammatory cytokines.
Future experiments
designed to better elucidate IL-17RA regulation in monocytes should target posttranscriptional modifications, and investigate the role of glycosylation of IL-17RA and
RC in receptor activity. The findings of this project have important physiological
relevance in that receptor turnover keep the immune response in balances even as cells
upregulate pro-inflammatory cytokines in response to pathogens.
81
Figure 17: Model system of IL-17 receptor regulation. 1) LPS signals through TLR4 and
CD14 to induce signaling (2), leading to upregulation of pro-inflammatory cytokines (3).
4) IL-17RA undergoes receptor internalization, though it is not known whether it is
through the direct effect of LPS signaling or the indirect effect of pro-inflammatory
cytokines upregulated as a result. Vesicles transporting IL-17RA fuse with lysosome,
leading to protein degradation. 5) IL-17RA and IL-17RC transcripts are also
upregulated, either as direct or indirect result of LPS signaling. These transcripts are
subject to post-transcriptional and post-translational modifications.
82
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Coffman, R.L. and J. Carty, A T cell activity that enhances polyclonal IgE production
and its inhibition by interferon-gamma. J Immunol, 1986. 136(3): p. 949-54.
Mosmann, T.R., et al., Two types of murine helper T cell clone. I. Definition according to
profiles of lymphokine activities and secreted proteins. J Immunol, 1986. 136(7): p. 234857.
Romagnani, S., The Th1/Th2 paradigm. Immunology Today, 1997. 18(6): p. 263-266.
Diaconu, C.C., et al., Plasticity of regulatory T cells under cytokine pressure. Roum Arch
Microbiol Immunol, 2010. 69(4): p. 190-6.
Rouvier, E., et al., CTLA-8, cloned from an activated T cell, bearing AU-rich messenger
RNA instability sequences, and homologous to a herpesvirus saimiri gene. J Immunol,
1993. 150(12): p. 5445-56.
Yao, Z., et al., Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel
cytokine receptor. Immunity, 1995. 3(6): p. 811-821.
Gaffen, S.L., Structure and signalling in the IL-17 receptor family. Nat Rev Immunol,
2009. 9(8): p. 556-67.
Fossiez, F., et al., T cell interleukin-17 induces stromal cells to produce proinflammatory
and hematopoietic cytokines. J Exp Med, 1996. 183(6): p. 2593-2603
Kennedy, J., et al., Mouse IL-17: a cytokine preferentially expressed by alpha beta TCR
+ CD4-CD8-T cells. Journal of Interferon & Cytokine Research, 1996. 16(8): p. 611-7.
Compston, A. and A. Coles, Multiple sclerosis. Lancet, 2002. 359(9313): p. 1221-1231.
Balashov, K.E., et al., Seasonal variation of interferon-gamma production in progressive
multiple sclerosis. Ann Neurol, 1998. 44(5): p. 824-8.
Issazadeh, S., et al., Interferon gamma, interleukin 4 and transforming growth factor beta
in experimental autoimmune encephalomyelitis in Lewis rats: dynamics of cellular mRNA
expression in the central nervous system and lymphoid cells. J Neurosci Res, 1995. 40(5):
p. 579-90.
Karni, A., et al., IL-18 is linked to raised IFN-[gamma] in multiple sclerosis and is
induced by activated CD4+ T cells via CD40-CD40 ligand interactions. J
Neuroimmunol, 2002. 125(1-2): p. 134-140.
Segal, B.M., B.K. Dwyer, and E.M. Shevach, An interleukin (IL)-10/IL-12
immunoregulatory circuit controls susceptibility to autoimmune disease. J Exp Med,
1998. 187(4): p. 537-546.
Cua, D.J., et al., Interleukin-23 rather than interleukin-12 is the critical cytokine for
autoimmune inflammation of the brain. Nature, 2003. 421(6924): p. 744-8.
Billiau, A., et al., Enhancement of experimental allergic encephalomyelitis in mice by
antibodies against IFN-gamma. J Immunol, 1988. 140(5): p. 1506-10.
Ferber, I.A., et al., Mice with a disrupted IFN-gamma gene are susceptible to the
induction of experimental autoimmune encephalomyelitis (EAE). J Immunol, 1996.
156(1): p. 5-7.
Krakowski, M. and T. Owens, Interferon- confers resistance to experimental allergic
encephalomyelitis. Eur J Immunol, 1996. 26(7): p. 1641-6.
Voorthuis, J., et al., Suppression of experimental allergic encephalomyelitis by
intraventricular administration of interferon-gamma in Lewis rats. Clin Exp Immunol,
1990. 81(2): p. 183-8.
83
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
Zhang, G.X., et al., Induction of experimental autoimmune encephalomyelitis in IL-12
receptor-beta 2-deficient mice: IL-12 responsiveness is not required in the pathogenesis
of inflammatory demyelination in the central nervous system. J Immunol, 2003. 170(4): p.
2153-60.
Oppmann, B., et al., Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with
biological activities similar as well as distinct from IL-12. Immunity, 2000. 13(5): p. 71525.
Langrish, C.L., et al., IL-23 drives a pathogenic T cell population that induces
autoimmune inflammation. J Exp Med, 2005. 201(2): p. 233-40.
Park, H., et al., A distinct lineage of CD4 T cells regulates tissue inflammation by
producing interleukin 17. Nat Immunol, 2005. 6(11): p. 1133-41.
Lee, J., et al., IL-17E, a Novel Proinflammatory Ligand for the IL-17 Receptor Homolog
IL-17Rh1. J Biol Chem, 2001. 276(2): p. 1660-1664.
Li, H., et al., Cloning and characterization of IL-17B and IL-17C, two new members of
the IL-17 cytokine family. Proc. Natl. Acad. Sci. U. S. A., 2000. 97(2): p. 773-778
Hymowitz, S., et al., IL-17s adopt a cystine knot fold: structure and activity of a novel
cytokine, IL-17F, and implications for receptor binding. The EMBO Journal, 2001.
20(19): p. 5332-5341
Korn, T., et al., IL-17 and Th17 Cells. Annu Rev Immunol, 2009. 27: p. 485-517.
Aggarwal, S. and A.L. Gurney, IL-17: prototype member of an emerging cytokine family.
J Leukoc Biol, 2002. 71(1): p. 1-8.
Wright, J.F., et al., Identification of an interleukin 17F/17A heterodimer in activated
human CD4+ T cells. J Biol Chem, 2007. 282(18): p. 13447-55.
Yang, X., et al., Regulation of inflammatory responses by IL-17F. J Exp Med, 2008.
205(5): p. 1063-75.
Ishigame, H., et al., Differential roles of interleukin-17A and -17F in host defense against
mucoepithelial bacterial infection and allergic responses. Immunity, 2009. 30(1): p. 10819.
Aarvak, T., et al., IL-17 Is Produced by Some Proinflammatory Th1/Th0 Cells But Not by
Th2 Cells. J Immunol, 1999. 162(3): p. 1246-1251.
Starnes, T., et al., Cutting edge: IL-17F, a novel cytokine selectively expressed in
activated T cells and monocytes, regulates angiogenesis and endothelial cell cytokine
production. J Immunol, 2001. 167(8): p. 4137-4140.
Yamaguchi, Y., et al., IL-17B and IL-17C are associated with TNF-alpha production and
contribute to the exacerbation of inflammatory arthritis. J Immunol, 2007. 179(10): p.
7128-36.
Conti, H.R., et al., Th17 cells and IL-17 receptor signaling are essential for mucosal host
defense against oral candidiasis. J Exp Med, 2009. 206(2): p. 299-311.
Uhlig, H.H., et al., Differential activity of IL-12 and IL-23 in mucosal and systemic innate
immune pathology. Immunity, 2006. 25(2): p. 309-18.
Cua, D.J. and C.M. Tato, Innate IL-17-producing cells: the sentinels of the immune
system. Nat Rev Immunol, 2010. 10(7): p. 479-89.
Korn, T., et al., IL-21 initiates an alternative pathway to induce proinflammatory TH17
cells. Nature, 2007. 448(7152): p. 484-487.
McGeachy, M.J. and D.J. Cua, Th17 cell differentiation: the long and winding road.
Immunity, 2008. 28(4): p. 445-53.
84
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
Veldhoen, M., et al., TGF [beta] in the context of an inflammatory cytokine milieu
supports de novo differentiation of IL-17-producing T cells. Immunity, 2006. 24(2): p.
179-189.
Grajewski, R.S., et al., Activation of invariant NKT cells ameliorates experimental ocular
autoimmunity by a mechanism involving innate IFN-gamma production and dampening
of the adaptive Th1 and Th17 responses. J Immunol, 2008. 181(7): p. 4791-7.
Yoshiga, Y., et al., Invariant NKT cells produce IL-17 through IL-23-dependent and independent pathways with potential modulation of Th17 response in collagen-induced
arthritis. Int J Mol Med, 2008. 22(3): p. 369-74.
Martin, B., et al., Interleukin-17-producing gammadelta T cells selectively expand in
response to pathogen products and environmental signals. Immunity, 2009. 31(2): p.
321-30.
Rachitskaya, A.V., et al., Cutting edge: NKT cells constitutively express IL-23 receptor
and RORgammat and rapidly produce IL-17 upon receptor ligation in an IL-6independent fashion. J Immunol, 2008. 180(8): p. 5167-71.
Sutton, C.E., et al., Interleukin-1 and IL-23 induce innate IL-17 production from
gammadelta T cells, amplifying Th17 responses and autoimmunity. Immunity, 2009.
31(2): p. 331-41.
Ribot, J.C., et al., CD27 is a thymic determinant of the balance between interferongamma- and interleukin 17-producing gammadelta T cell subsets. Nat Immunol, 2009.
10(4): p. 427-36.
Umemura, M., et al., IL-17-mediated regulation of innate and acquired immune response
against pulmonary Mycobacterium bovis bacille Calmette-Guerin infection. J Immunol,
2007. 178(6): p. 3786-96.
