* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microsatellite wikipedia , lookup
Do Now When you hear “DNA”, what are some thoughts that come to your mind? Where is DNA found? • What organelle is known as the “control center” of the cell? • What structures are found in the nucleus? • Chromosome contain segments called _________ that code for traits. • Genes are made up of __________. The Structure of DNA • DNA = Deoxyribonucleic acid • 3 Components of DNA: Sugar = Deoxyribose Phosphates Nitrogenous bases DNA Looks Like A Ladder • Similar to a ladder: – Sugar + Phosphate = Sides of a Ladder, “Backbone” – Bases = Rungs of a Ladder The Nitrogenous Bases 2 different categories of bases: – Pyrimidines – Purines Pyrimidines • Has 1 Ring • Thymine (T) • Cytosine (C) Purines • Have 2 Rings • Adenine (A) • Guanine (G) Base Pairing • In order to form the rungs of the ladder, the bases need to be paired • A pyrimidine and a purine are paired together – Cytosine (C) + Guanine (G) – Thymine (T) + Adenine (A) • Hydrogen bonds form between the pairs and hold them together Bases: So What? • Different sequences of bases code for different genes/traits. • Each gene has its own unique sequence of letters/bases • Each gene codes for a protein that has its own unique function in a cell. How can 4 letters (A,T,C,G) code for all of our different genes? • Think of the 26 letters in an alphabet • Letters can be combined in endless different ways to form an endless amount words • In the same way, the 4 bases can be combined in endless different ways to form an endless amount of different sequences, resulting in different genes Double Helix • The DNA ladder is actually twisted (coiled)! Double Helix • It looks like a spiral staircase! Why Do You Think DNA Is Coiled? Double Helix • Double helix consists of 2 strands • Each strand consists of… – a sugar-phosphate backbone + a sequence of nitrogenous bases • The two strands complement each other Practice • Write the sequence that complements the following strand: AATCGGGTACGTAGGTCGTAGCT Base Pairing Why do you think a purine is paired with a pyrimidine? Answer • The difference in the number of rings of purines & pyrimidines is important • If 2 purines (which each has 2 rings) paired together, it would be too wide to fit within the backbone • If 2 pyrimidines (which each has 1 ring) paired together, it would be too narrow to fit within the backbone Hands-On Activity: Building a model of DNA