Download DNA polymerase

DNA Structure and
Function
Chapter 12
Discovery of DNA
Nucleic Acids were discovered in 1869 by
Friedrich Mieschner as a substance
contained within nuclei
 1929 Phoebus Levene discovered that
DNA was a polymer of nucleotides
 During the ’30s & 40’s proteins rather
than DNA was thought to hold genetic
information

Griffith Discovers
Transformation

1928

Attempting to develop a vaccine

Isolated two strains of Streptococcus
pneumoniae
 Rough
strain was harmless
 Smooth
strain was pathogenic
Transformation
1. Mice injected with
live cells of harmless
strain R.
2. Mice injected with live
cells of killer strain S.
3. Mice injected with
heat-killed S cells.
4. Mice injected with
live R cells plus heatkilled S cells.
Mice live. No live R
cells in their blood.
Mice die. Live S cells in
their blood.
Mice live. No live S cells
in their blood.
Mice die. Live S cells in
their blood.
Transformation
What happened in the fourth experiment?
 The harmless R cells had been
transformed by material from the dead S
cells
 Descendents of the transformed cells were
also pathogenic
 Why?
Oswald & Avery
What is the transforming material?
 Cell extracts treated with protein-digesting
enzymes could still transform bacteria
 Cell extracts treated with DNA-digesting
enzymes lost their transforming ability
 Concluded that DNA, not protein,
transforms bacteria
Bacteriophages



Viruses that infect
bacteria
Consist of protein and
DNA
Inject their hereditary
material into bacteria
bacterial
cell wall
plasma
membrane
cytoplasm
Figure 13.4b
Page 219
Hershey & Chase’s
Experiments

Created labeled bacteriophages
sulfur – Labels Proteins
 Radioactive phosphorus – Labels Nucleic Acids
 Radioactive
Allowed labeled viruses to infect bacteria
 Asked: Where are the radioactive labels after
infection?

Hershey – Chase Experiment
What is DNA?
DNA is a Nucleic Acid
 Polymer of Nucleotides
 Each nucleotide consists of

 Deoxyribose
(5-carbon sugar)
 Phosphate group
 A nitrogen-containing base

Four bases
 Adenine,
Guanine, Thymine, Cytosine
Nucleotide Structure
Composition of DNA

Chargaff showed:
 Amount
of adenine relative to guanine differs
among species
 Amount
of adenine always equals amount of
thymine and amount of guanine always
equals amount of cytosine
A=T and G=C
Rosalind Franklin’s Work
Was an expert in X-ray crystallography
 Used this technique to examine DNA fibers
 Concluded that DNA was some sort of helix

Watson-Crick Model





DNA consists of two nucleotide strands:
Double Helix
Strands run in opposite directions - Antiparallel
Strands are held together by hydrogen bonds
between bases
A binds with T and C with G
The sides of the ladder are a sugar-phosphate
backbone, while the “rungs” of the ladder are the
bases
DNA is antiparallel
Base-pairing rule
The four bases of DNA are:
Adenine (A) Guanine (G) Thymine
(T) Cytosine (C)
Adenine always hydrogen bonds
with Thymine (A-T)
Guanine always hydrogen bonds
with Cytosine (G-C)
These bonding patterns are called
base pairings (bp)
The pattern of base pairing is the mechanism by which DNA
holds information.
Humans have a > 6 billion of these base pairings
Less than 5% of our DNA actually forms genes
There about 30,000 genes encoded in our DNA, nearly half of
these genes either have yet to be discovered or their function
is unknown
DNA is written out like this:
CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACC
CTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAG
AGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGG
CCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGC
TGGGATCCTGGA
DNA replication
Before mitosis and meiosis, all of the DNA
in the cell must be copied or replicated
 How does this happen?

How does DNA replicate?

Possibilities:
DNA Replication




The mechanism by which DNA is replicated is
considered semi-conservative
Semi-conservative replication: Half of the
original parent DNA molecule is conserved in
each of the daughter molecules.
This allows for the parent DNA to serve as a
template for generating the daughter DNA
molecules
Half of the replicated DNA strand is “old” and
the other half is “new”
DNA
Replication

SemiConservative
new
old
old
new
Basepairing During Replication
• Each old strand serves as a template for
the new complementary strand
Enzymes Required for Replication




Helicase: “Melts” or opens up the double
strand so that the DNA is single stranded
DNA polymerase: multiple types, responsible
for the actual synthesis of DNA
Ligase: Joins together small newly synthesized
pieces of DNA called Okazaki fragments
Primase: Adds an RNA primer so that DNA
synthesis can begin
DNA Replication
• DNA is synthesized
5’ to 3’
• Energy for
synthesis comes
from the removal of
the two phosphates
of the in coming
nucleotide
DNA Replication




Since DNA is antiparallel, synthesis occurs in
opposite directions
One strand in continuously synthesized leading strand (5’3’)
The other is synthesized in short discontinuous
strands - lagging strand (3’5’)
Because of this DNA synthesis is called
Semidiscontinuous
DNA
Replication
DNA Replication
DNA Replication: Fast & Accurate!
It takes E. coli <1 hour to copy 5 million
base pairs in its single chromosome &
divide to form 2 identical daughter cells
 Human cell copies its 6 billion bases &
divide into daughter cells in only few hours
 Remarkably accurate

 only
~1 error per 100 million bases
 ~30 errors per cell cycle
DNA Repair
Mistakes can occur during replication
 DNA polymerase can read correct
sequence from complementary strand
and, together with DNA ligase, can repair
mistakes in incorrect strand