Jovanovic, D., et al., IL-17 stimulates the production and expression of proinflammatory
cytokines, IL-{beta} and TNF-{alpha}, by human macrophages. J Immunol, 1998.
160(7): p. 3513- 3521.
Rahman, M., et al., IL-17R activation of human airway smooth muscle cells induces
CXCL-8 production via a transcriptional-dependent mechanism. Clin Immunol, 2005.
115(3): p. 268-276.
Laan, M., et al., IL-17-induced cytokine release in human bronchial epithelial cells in
vitro: role of mitogen-activated protein (MAP) kinases. Bri J Pharmacol, 2001. 133(1): p.
200-206.
Cai, X.Y., et al., Regulation of granulocyte colony-stimulating factor gene expression by
interleukin-17. Immunol Lett, 1998. 62(1): p. 51-8.
Witowski, J., et al., IL-17 stimulates intraperitoneal neutrophil infiltration through the
release of GRO {alpha} chemokine from mesothelial cells. J Immunol, 2000. 165(10): p.
5814-5821.
Schwarzenberger, P., et al., Requirement of endogenous stem cell factor and granulocytecolony-stimulating factor for IL-17-mediated granulopoiesis. J Immunol, 2000. 164(9): p.
4783- 4789.
Woltman, A.M., et al., Interleukin-17 and CD40-ligand synergistically enhance cytokine
and chemokine production by renal epithelial cells. J Am Soc Nephrol, 2000. 11(11): p.
2044-55.
85
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
Ye, P., et al., Requirement of interleukin 17 receptor signaling for lung CXC chemokine
and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host
defense. J Exp Med, 2001. 194(4): p. 519-27.
Huang, W., et al., Requirement of interleukin-17A for systemic anti-Candida albicans
host defense in mice. J Infect Dis, 2004. 190(3): p. 624-631.
Kelly, M., et al., Interleukin-17/interleukin-17 receptor-mediated signaling is important
for generation of an optimal polymorphonuclear response against Toxoplasma gondii
infection. Infect Immun, 2005. 73(1): p. 617-621.
Gaffen, S.L., Structure and signalling in the IL-17 receptor family. Nat Rev Immunol,
2009. 9(8): p. 556-67.
Yao, Z., et al., Molecular characterization of the human interleukin (IL)-17 receptor.
Cytokine, 1997. 9(11): p. 794-800.
Kramer, J.M., et al., Cutting edge: identification of a pre-ligand assembly domain
(PLAD) and ligand binding site in the IL-17 receptor. J Immunol, 2007. 179(10): p.
6379-83.
Toy, D., et al., Cutting edge: interleukin 17 signals through a heteromeric receptor
complex. J Immunol, 2006. 177(1): p. 36-9.
Aggarwal, S. and A. Gurney, IL-17: prototype member of an emerging cytokine family. J
Leukoc Biol, 2002. 71(1): p. 1-8
O'Quinn, D., et al., Emergence of the Th17 pathway and its role in host defense. Adv
Immunol, 2008. 99: p. 115-163.
Gaffen, S.L., An overview of IL-17 function and signaling. Cytokine, 2008. 43(3): p. 4027.
Qian, Y., et al., The adaptor Act1 is required for interleukin 17-dependent signaling
associated with autoimmune and inflammatory disease. Nat Immunol, 2007. 8(3): p.
247-256.
Maitra, A., et al., Distinct functional motifs within the IL-17 receptor regulate signal
transduction and target gene expression. Proc. Natl. Acad. Sci, 2007. 104(18): p. 750611.
Novatchkova, M., et al., The STIR-domain superfamily in signal transduction,
development and immunity. Trends Biochem Sci 2003. 28(5): p. 226-9.
Toshchakov, V.Y. and S.N. Vogel, Cell-penetrating TIR BB loop decoy peptides a novel
class of TLR signaling inhibitors and a tool to study topology of TIR-TIR interactions.
Expert Opin Biol Ther, 2007. 7(7): p. 1035-50.
Shen, F. and S.L. Gaffen, Structure-function relationships in the IL-17 receptor:
implications for signal transduction and therapy. Cytokine, 2008. 41(2): p. 92-104.
Dong, C., Regulation and pro-inflammatory function of interleukin-17 family cytokines.
Immunol Rev 2008. 226: p. 80-6.
Shen, F., et al., IL-17 Receptor Signaling Inhibits C/EBP{beta} by Sequential
Phosphorylation of the Regulatory 2 Domain. Sci Signal, 2009. 2(59): p. ra8.
Hartupee, J., et al., IL-17 Signaling for mRNA Stabilization Does Not Require TNF
Receptor-Associated Factor 6. J Immunol, 2009. 182(3): p. 1660-1666.
Schwandner, R., K. Yamaguchi, and Z. Cao, Requirement of tumor necrosis factor
receptor-associated factor (TRAF)6 in interleukin 17 signal transduction. J Exp Med,
2000. 191(7): p. 1233-40.
86
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
Ruddy, M., et al., Functional cooperation between interleukin-17 and tumor necrosis
factor-{alpha} is mediated by CCAAT/enhancer-binding protein family members. J Biol
Chem, 2004. 279(4): p. 2559-2567.
Dipak, P. and F. Pelagia, CCAAT/enhancer-binding proteins: structure, function and
regulation. Biochem J, 2002. 365: p. 561-575.
Shen, F., et al., Cytokines link osteoblasts and inflammation: microarray analysis of
interleukin-17- and TNF-alpha-induced genes in bone cells. J Leukoc Biol, 2005. 77(3):
p. 388-99.
Zeng, R., et al., Synergy of IL-21 and IL-15 in regulating CD8+ T cell expansion and
function. J Exp Med, 2005. 201(1): p. 139-148.
Lindemann, M.J., et al., Differential Regulation of the IL-17 Receptor by γc Cytokines. J
Biol Chem, 2008. 283(20): p. 14100-14108.
Althoff, K., et al., Shedding of interleukin-6 receptor and tumor necrosis factor alpha.
Contribution of the stalk sequence to the cleavage pattern of transmembrane proteins.
Eur J Biochem, 2000. 267(9): p. 2624-31.
Levine, S.J., Mechanisms of soluble cytokine receptor generation. J Immunol, 2004.
173(9): p. 5343-8.
Jostock, T., et al., Soluble gp130 is the natural inhibitor of soluble interleukin 6 receptor
transsignaling responses. Eur J Biol Chem, 2001. 268(1): p. 160-167.
Haudenschild, D., et al., Soluble and transmembrane isoforms of novel interleukin-17
receptor-like protein by RNA splicing and expression in prostate cancer. J Biol Chem,
2002. 277(6): p. 4309-16.
Lei, J.T. and M. Martinez-Moczygemba, Separate endocytic pathways regulate IL-5
receptor internalization and signaling. J Leuokoc Biol, 2008. 84(2): p. 499-509.
Di Guglielmo, G.M., et al., Distinct endocytic pathways regulate TGF-beta receptor
signalling and turnover. Nat Cell Biol, 2003. 5(5): p. 410-21.
Lamaze, C., et al., Interleukin 2 receptors and detergent-resistant membrane domains
define a clathrin-independent endocytic pathway. Mol Cell, 2001. 7(3): p. 661-71.
Le Roy, C. and J.L. Wrana, Clathrin- and non-clathrin-mediated endocytic regulation of
cell signalling. Nat Rev Mol Cell Biol, 2005. 6(2): p. 112-26.
Ciak, J. and F.E. Hahn, Chloroquine: mode of action. Science, 1966. 151(708): p. 347-9.
Harada, M., et al., Bafilomycin A1, a specific inhibitor of vacuolar-type H+-ATPases,
inhibits the receptor-mediated endocytosis of asialoglycoproteins in isolated rat
hepatocytes. J Hepatol, 1996. 24(5): p. 594-603.
Donaldson, J.G. and N. Segev, Regulation and coordination of intracellular trafficking:
an overview. Trafficking Inside Cells: Pathways, Mechanisms and Regulation.
Austin/New York: Landes Bioscience/Springer Science+ Business Media, 2009: p. 329–
41.
Clague, M.J. and S. Urbe, Ubiquitin: same molecule, different degradation pathways.
Cell, 2010. 143(5): p. 682-5.
Rong, Z., et al., Interleukin-17F signaling requires ubiquitination of interleukin-17
receptor via TRAF6. Cell Signal, 2007. 19(7): p. 1514-20.
Dubin, P. and J. Kolls, IL-23 mediates inflammatory responses to mucoid Pseudomonas
aeruginosa lung infection in mice. Am J Physiol Lung Cell Mol Physiol, 2007. 292(2): p.
L519- 528.
87
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
Romani, L., et al., Defective tryptophan catabolism underlies inflammation in mouse
chronic granulomatous disease. Nature, 2008. 451(7175): p. 211-215.
Korn, T., et al., IL-17 and Th17 Cells. Annu Rev Immunol, 2009. 27: p. 485-517.
Vignola, A.M., et al., Evaluation of apoptosis of eosinophils, macrophages, and T
lymphocytes in mucosal biopsy specimens of patients with asthma and chronic bronchitis.
J Allergy Clin Immunol, 1999. 103(4): p. 563-73.
Mangan, D. and S. Wahl, Differential regulation of human monocyte programmed cell
death (apoptosis) by chemotactic factors and pro-inflammatory cytokines. J Immunol,
1991. 147(10): p. 3408-3412.
Sergejeva, S., et al., Interleukin-17 as a recruitment and survival factor for airway
macrophages in allergic airway inflammation. Am J Respir Cell Mol Biol, 2005. 33(3):
p. 248-53.
Shahrara, S., et al., IL-17 induces monocyte migration in rheumatoid arthritis. J
Immunol, 2009. 182(6): p. 3884-91.
Honorati, M.C., et al., High in vivo expression of interleukin-17 receptor in synovial
endothelial cells and chondrocytes from arthritis patients. Rheumatology (Oxford), 2001.
40(5): p. 522-7.
Jovanovic, D.V., et al., Stimulation of 92-kd gelatinase (matrix metalloproteinase 9)
production by interleukin-17 in human monocyte/macrophages: a possible role in
rheumatoid arthritis. Arthritis Rheum, 2000. 43(5): p. 1134-44.
Hunt, P.W., Th17, gut, and HIV: therapeutic implications. Curr Opin HIV AIDS, 2010.
5(2): p. 189-93.
Maek, A.N.W., et al., Increased interleukin-17 production both in helper T cell subset
Th17 and CD4-negative T cells in human immunodeficiency virus infection. Viral
Immunol, 2007. 20(1): p. 66-75.
Ndhlovu, L.C., et al., Suppression of HIV-1 plasma viral load below detection preserves
IL-17 producing T cells in HIV-1 infection. AIDS, 2008. 22(8): p. 990-2.
Yue, F.Y., et al., Viral specific IL-17 producing CD4+ T cells are detectable in early
HIV-1 infection. J Virol, 2008. 82(13): p. 6767–6771.
Griffin, G.E., et al., Activation of HIV gene expression during monocyte differentiation by
induction of NF-kB. Nature, 1989. 339(6219): p. 70-73.
Garcia-Zepeda, E., et al., Human monocyte chemoattractant protein (MCP)-4 is a novel
CC chemokine with activities on monocytes, eosinophils, and basophils induced in
allergic and nonallergic inflammation that signals through the CC chemokine receptors
(CCR)-2 and-3. J Immunol, 1996. 157(12): p. 5613-26.
Witko-Sarsat, V., et al., Neutrophils: molecules, functions and pathophysiological
aspects. Laboratory investigation, 2000. 80(5): p. 617-653.
Guha, M. and N. Mackman, LPS induction of gene expression in human monocytes. Cell
Signal, 2001. 13(2): p. 85-94.
Ma, W., et al., The p38 mitogen-activated kinase pathway regulates the human
interleukin-10 promoter via the activation of Sp1 transcription factor in
lipopolysaccharide-stimulated human macrophages. J Biol Chem, 2001. 276(17): p.
13664-74.
Lee, S.M., et al., The regulation and biological activity of interleukin 12. Leuk
Lymphoma, 1998. 29(5-6): p. 427-38.
88
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
Liu, D.-f., W. Wei, and L.-h. Song, Upregulation of TNF-[alpha] and IL-6 mRNA in
mouse liver induced by bacille Calmette-Guerin plus lipopolysaccharide. Acta Pharmacol
Sin, 2006. 27(4): p. 460-468.
Guzzo, C., N.F. Che Mat, and K. Gee, Interleukin-27 induces a STAT1/3- and NFkappaB-dependent proinflammatory cytokine profile in human monocytes. J Biol Chem,
2010. 285(32): p. 24404-11.
Reibman, J., et al., Regulation of Expression of Granulocyte-Macrophage ColonyStimulating Factor in Human Bronchial Epithelial Cells: Roles of Protein Kinase C and
Mitogen-Activated Protein Kinases. J Immunol, 2000. 165(3): p. 1618-1625.
Dunne, A. and L. O'Neill, The interleukin-1 receptor/Toll-like receptor superfamily:
signal transduction during inflammation and host defense. Sci STKE, 2003. 2003(171):
p. re3.
Gaffen, S.L., et al., The IL-17 cytokine family. Vitam Horm, 2006. 74: p. 255-82.
De Bruyn, C., et al., Modulation of human cord blood progenitor cell growth by
recombinant human interleukin 3 (IL-3), IL-6, granulocyte-macrophage colony
stimulating factor (GM-CSF) and stem cell factor (SCF) in serum-supplemented and
serum-free medium. Stem Cells, 1994. 12(6): p. 616-625.
Van Grol, J., et al., HIV-1 Inhibits Autophagy in Bystander Macrophage/Monocytic Cells
through Src-Akt and STAT3. PLoS One, 2010. 5(7): p. e11733.
Heinzelmann, M., et al., Endocytosis of heparin-binding protein (CAP37) is essential for
the enhancement of lipopolysaccharide-induced TNF-alpha production in human
monocytes. J Immunol, 1999. 162(7): p. 4240-5.
Tveten, K., et al., The effect of bafilomycin A1 and protease inhibitors on the degradation
and recycling of a Class 5-mutant LDLR. Acta Biochim Biophys Sin, 2009. 41(3): p.
246-255.
Farina, c., et al., V-atpase inhibitors for use in the treatment of septic shock. 2007, WO
Patent WO/2007/048,848.
Scala, G. and J. Oppenheim, Antigen presentation by human monocytes: evidence for
stimulant processing and requirement for interleukin 1. J Immunol, 1983. 131(3): p.
1160-1166.
Jang, C.H., et al., Chloroquine inhibits production of TNF-alpha, IL-1beta and IL-6 from
lipopolysaccharide-stimulated human monocytes/macrophages by different modes.
Rheumatology (Oxford), 2006. 45(6): p. 703-10.
Kitchens, R.L., Role of CD14 in cellular recognition of bacterial lipopolysaccharides.
Chem Immunol, 2000. 74: p. 61-82.
Dentener, M., et al., Involvement of CD14 in lipopolysaccharide-induced tumor necrosis
factor-alpha, IL-6 and IL-8 release by human monocytes and alveolar macrophages. J
Immunol, 1993. 150(7): p. 2885-91.
Ladisch, S., et al., Modulation of the immune response by gangliosides. Inhibition of
adherent monocyte accessory function in vitro. J Clin Invest, 1984. 74(6): p. 2074-81.
Kamphuis, S., et al., Tolerogenic immune responses to novel T-cell epitopes from heatshock protein 60 in juvenile idiopathic arthritis. Lancet, 2005. 366(9479): p. 50-56.
Gee, K., et al., Differential regulation of CD44 expression by lipopolysaccharide (LPS)
and TNF-alpha in human monocytic cells: distinct involvement of c-Jun N-terminal
kinase in LPS-induced CD44 expression. J Immunol, 2002. 169(10): p. 5660-72.
89
128.
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
Day, D. and M. Tuite, Post-transcriptional gene regulatory mechanisms in eukaryotes:
an overview. J Endocrinol, 1998. 157(3): p. 361-71.
Anderson, P., Post-transcriptional control of cytokine production. Nat Immunol, 2008.
9(4): p. 353-9.
Stoecklin, G. and P. Anderson, Posttranscriptional mechanisms regulating the
inflammatory response. Adv Immunol, 2006. 89: p. 1-37.
O'Connell, R.M., et al., MicroRNA-155 is induced during the macrophage inflammatory
response. Proc. Natl. Acad. Sci, 2007. 104(5): p. 1604-9.
Rodriguez, A., et al., Requirement of bic/microRNA-155 for normal immune function.
Science, 2007. 316(5824): p. 608-11.
Kurosaka, K., N. Watanabe, and Y. Kobayashi, Production of proinflammatory cytokines
by phorbol myristate acetate-treated THP-1 cells and monocyte-derived macrophages
after phagocytosis of apoptotic CTLL-2 cells. J Immunol, 1998. 161(11): p. 6245-9.
Gilfillan, M.C., et al., Expression of the Costimulatory Receptor CD30 Is Regulated by
Both CD28 and Cytokines. J Immunol, 1998. 160(5): p. 2180-2187.
Ho, A.W., et al., IL-17RC Is Required for Immune Signaling via an Extended SEF/IL-17R
Signaling Domain in the Cytoplasmic Tail. J Immunol, 2010. 185(2): p. 1063-1070.
Ho, A.W. and S.L. Gaffen, IL-17RC: a partner in IL-17 signaling and beyond. Semin
Immunopathol, 2010. 32(1): p. 33-42.
Hull, K.M., et al., The TNF receptor-associated periodic syndrome (TRAPS): emerging
concepts of an autoinflammatory disorder. Medicine, 2002. 81(5): p. 349-68.
Cunnion, K.M., Tumor necrosis factor receptors encoded by poxviruses. Mol Genet
Metab, 1999. 67(4): p. 278-82.
Pitti, R.M., et al., Genomic amplification of a decoy receptor for Fas ligand in lung and
colon cancer. Nature, 1998. 396(6712): p. 699-703.
Sung, H.H., et al., Transgenic expression of decoy receptor 3 protects islets from
spontaneous and chemical-induced autoimmune destruction in nonobese diabetic mice. J
Exp Med, 2004. 199(8): p. 1143-51.
Andreola, G., et al., Induction of lymphocyte apoptosis by tumor cell secretion of FasLbearing microvesicles. J Exp Med, 2002. 195(10): p. 1303-16.
van den Borne, B.E., et al., Chloroquine and hydroxychloroquine equally affect tumor
necrosis factor-alpha, interleukin 6, and interferon-gamma production by peripheral
blood mononuclear cells. J Rheumatol, 1997. 24(1): p. 55-60.
Picot, S., et al., Chloroquine-induced inhibition of the production of TNF, but not of IL-6,
is affected by disruption of iron metabolism. Immunology, 1993. 80(1): p. 127-33.
Chen, Z.J. and L.J. Sun, Nonproteolytic functions of ubiquitin in cell signaling. Mol Cell,
2009. 33(3): p. 275-86.
Bush, K.A., et al., Reduction of joint inflammation and bone erosion in rat adjuvant
arthritis by treatment with interleukin-17 receptor IgG1 Fc fusion protein. Arthritis
Rheum, 2002. 46(3): p. 802-5.
Lubberts, E., IL-17/Th17 targeting: on the road to prevent chronic destructive arthritis?
Cytokine, 2008. 41(2): p. 84-91.
Kassiotis, G. and G. Kollias, TNF and receptors in organ-specific autoimmune disease:
multi-layered functioning mirrored in animal models. J Clin Invest, 2001. 107(12): p.
1507-8.
90
148.
149.
Deng, G.M., et al., Amelioration of inflammatory arthritis by targeting the pre-ligand
assembly domain of tumor necrosis factor receptors. Nat Med, 2005. 11(10): p. 10661072.
Smith, E., et al., IL-17A inhibits the expansion of IL-17A-producing T cells in mice
through "short-loop" inhibition via IL-17 receptor. J Immunol, 2008. 181(2): p. 1357-64.
91
Appendix
92
Co-authored publications:
1. Che Mat NF, Zhang X, Guzzo C, Gee K. Interleukin-23-induced interleukin-23
receptor subunit expression is mediated by the janus kinase/signal transducer and
activation of transcription pathway in human CD4 T cells. J Interferon Cytokine
Res, 2011. 31(4):363-71
For this paper, I did RT-PCR and Western blot analysis that confirmed the
induction of IL-23 receptors in response to IL-23, and Western blot analysis that
showed phosphorylation of STAT3 in response to IL-23.
2. Guzzo C, Che Mat NF, Zhang X, Gee K. HIV Infection. Impact of HIV infection
and HAART therapy on CD4 T helper cell subset expression and function.2011.
InTech. In press.
For this book chapter, I wrote the section on IL-17/Th17 role in HIV infection.
93
JOURNAL OF INTERFERON & CYTOKINE RESEARCH
Volume 31, Number 4, 2011
ª Mary Ann Liebert, Inc.
DOI: 10.1089/jir.2010.0083
Interleukin-23-Induced Interleukin-23 Receptor Subunit
Expression Is Mediated by the Janus Kinase/Signal
Transducer and Activation of Transcription Pathway
in Human CD4 T Cells
Nor Fazila Che Mat, Xiubo Zhang, Christina Guzzo, and Katrina Gee
Interleukin (IL)-23 plays a critical role in the development of the T helper (Th) cell response and is responsible for
the maintenance of the IL-17 producing subset of Th cells, Th17. IL-23 is a heterodimeric cytokine composed of
IL-23p19 and IL-12p40 subunits, and the signaling pathway for IL-23 involves 2 receptor chains: IL-12Rb1 and
IL-23Ra. The IL-23 receptor complex is expressed on a number of cells, including natural killer cells, monocytes,
macrophages, dendritic cells, and CD4 T cells. Currently, the molecular mechanisms governing expression of the
IL-23 receptor chains, IL-23Ra and IL-12Rb1, are not well understood. Our results show that IL-23 induces
upregulation of IL-23Ra and IL-12Rb1 expression in human CD4 T cells. Further, we demonstrate that inhibition
of the Janus kinase/signal transducer and activation of transcription ( JAK/STAT) pathway by SD-1029, a JAK2
inhibitor, 50 -deoxy-50 -(methylthio) adenosine, a STAT1 inhibitor, and STAT3 VII, a STAT3 inhibitor, were able to
block IL-23-induced expression of IL-23 receptor subunits in the human SUPT-1 T cell line and in primary CD4
human T cells. Taken together, our results suggest a positive feedback regulation of the IL-23 receptor via IL-23mediated activation of the JAK/STAT pathway.
Introduction
T
he interaction between interleukin-23 (IL-23) and
its specific receptor, IL-23R, plays a critical role in promoting the proliferation of memory T helper 1 (Th1) cells.
IL-23, produced by antigen presenting cells, has proinflammatory activity and is involved in the development of
autoimmune diseases, including rheumatoid arthritis, multiple sclerosis, and psoriasis (Lee and others 2004; VakninDembinsky and others 2006; Kim and others 2007). This
cytokine also supports the in vivo development and expansion of the novel IL-17 producing Th cell subset, Th17 cells
(Harrington and others 2005; Langrish and others 2005; Chen
and others 2007; Zhou and others 2007; Manel and others
2008; McGeachy and others 2009; Morishima and others
2009). Th17 cells play an important role in the induction of
autoimmune disease and are also involved in host defense
against extracellular bacteria and fungi (Langrish and others
2005; Weaver and others 2006, 2007; Bettelli and others 2007;
Gee and others 2009). Regulation of IL-23 responsiveness, in
terms of IL-23R expression is critical to the maintenance of
the Th17 response pathway.
The IL-23R is heterodimeric, consisting of a unique IL23Ra chain and the IL-12Rb1 chain as found in the IL-12
receptor (Parham and others 2002). IL-23Ra is expressed on
activated T cells, memory T cells, as well as natural killer
cells and monocytes/macrophage and dendritic cells (Belladonna and others 2002; Parham and others 2002), whereas
the IL-12Rb1 chain has been shown to be expressed on T
cells, natural killer cells, and dendritic cells (Desai and others
1992). Activated human CD4 T cells treated with anti-CD3
and anti-CD28 in the presence of IL-23 express enhanced
levels of IL-23R (Chen and others 2007), and IL-6 and
transforming growth factor-beta (TGF-b) have also been
shown to induce the upregulation of IL-23R and enhance IL23 responsiveness/Th17 differentiation (Yang and others
2007; Zhou and others 2007; Morishima and others 2009). IL2, IL-7, and IL-15 have been shown to upregulate IL-12Rb1
expression (Wu and others 1997). However, the molecular
mechanism behind IL-23-mediated IL-23Ra expression has
not been investigated in CD4 T cells, and the effect of IL-23
on IL-12Rb1 expression has not been reported.
IL-23 has been shown to activate a similar profile of the
Janus kinase ( JAK) and signal transducers and activator of
transcription (STAT) pathway as that of IL-12. Members of
the JAK/STAT pathway induced by IL-12 and IL-23 include
JAK2, Tyk2, STAT1, STAT3, STAT4, and STAT5 (Parham
and others 2002). Both IL-23 receptor subunits are required
Department of Microbiology and Immunology, Queen’s University, Kingston, Ontario, Canada.
94
363
364
CHE MAT ET AL.
for the bioactivity of IL-23, but IL-23Ra is responsible for the
activation of intracellular signal transduction due to its association with JAK2 and STAT3 (Parham and others 2002;
Hunter 2005). A critical role for STAT3 in Th17 development
has been described (Nishihara and others 2007; Yang and
others 2007; Chaudhry and others 2009) and IL-23-induced
activation of STAT3 plays a role in IL-17 production from
Th17 cells (Cho and others 2006; Yang and others 2007;
Caruso and others 2008).
Using primary human CD4 T cells and the human T cell
line, SUPT-1, we demonstrate that IL-23 induces the upregulation of both IL-23Ra and IL-12Rb1 receptor chains at
both message and protein levels. Additionally, we show that
JAK2, STAT1, and STAT3 activation are required for IL-23mediated induction of its own receptor. These results suggest
that IL-23 plays an important role in a positive feedback loop
in terms of IL-23R expression and IL-23 responsiveness in
human CD4 T cells.
Materials and Methods
CD4 T lymphocyte isolation
Peripheral blood mononuclear cells were isolated by centrifugation over Lympholyte (Cedarlane). CD4 T cells were
purified from peripheral blood mononuclear cells by using
the Human CD4þ T cell Enrichment Kit (Stem Cell Technologies) as per the manufacturer’s instructions. Briefly, the
cells were washed with phosphate-buffered saline–EDTA
(Sigma) with 2% fetal calf serum (FCS) (Hyclone). After
washing, cells were cultured in Iscove’s modified Dulbecco’s
medium (IMDM) (Gibco–Invitrogen) supplemented with
10% FCS, and the viability of the cells were tested with trypan blue (Fluka).
Cell culture and stimulation
Signalling Technology. For receptor expression, whole cell
lysates were subjected to Western analysis using anti-IL12Rb1 and anti-IL-23Ra (Santa Cruz Biotechnology). b-Actin (Biovision) was used as a loading control as indicated.
Horseradish peroxidase-labeled secondary antibodies, goat
anti-mouse IgG, goat anti-rabbit IgG, and rabbit anti-goat
IgG were obtained from Santa Cruz Biotechnology. Expression of protein was measured by chemiluminesce using
the ECL Advance Detection Kit (Amersham Biosciences)
and detected using the HD2 Alphalnnotech imaging system
(Fisher Scientific). Fold increase relative to b-actin expression was measured using HD2 AlphaInnotech imaging
software.
Reverse transcriptase–polymerase chain reaction
Total RNA was prepared using the TRI-Reagent (Bioshop
Canada, Inc.) method. RNA was reverse transcribed into
cDNA using Moloney murine leukemia virus RT, with random primers, RNase Out, and oligo dT (Invitrogen). PCR
amplification of cDNA aliquots was performed by adding
2 mL of cDNA, sense and antisense primers, and 5 Taq
Polymerase Master Mix (New England Biolabs). The following specific primers were used—IL-23Ra: sense 50 -TGTA
CTGCACTGCTGAATGTCCCA-30 , antisense 50 -ATTCCAGG
TGCAAGTCATGTTGCC-30 ; IL-12 Rb1: sense 50 -ACACTGT
CACACTCTGGGTGGAAT-30 , antisense 50 -AACTGAGTTG
TAGAGCTGCAGGGT-30 ; h18srRNA: sense 50 -TTCGGAAC
TGAGGCCATGAT-30 , antisense 50 -CGAACCTCCGACTT
TCGTTT-30 . The PCR products were separated on 2% agarose gels (Bioshop Canada Inc) containing ethidium bromide
(Sigma) and were observed using the HD2 Alphalnnotech
imaging system. Fold increase relative to 18srRNA expression was measured using HD2 AlphaInnotech imaging
software.
Electrophoretic mobility shift assay
SUPT-1 (ATCC), a human leukemic T cell line, and primary CD4 T cells were cultured in IMDM supplemented
with 10% FCS. SUPT-1 cells and primary CD4 T cells were
stimulated with recombinant IL-23 (5 ng/mL) (R&D Systems) and incubated at 378C for different times for either
Western blotting analysis or reverse transcriptase–polymerase
chain reaction (RT-PCR). SD-1029 (Calbiochem) was used as
JAK2 inhibitor, 50 -deoxy-50 -(methylthio) adenosine (MTA;
Sigma) was used as STAT1 inhibitor, and STAT3 VII (Calbiochem) was used as STAT3 inhibitor.
Western blot analysis
SUPT-1 cells and primary CD4 T cells were cultured with
IL-23 (5 ng/mL) from 0 to 60 min or from 0 to 24 h. Cells
were harvested and lysed in lysis buffer [1 M HEPES, 0.5 M
NaF, 0.5 M EGTA, 2.5 M NaCl, 1 M MgCl2, 100% glycerol,
100% Triton-X-100, and protease inhibitor cocktail (Pierce)].
Fifty micrograms of total protein was resolved on 12%
polyacrylamide gels and were transferred to polyvinylidene
fluoride (PVDF) membranes (Pall Corporation) and then
blocked 1 h in 2.5% bovine serum albumin (Bioshop Canada, Inc.). Specific antibodies for phosphorylated JAK2,
phosphorylated Tyk2, phosphorylated STAT1, phosphorylated STAT3, and phosphorylated STAT4 were purchased
from Santa Cruz Biotechnology. Antibodies for pan JAK2,
Tyk2, STAT1, STAT3, and STAT4 were purchased from Cell
95
Cell pellets were resuspended in 1 mL of cold Buffer A
[10 mM HEPES (pH 7.9), 10 mM KCl, and 1.5 mM MgCl2]
and centrifuged at 48C at 200 g for 5 min. Cell pellets were
then again resuspended with cold Buffer A plus 0.1% NP40
and incubated on ice for 10 min followed by centrifugation at
48C at 20,000 g. Resulting cell pellets were resuspended with
cold Buffer B [20 mM HEPES (pH 7.0), 420 nM NaCl, 1.5 mM
MgCl2, 0.2 EDTA, and 25% glycerol] and incubated for
15 min on ice, followed by centrifugation at 48C at 20,000 g
for 10 min. The supernatant was mixed with cold Buffer C
(20 mM HEPES, 50 mM KCl, 0.2 mM EDTA, and 20% glycerol). Nuclear protein concentration was measured by the
Bradford method. Binding reactions were carried out by incubating 5 mg of nuclear extract in binding buffer (100 mM
Tris, 500 mM KCl, and 10 mM DTT) with 50% glycerol,
100 mM MgCl2, Poly dIdC, 1% NP-40, and biotin-labeled
probes (STAT1: 50 -CAT GTT ATG CAT ATT CCT GTA
AGT G-30 ; STAT3: 50 -GAT CCT TCT GGG AAT TCC TAG
ATC-30 ). The specificity of protein–DNA complexes was
determined by incubating the extracts with excess (200-fold)
of annealed, unlabelled, cold competitor probe for 30 min at
room temperature. Supershift analysis was performed by
incubating 2 mg of polyclonal rabbit anti-STAT1 or antiSTAT3 (Santa Cruz) with the reaction for 1 h at room temperature. The analysis of the DNA–protein complex was
carried out on a 5% nondenaturing polyacrylamide gel,
IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS
transferred to nylon membranes (Pierce) and cross-linked
(Spectroline UV Crosslinker; Fisher Scientific). Detection was
performed by chemiluminesce using the ECL Advance detection kit (Amersham Biosciences) and detected using the
HD2 Alphalnnotech imaging system.
Results
Characterization of the IL-23-induced JAK/STAT
pathway in human CD4 T cells
To characterize the signaling pathway induced by IL-23,
we stimulated CD4 T cells with IL-23 and examined the
phosphorylation of JAK and STAT molecules. We initially
performed these experiments in primary CD4 T cells (Fig.
1A). For an additional human CD4 T cell model system, we
utilized the T cell line SUPT-1 (Fig. 1B). Our results demonstrate that IL-23 induces the phosphorylation of JAK2,
Tyk2, STAT1, STAT3, and STAT4 in both primary human
CD4 T cells (Fig. 1A) and in SUPT-1 cells (Fig. 1B). Phosphorylated JAK2, Tyk2, STAT1, and STAT3 proteins were
detected at 5 min after stimulation and reached maximum
levels after 15 min. The STAT4 activation is notably weaker
in response to IL-23 in primary CD4 T cells (Fig. 1A).
IL-23 induces IL-23 receptor expression
in human CD4 T cells
Previously, it has been reported that both IL-23 receptor
chains are detected in human T cells (Parham and others
2002) and activated human CD4 T cells treated with IL-23
expressed elevated IL-23R mRNA expression (Chen and
others 2007). However, there is no evidence as to whether IL23 alone is able to induce expression of the IL-23 receptor
subunits in human CD4 T cells. To directly address this issue,
we stimulated primary human CD4 T cells and SUPT-1 with
IL-23 from 0 to 8 h, for mRNA expression, and from 0 to 24 h
for protein expression. We found that IL-23 was able to in-
365
duce expression of both IL-23 receptor subunits in primary
human CD4 T cells and SUPT-1 cells (Fig. 2). It has been
demonstrated that IL-6 and TGF-b can stimulate IL-23R expression (Yang and others 2007; Zhou and others 2007;
Morishima and others 2009). To confirm that the induction of
IL-12Rb1 and IL-23Ra expression is due directly to IL-23mediated signaling in our cell systems and not secondary
downstream induction of cytokines, we tested whether IL23-treated SUPT-1 cells and primary CD4 T cells expressed
upregulated expression of either IL-6 or TGF-b. Our data
indicated that although basal levels of TGF-b mRNA were
detected in unstimulated cells, IL-23 was not able to enhance
TGF-b expression. Additionally, no IL-6 was detectable in
resting cells and IL-23 was not capable of inducing IL-6 expression (data not shown).
Protein expression levels of IL-12Rb1 and IL-23Ra were
enhanced after 4 h stimulation with IL-23 and, in the case of
IL-12Rb1, persisted up to 24 h in primary CD4 T cells (Fig.
2A) and SUPT-1 cells (Fig. 2B). In the case of IL-23Ra, expression peaked at 16 h in primary cells and at 8 h in SUPT-1
cells and returned to basal levels after 24 h. To determine
whether IL-23 affected IL-23R expression at the level of
transcription, we examined the pattern of IL-23-induced IL23R expression by RT-PCR. IL-23 was able to induce IL-23Ra
and IL-12Rb1 mRNA expression in both primary CD4 T cells
and in SUPT-1 cells in a similar pattern as detected by
Western blotting. IL-12Rb1 expression was enhanced after
2 h of IL-23 stimulation in primary cells (Fig. 2A) and in
SUPT-1 cells (Fig. 2B). Upregulation of IL-12Rb1 mRNA expression persisted for up to 8 h. However, IL-23Ra expression induced after 2 h of IL-23 treatment in primary cells
decreased to close to basal levels after 8 h of treatment (Fig.
2A). In SUPT-1 cells, IL-23Ra expression was induced after
4 h of IL-23 treatment and was ablated by 8 h (Fig. 2B). Taken
together, these results indicate that the temporal regulation
of IL-23R subunits by IL-23 stimulation may be differentially
controlled.
FIG. 1. IL-23 induces phosphorylation
of the JAK/STAT pathway in human
CD4 T cells. Primary human CD4 T cells
(A) or SUPT-1 cells (B) were treated with
IL-23 for the times indicated. Cell lysates
were analyzed by SDS-PAGE and membranes were blotted using phospho (p)specific antibodies to JAK2, Tyk2, STAT1,
STAT3, or STAT4. Membranes were also
probed with pan antibodies for JAK2,
Tyk2, STAT1, STAT3, or STAT4 as loading controls. Blots shown are representative of 5 separate experiments. IL,
interleukin; JAK, Janus kinase; SDSPAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; STAT,
signal transducers and activator of transcription.
96
366
CHE MAT ET AL.
FIG. 2. IL-23 enhances expression of
IL-23Ra and IL-12Rb1 expression in human CD4 T cells. Primary human
CD4 T cells (A) or SUPT-1 cells (B) were
treated with IL-23 for the times indicated.
Cell lysates (left panels) were analyzed by
SDS-PAGE and membranes were blotted
using antibodies to either IL-12Rb1 or
IL-23Ra. Membranes were probed with
b-actin as a loading control. Total mRNA
(right panels) was analyzed for IL-12Rb1
and IL-23Ra expression by RT-PCR.
18srRNA was included as the house
keeping gene. Data shown are representative of 5 separate experiments. Fold
increase was determined relative to
b-actin or 18srRNA for Western blots and
RT-PCR analysis, respectively. RT-PCR,
reverse transcriptase–polymerase chain
reaction.
together, these results indicate the involvement of the JAK/
STAT pathway in IL-23-induced IL-23R expression.
To further dissect this pathway, we examined the effect of the
STAT1 inhibitor, MTA, on IL-23-induced IL-23R expression.
Initially, we confirmed the specificity of MTA on the nuclear
localization of the STAT1 protein by electrophoretic mobility
shift assay (EMSA), since this inhibitor does not affect the
phosphorylation of STAT1, but does inhibit the activation of
STAT1 as measured by nuclear localization (Mowen and
others 2001; Shen and Lentsch 2004). Nuclear extracts from
SUPT-1 T cells were analyzed for the presence of activated
STAT1 after 1 h incubation with MTA before IL-23 treatment.
The addition of MTA at different doses (0.1, 0.3, and 1.0 mM)
resulted in a dose-dependent inhibition of STAT1 activation
(Fig. 4A). Supershift experiments using anti-STAT1 antibodies exhibited a partial inhibition of the protein–DNA
complex, indicating the presence of activated STAT1 proteins. Additionally, STAT1/STAT3 heterodimers have been
detected (Stancato and others 1996; Sato and others 1997;
Sheikh and others 2004; Guzzo and others 2010). To test
whether STAT1/3 heterodimers were being induced in this
system, we performed supershift analysis using anti-STAT3
antibodies. Incubation of nuclear proteins with anti-STAT3
also resulted in a partial abrogation of protein–DNA complexes. To confirm these results, we also performed EMSA
analysis using STAT3-specific probes. These results show
that MTA is also able to inhibit STAT3 activation in a dosedependent manner. Supershift experiments using either
anti-STAT1 or anti-STAT3 antibodies show inhibition of
protein–DNA complexes, indicating the formation of IL-23induced STAT1/3 heterodimers.
We next determined whether treatment of cells with MTA
affected IL-23-induced IL-23R expression. The effect of MTA
on IL-23R expression was examined at protein and mRNA
levels. Analysis by Western blot and RT-PCR showed that
MTA significantly downregulated the IL-12Rb1 and IL-23Ra
expression in SUPT-1 (Fig. 4B) and primary CD4 T cells (Fig.
4C). The inhibitory effects were observed as early as 0.1 mM
of MTA and levels of IL-12Rb1 and IL-23Ra expression returned to basal levels at 1 mM of MTA.
The JAK/STAT pathway regulates IL-23-induced
IL-23 receptor expression
We sought to identify the regulatory mechanisms of IL-23mediated IL-23R subunit expression. Since JAK2 and STAT3
have been demonstrated to physically associate with the
IL-23Ra, and STAT1 and STAT3 exhibit relatively strong
phosphorylation in response to IL-23 stimulation in primary
CD4 T cells (Fig. 1A) (Parham and others 2002), we chose
to focus on the role of these JAK/STAT family members in
IL-23-mediated IL-23R expression.
To study the role played by the JAK/STAT pathway in
IL-23-induced upregulation of IL-23Ra and IL-12Rb1 expression, we used specific inhibitors for JAK2 (SD-1029), STAT1
(MTA), and STAT3 (STAT3 VII). Initially, we investigated the
effect of the JAK2 inhibitor on IL-23-mediated IL-23R expression. First, we confirmed the inhibitory effect of SD-1029
by measuring the phosphorylation of JAK2 in SUPT-1 cells.
The phosphorylation of JAK2 in SUPT-1 (Fig. 3A) and primary
CD4 T cells (data not shown) was suppressed after 1 h incubation with SD-1029 before IL-23 stimulation. The effect of
SD-1029 on Tyk2 phosphorylation has not been well documented, and since IL-23 induces Tyk2 phosphorylation, we
examined whether SD-1029 was also capable of inhibiting
Tyk2 activation. The results indicate that IL-23-induced Tyk2
phosphorylation is blocked by SD-1029. Since phosphorylated
JAK2 and Tyk2 subsequently activate downstream targets,
including STAT1 and STAT3, we examined the effect of
this inhibitor on the phosphorylation of STAT1 and STAT3.
As expected, SD-1029 was also able to inhibit the phosphorylation of STAT1 and STAT3 (Fig. 3A).
Evaluation of the effect of SD-1029 on IL-23-induced IL12Rb1 and IL-23Ra expression showed a significant inhibition of each receptor chain. In both SUPT-1 (Fig. 3B) and
primary CD4 T cells (Fig. 3C), inhibition of protein and
mRNA levels of IL-12Rb1 by SD-1029 were observed at 5 mM
and decreased to basal levels at 10 mM. In the case of the IL23Ra subunit, SD-1029 preincubation resulted in the abrogation of protein and mRNA expression at 5 mM in both
SUPT-1 (Fig. 3B) and primary CD4 T cells (Fig. 3C). Taken
97
IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS
367
FIG. 3. IL-23-induced IL23 receptor subunit expression is dependent on the
JAK/STAT pathway. (A)
SUPT-1 cells were pretreated for 1 h with the
JAK2 inhibitor SD-1029 at
doses ranging from 1 to
10 mM followed by treatment with IL-23 for 15 min.
Cell lysates were analyzed
by SDS-PAGE and membranes were probed using
phospho (p) specific antibodies for JAK2, Tyk2,
STAT1, and STAT3. JAK2
antibodies were used as
loading control. SUPT-1 (B)
and
primary
human
CD4 T cells (C) were pretreated for 1 h with the
JAK2 inhibitor SD-1029 at
doses ranging from 0 to
10 mM followed by treatment with IL-23 for 8 or 4 h
for Western blotting or RTPCR analysis, respectively.
Cell lysates were analyzed
by SDS-PAGE (top panels)
and membranes were blotted using antibodies to either IL-12Rb1 or IL-23Ra.
Membranes were probed
with b-actin as a loading
control. Total mRNA (bottom panels) was analyzed
for IL-12Rb1 and IL-23Ra
expression by RT-PCR.
18SrRNA was included as the house keeping gene. Data shown are representative of 5 separate experiments. Fold increase
was determined relative to b-actin or 18srRNA for Western blots and RT-PCR analysis, respectively.
vious work demonstrates that IL-23 activates the JAK/STAT
pathway through complex formation with IL-23Ra and IL12Rb1 (Oppmann and others 2000; Parham and others 2002).
As our model systems, we used primary human CD4 T cells
isolated from healthy donors and the SUPT-1 human T cell
line. In both cell types, we demonstrate that IL-23 was able to
induce the JAK/STAT pathway via strong phosphorylation of
JAK2, Tyk2, STAT1, and STAT3. In agreement with others, we
demonstrated that IL-23 induces weaker phosphorylation of
STAT4 compared to STAT1 or STAT3 in primary CD4 T cells
(Oppmann and others 2000; Parham and others 2002).
The activation of JAK/STAT signaling molecules in response to IL-23 is dependent on the presence of IL-23Ra
(Parham and others 2002); however, the regulation of IL23Ra and that of IL-12Rb1 in response to IL-23 stimulation
are not described. Previously, IL-6 was shown to upregulate IL-23R mRNA expression in the presence or absence of
IL-23 in T cells after anti-CD3/anti-CD28 activation (Yang
and others 2007). Further to this study, Morishima and
others (2009) demonstrated that IL-23 in synergy with IL-6
was required to enhance IL-23R protein levels, whereas IL-6
alone enhanced IL-23R at the message level only. Our study
shows that IL-23 is not able to induce IL-6 expression, indicating that IL-23-mediated IL-23R induction is occurring
We next examined the role of STAT3 in IL-23-mediated
induction of IL-23R through the use of a STAT3 inhibitor,
STAT3 VII (Xu and others 2008). We cultured human CD4 T
cells with STAT3 VII for 1 h before IL-23 stimulation and
examined the suppression of STAT3 phosphorylation by
Western analysis. Incubation with STAT3 VII for 1 h significantly suppressed the activation of STAT3 in SUPT-1
(Fig. 5A) and primary CD4 T cells (data not shown). The
phosphorylation of STAT1 did not change, indicating that
this inhibitor is specific for STAT3 and does not affect the
phosphorylation of STAT1. STAT3 VII also had no significant effect on the total amount of cellular STAT3 protein as
determined by Western analysis (Fig. 5A). In human CD4 T
cells, incubation with STAT3 VII for 1 h before IL-23 stimulation led to inhibition of IL-23-induced IL-23R expression.
The expression levels of IL-12Rb1 and IL-23Ra in both SUPT1 cells (Fig. 5B) and primary CD4 T cells (Fig. 5C) decreased
at doses as low as 0.5 mM of STAT3 VII and returned to basal
levels, or below, at 2 mM of STAT3 VII.
Discussion
In this study, we provide evidence that JAK2, STAT1, and
STAT3 are involved in IL-23-induced IL-23R expression. Pre-
98
368
CHE MAT ET AL.
FIG. 4. STAT1 is involved in IL-23-mediated IL-23Ra and IL-12Rb1 upregulation. (A) SUPT-1 cells were pretreated for
1 h with STAT1 inhibitor, MTA, at doses
ranging from 0.1 to 1 mM followed by
treatment with IL-23 for 15 min. EMSA
was performed on nuclear lysates using
probes specific for either STAT1 or STAT3.
SS assays with antibodies for either STAT1
of STAT3 were performed as indicated.
CC probe was added to indicate binding
specificity. SUPT-1 (B) and primary human CD4 T cells (C) were pretreated for
1 h with the STAT1 inhibitor MTA at doses
ranging from 0.1 to 1 mM followed by
treatment with IL-23 for 8 or 4 h for Western blotting or RT-PCR analysis, respectively. Cell lysates were analyzed by SDSPAGE (top panels) and membranes were
blotted using antibodies to either IL-12Rb1
or IL-23Ra. Membranes were probed with
b-actin as a loading control. Total mRNA
(bottom panels) was analyzed for IL-12Rb1
and IL-23Ra expression by RT-PCR.
18srRNA was included as the house
keeping gene. Data shown are representative of 5 separate experiments. Fold increase was determined relative to b-actin
or 18srRNA for Western blots and RT-PCR
analysis, respectively. CC, cold competitor; MTA, 50 -deoxy-50 -(methylthio) adenosine; SS, supershift.
independently of endogenous IL-6 expression in both
SUPT-1 cells and primary CD4 T cells. A role for TGF-b in
upregulation of IL-23Ra has also been demonstrated,
whereby IL-6 stimulation of CD4 T cells induced the upregulation of TGF-b mRNA expression (Morishima and others 2009). However, as levels of IL-6 were undetectable and
as TGF-b signals mainly through the Smad signaling family
(Moustakas and others 2002; Letterio 2005), it is unlikely
that TGF-b is involved in induction of IL-23R expression in
our system. Indeed, our results demonstrated that IL-23
stimulation did not enhance mRNA levels of TGF-b. Human memory T cells are also able to upregulate IL-23 receptor expression in response to anti-CD3/anti-CD28 in
combination with IL-23 (Chen and others 2007). The effects
of activation of T cells on the molecular mechanism behind
IL-23-mediated IL-23R upregulation are yet to be studied
and the role of other key cytokines, including that of IL-6
and TGF-b, is yet to be fully elucidated. However, we
demonstrate for the first time that IL-23 alone is able to
induce both IL-23R subunit expression at mRNA and protein levels in primary human CD4 T cells.
Recently, IL-23R has been shown to contribute to the development autoimmune disease. IL-23R can be alternatively
spliced to generate at least 6 isoforms in normal lymphoid
cells and in numerous tumor cell lines (Zhang and others
2006). Polymorphisms within the IL-23R gene locus have
been reported to be involved in inflammatory bowel disease,
Crohn’s disease, ulcerative colitis, and in the development of
psoriasis (Duerr and others 2006; Garcia and others 2008).
99
Although the focus of many studies has been on the formation of splice variant expression of IL-23R, the molecular
mechanisms governing regulation of IL-2R subunit expression have not been reported.
Our data indicate that although IL-23 induced expression
of both IL-12Rb and IL-23Ra in human CD4 T cells, the
temporal regulation of each receptor unit is different, and
thus may be regulated by different factors. In both cell types,
induction of IL-23Ra appears to be transient, returning to
basal levels after 24 h of IL-23 treatment. This effect is mirrored in the RT-PCR data, whereby after 8 h of IL-23 treatment the IL-23Ra expression is significantly diminished. On
the other hand, expression of IL-12Rb1 appears to be maintained in both the protein and mRNA levels. IL-23 has been
shown to induce expression suppressor of cytokine signaling
3(SOCS3) expression, which subsequently inhibits IL-23induced STAT3 activation (Chen and others 2006). Induction
of SOCS proteins, in particular that of SOCS3, may account
for the significant decrease in IL-23Ra expression compared
to that of IL-12Rb1, and further work in this regard is required to identify a role for these proteins in IL-23-mediated
IL-23R expression.
In our study, we demonstrate that IL-23 enhances IL-23
receptor expression through the JAK/STAT pathway. We
determined this through the use of specific inhibitors for
JAK2, STAT1, and STAT3: namely, SD-1029, MTA, and
STAT3 VII, respectively. Because JAK2 and STAT3 have been
demonstrated to physically associate with the IL-23Ra (Parham and others 2002), and because our data showed that IL-
IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS
369
FIG. 5. STAT3 is involved in IL-23-induced IL-23Ra and IL-12Rb1 upregulation. (A) SUPT-1 cells were pretreated for
1 h with STAT3 inhibitor, STAT3 VII, for
doses ranging from 0.5 to 2 mM followed
by treatment with IL-23 for 15 min. Cell
lysates were analyzed by SDS-PAGE and
membranes were probed using phospho
(p)-specific antibodies for STAT1 and
STAT3. STAT3 antibodies were used as
loading control. SUPT-1 (B) and primary
human CD4 T cells (C) were pretreated
for 1 h with the STAT3 inhibitor STAT3
VII, for doses ranging from 0.5 to 2 mM
followed by treatment with IL-23 for 8 or
4 h for Western blotting or RT-PCR analysis, respectively. Proteins were resolved
by SDS-PAGE (top panels) and membranes were blotted using antibodies to
either IL-12Rb1 or IL-23Ra. Membranes
were probed with b-actin as a loading
control. Total mRNA (bottom panels) was
analyzed for IL-12Rb1 and IL-23Ra expression by RT-PCR. 18srRNA was included as the house keeping gene. Data
shown are representative of 5 separate
experiments. Fold increase was determined relative to b-actin or 18srRNA for
Western blots and RT-PCR analysis, respectively.
23 stimulation elicited strong phosphorylation of STAT1 and
STAT3 in primary CD4 T cells, we chose to focus on the role
of these JAK/STAT family members in IL-23-mediated IL23R expression. SD-1029 has previously been reported as an
inhibitor of STAT3 activation due to inhibition of JAK2
phosphorylation (Duan and others 2006). As we expected,
SD-1029 inhibited not only JAK2 phosphorylation, but also
the phosphorylation of STAT1 and STAT3. We also observed
that SD-1029 strongly inhibited Tyk2 phosphorylation, implicating both JAK2 and Tyk2 as upstream requirements for
IL-23-induced IL-23R expression. A specific role for Tyk2 in
IL-23-induced IL-23R has yet to be clarified.
Inhibition of the JAK/STAT pathway resulted in abrogation of IL-23-induced expression of both IL-23Ra and IL12Rb1 receptor chains in human CD4 T cells. We chose to
further investigate the roles played by STAT1 and STAT3 in
IL-23-induced IL-23R expression. To examine the effect of
inhibiting STAT1 and STAT3 activation, we used MTA and
STAT3 VII inhibitors, respectively. Both MTA and STAT3 VII
blocked IL-23-induced IL-23R expression. In both cases, expression of IL-23Ra and IL-12Rb1 were returned to basal
levels or were abrogated completely. In support of our data,
IL-6-induced STAT3 activation has been suggested to be involved in IL-6 mediated upregulation of IL-23R (Yang and
others 2007).
The apparent requirement of both STAT1 and STAT3 can
be attributed to the ability of STAT1 and STAT3 to form
heterodimers (Stancato and others 1996; Sato and others
1997; Sheikh and others 2004; Guzzo and others 2010).
Therefore, it may be possible that IL-23 induces heterodimer
formation of STAT1 and STAT3, which is ultimately required
for optimal IL-23Ra and IL-12Rb1 expression in response to
IL-23. It has been suggested that although IL-23-induced
phosphorylation of STAT4 is comparatively weaker to that of
IL-12, STAT4 may form heterodimers with STAT3 (Parham
and others 2002). IL-23 has also been shown to induce the
activation of NF-kB and PI3 kinase in murine CD4 T cells
(Cho and others 2006). Therefore, a role for other transcription factors, including that of NF-kB and STAT4, cannot be
ruled out at this point and merits further investigation.
IL-23 has been shown to play a critical role in the maintenance of the Th17 T cell subset and IL-23Ra has been
shown to be expressed on Th17 cells (Langrish and others
2005; Annunziato and others 2007; Chen and others 2007;
Zhou and others 2007; Manel and others 2008; Morishima
and others 2009). The dependence of IL-23-mediated IL-23
receptor expression on the JAK/STAT pathway may have
implications on the development of Th17 cells, particularly as
STAT3 activation has been shown to be critical to the differentiation of Th17 cells as well as the production of IL-17 (Cho
and others 2006; Nishihara and others 2007; Yang and others
2007; Caruso and others 2008; Chaudhry and others 2009).
Thus, our results suggest that IL-23 itself may be an important
regulator of Th17 cell differentiation and maintenance by enhancing IL-23 receptor expression on these T cells. Our data in
primary CD4 T cells suggest that IL-23 treatment may expand
and support Th17 cell development via upregulation of IL-23R
and thus provide a positive feedback loop for response to this
cytokine. Further work in this regard will be critical to characterizing this key feature of IL-23.
In summary, we demonstrate activation of the JAK/STAT
pathway induced by IL-23 in human CD4 T cells. For the
100
370
CHE MAT ET AL.
first time, we show that IL-23 alone can upregulate its own
receptor expression in these cells at both message and protein levels. Further, JAK2, STAT1, and STAT3 are involved in
IL-23-induced IL-23 receptor expression. Taken together, our
data suggest that JAK/STAT signaling molecules are important for the regulation of IL-23 receptor in human CD4 T
cells. These findings provide new information on how IL-23
receptor expression is regulated in human T cells and suggest a potential molecular mechanism for IL-23 in Th17 cell
development.
Acknowledgments
This work was supported by the National Sciences and
Engineering Research Council of Canada and the Canada
Foundation for Innovation. N.F.C.M. is supported by the
Ministry of Higher Education, Malaysia, and Universiti Sains
Malaysia. X.Z. is supported by a studentship from the National Sciences and Engineering Research Council of Canada.
C.G. is supported by a Canadian Institutes of Health Research Vanier Award. Dorothy Agnew is gratefully acknowledged for phlebotomy.
Author Disclosure Statement
No competing financial interests exist.
References
Annunziato F, Cosmi L, Santarlasci V, Maggi L, Liotta F, Mazzinghi B, Parente E, Fili L, Ferri S, Frosali F, Giudici F, Romagnani P, Parronchi P, Tonelli F, Maggi E, Romagnani S.
2007. Phenotypic and functional features of human Th17 cells.
J Exp Med 204(8):1849–1861.
Belladonna ML, Renauld JC, Bianchi R, Vacca C, Fallarino F,
Orabona C, Fioretti MC, Grohmann U, Puccetti P. 2002. IL-23
and IL-12 have overlapping, but distinct, effects on murine
dendritic cells. J Immunol 168(11):5448–5454.
Bettelli E, Korn T, Kuchroo VK. 2007. Th17: the third member of
the effector T cell trilogy. Curr Opin Immunol 19(6):652–657.
Caruso R, Fina D, Paoluzi OA, Del Vecchio BG, Stolfi C, Rizzo A,
Caprioli F, Sarra M, Andrei F, Fantini MC, MacDonald TT,
Pallone F, Monteleone G. 2008. IL-23-mediated regulation of
IL-17 production in Helicobacter pylori-infected gastric mucosa. Eur J Immunol 38(2):470–478.
Chaudhry A, Rudra D, Treuting P, Samstein RM, Liang Y, Kas
A, Rudensky AY. 2009. CD4þ regulatory T cells control TH17
responses in a Stat3-dependent manner. Science 326(5955):
986–991.
Chen Z, Laurence A, Kanno Y, Pacher-Zavisin M, Zhu BM, Tato
C, Yoshimura A, Hennighausen L, O’Shea JJ. 2006. Selective
regulatory function of Socs3 in the formation of IL-17-secreting
T cells. Proc Natl Acad Sci U S A 103(21):8137–8142.
Chen Z, Tato CM, Muul L, Laurence A, O’Shea JJ. 2007. Distinct
regulation of interleukin-17 in human T helper lymphocytes.
Arthritis Rheum 56(9):2936–2946.
Cho ML, Kang JW, Moon YM, Nam HJ, Jhun JY, Heo SB, Jin HT,
Min SY, Ju JH, Park KS, Cho YG, Yoon CH, Park SH, Sung
YC, Kim HY. 2006. STAT3 and NF-kappaB signal pathway is
required for IL-23-mediated IL-17 production in spontaneous
arthritis animal model IL-1 receptor antagonist-deficient mice.
J Immunol 176(9):5652–5661.
Desai BB, Quinn PM, Wolitzky AG, Mongini PK, Chizzonite R,
Gately MK. 1992. IL-12 receptor. II. Distribution and regulation of receptor expression. J Immunol 148(10):3125–3132.
Duan Z, Bradner JE, Greenberg E, Levine R, Foster R, Mahoney
J, Seiden MV. 2006. SD-1029 inhibits signal transducer and
activator of transcription 3 nuclear translocation. Clin Cancer
Res 12(22):6844–6852.
Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly
MJ, Steinhart AH, Abraham C, Regueiro M, Griffiths A,
Dassopoulos T, Bitton A, Yang H, Targan S, Datta LW, Kistner
EO, Schumm LP, Lee AT, Gregersen PK, Barmada MM, Rotter
JI, Nicolae DL, Cho JH. 2006. A genome-wide association
study identifies IL23R as an inflammatory bowel disease gene.
Science 314(5804):1461–1463.
Garcia VE, Chang M, Brandon R, Li Y, Matsunami N, CallisDuffin KP, Civello D, Rowland CM, Bui N, Catanese JJ,
Krueger GG, Leppert MF, Begovich AB, Schrodi SJ. 2008.
Detailed genetic characterization of the interleukin-23 receptor
in psoriasis. Genes Immun 9(6):546–555.
Gee K, Guzzo C, Che Mat NF, Ma W, Kumar A. 2009. The IL-12
family of cytokines in infection, inflammation and autoimmune disorders. Inflamm Allergy Drug Targets 8(1):40–52.
Guzzo C, Che Mat NF, Gee K. 2010. Interleukin-27 induces a
STAT1/3 and NF-{kappa}B dependent proinflammatory cytokine profile in human monocytes. J Biol Chem 285(32):
24404–24411.
Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL,
Murphy KM, Weaver CT. 2005. Interleukin 17-producing
CD4þ effector T cells develop via a lineage distinct from the T
helper type 1 and 2 lineages. Nat Immunol 6(11):1123–1132.
Hunter CA. 2005. New IL-12-family members: IL-23 and IL-27,
cytokines with divergent functions. Nat Rev Immunol 5(7):
521–531.
Kim HR, Cho ML, Kim KW, Juhn JY, Hwang SY, Yoon CH, Park
SH, Lee SH, Kim HY. 2007. Up-regulation of IL-23p19 expression in rheumatoid arthritis synovial fibroblasts by IL-17
through PI3-kinase-, NF-kappaB- and p38 MAPK-dependent
signalling pathways. Rheumatology (Oxford) 46(1):57–64.
Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B,
Sedgwick JD, McClanahan T, Kastelein RA, Cua DJ. 2005.
IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201(2):233–240.
Lee E, Trepicchio WL, Oestreicher JL, Pittman D, Wang F,
Chamian F, Dhodapkar M, Krueger JG. 2004. Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris. J Exp Med 199(1):125–130.
Letterio JJ. 2005. TGF-beta signaling in T cells: roles in lymphoid
and epithelial neoplasia. Oncogene 24(37):5701–5712.
Manel N, Unutmaz D, Littman DR. 2008. The differentiation of
human T(H)-17 cells requires transforming growth factor-beta
and induction of the nuclear receptor RORgammat. Nat Immunol 9(6):641–649.
McGeachy MJ, Chen Y, Tato CM, Laurence A, Joyce-Shaikh B,
Blumenschein WM, McClanahan TK, O’Shea JJ, Cua DJ. 2009.
The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17-producing effector T helper cells
in vivo. Nat Immunol 10(3):314–324.
Morishima N, Mizoguchi I, Takeda K, Mizuguchi J, Yoshimoto
T. 2009. TGF-beta is necessary for induction of IL-23R and
Th17 differentiation by IL-6 and IL-23. Biochem Biophys Res
Commun 386(1):105–110.
Moustakas A, Pardali K, Gaal A, Heldin CH. 2002. Mechanisms
of TGF-beta signaling in regulation of cell growth and differentiation. Immunol Lett 82(1–2):85–91.
Mowen KA, Tang J, Zhu W, Schurter BT, Shuai K, Herschman
HR, David M. 2001. Arginine methylation of STAT1 modulates IFNalpha/beta-induced transcription. Cell 104(5):
731–741.
101
IL-23 INDUCES IL-23 RECEPTOR EXPRESSION IN CD4 T CELLS
Nishihara M, Ogura H, Ueda N, Tsuruoka M, Kitabayashi C,
Tsuji F, Aono H, Ishihara K, Huseby E, Betz UA, Murakami
M, Hirano T. 2007. IL-6-gp130-STAT3 in T cells directs the
development of IL-17þ Th with a minimum effect on that of
Treg in the steady state. Int Immunol 19(6):695–702.
Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega
F, Yu N, Wang J, Singh K, Zonin F, Vaisberg E, Churakova T,
Liu M, Gorman D, Wagner J, Zurawski S, Liu Y, Abrams JS,
Moore KW, Rennick D, Waal-Malefyt R, Hannum C,
Bazan JF, Kastelein RA. 2000. Novel p19 protein engages
IL-12p40 to form a cytokine, IL-23, with biological activities
similar as well as distinct from IL-12. Immunity 13(5):
715–725.
Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Cheung J,
Pflanz S, Zhang R, Singh KP, Vega F, To W, Wagner J,
O’Farrell AM, McClanahan T, Zurawski S, Hannum C, Gorman D, Rennick DM, Kastelein RA, de Waal MR, Moore KW.
2002. A receptor for the heterodimeric cytokine IL-23 is
composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol 168(11):5699–5708.
Sato T, Selleri C, Young NS, Maciejewski JP. 1997. Inhibition of
interferon regulatory factor-1 expression results in predominance of cell growth stimulatory effects of interferon-gamma
due to phosphorylation of Stat1 and Stat3. Blood 90(12):4749–
4758.
Sheikh F, Baurin VV, Lewis-Antes A, Shah NK, Smirnov SV,
Anantha S, Dickensheets H, Dumoutier L, Renauld JC,
Zdanov A, Donnelly RP, Kotenko SV. 2004. Cutting edge:
IL-26 signals through a novel receptor complex composed
of IL-20 receptor 1 and IL-10 receptor 2. J Immunol 172(4):
2006–2010.
Shen H, Lentsch AB. 2004. Progressive dysregulation of transcription factors NF-kappa B and STAT1 in prostate cancer
cells causes proangiogenic production of CXC chemokines.
Am J Physiol Cell Physiol 286(4):C840–C847.
Stancato LF, David M, Carter-Su C, Larner AC, Pratt WB. 1996.
Preassociation of STAT1 with STAT2 and STAT3 in separate
signalling complexes prior to cytokine stimulation. J Biol
Chem 271(8):4134–4137.
Vaknin-Dembinsky A, Balashov K, Weiner HL. 2006. IL-23 is
increased in dendritic cells in multiple sclerosis and downregulation of IL-23 by antisense oligos increases dendritic cell
IL-10 production. J Immunol 176(12):7768–7774.
371
Weaver CT, Harrington LE, Mangan PR, Gavrieli M, Murphy
KM. 2006. Th17: an effector CD4 T cell lineage with regulatory
T cell ties. Immunity 24(6):677–688.
Weaver CT, Hatton RD, Mangan PR, Harrington LE. 2007. IL-17
family cytokines and the expanding diversity of effector T cell
lineages. Annu Rev Immunol 25:821–852.
Wu C, Warrier RR, Wang X, Presky DH, Gately MK. 1997.
Regulation of interleukin-12 receptor beta1 chain expression
and interleukin-12 binding by human peripheral blood
mononuclear cells. Eur J Immunol 27(1):147–154.
Xu J, Cole DC, Chang CP, Ayyad R, Asselin M, Hao W, Gibbons
J, Jelinsky SA, Saraf KA, Park K. 2008. Inhibition of the signal
transducer and activator of transcription-3 (STAT3) signaling
pathway by 4-oxo-1-phenyl-1,4-dihydroquinoline-3-carboxylic
acid esters. J Med Chem 51 (14):4115–4121.
Yang XO, Panopoulos AD, Nurieva R, Chang SH, Wang D,
Watowich SS, Dong C. 2007. STAT3 regulates cytokinemediated generation of inflammatory helper T cells. J Biol
Chem 282(13):9358–9363.
Zhang XY, Zhang HJ, Zhang Y, Fu YJ, He J, Zhu LP, Wang SH,
Liu L. 2006. Identification and expression analysis of alternatively spliced isoforms of human interleukin-23 receptor gene
in normal lymphoid cells and selected tumor cells. Immunogenetics 57(12):934–943.
Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T,
Levy DE, Leonard WJ, Littman DR. 2007. IL-6 programs T(H)17 cell differentiation by promoting sequential engagement of
the IL-21 and IL-23 pathways. Nat Immunol 8(9):967–974.
Address correspondence to:
Katrina Gee
Assistant Professor
Department of Microbiology and Immunology
Queen’s University
Room 739 Botterell Hall
Kingston
Ontario
Canada K7L 3N6
E-mail: [email protected]
Received 12 July 2010/Accepted 31 August 2010
102