* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genetics Powerpoint for Bio. I
History of genetic engineering wikipedia , lookup
Hybrid (biology) wikipedia , lookup
Point mutation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Gene expression programming wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Genomic imprinting wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Genome (book) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Designer baby wikipedia , lookup
Microevolution wikipedia , lookup
Y chromosome wikipedia , lookup
Neocentromere wikipedia , lookup
Genetics Biology I Chromosomes Centromere ↓ Chromatid Chromatid database of genes that are on each chromosome (hax1, fuca1) Karyotype – spread of human chromosomes to look for chromosomal abnormalities OR Chromosome Terminology Homologous Chromosomes – paired chromosomes – same size, same banding pattern, same type of genes but not necessarily the exact same forms of each gene Example – gene on one chromosome for brown eyes and gene on its homologue for blue eyes GGGTCAGTCATTTTAAGAGATC GGGAAAGTCATTTTAAGAGATC Remember – Sister Chromatids are two halves of the same double chromosome and are exact copies of one another Real Karyotype Down’s Syndrome Karyotype Cell Types and Chromosome Types Diploid – cell with the normal # of chromosomes (2n) Haploid – cell with ½ the normal number of chromosomes (n) Somatic cell – normal body cell Sex Cell, gamete – sperm and egg – haploid cells Germ cell – 2n cell that is the precursor to the gametes Autosomes – chromosomes 1-22 Sex chromosomes – X and Y, necessary to determine sex, but code for many proteins not related to sex and found in all cells Meiosis – cell division process that produces the sperm and egg (n) Purpose of Meiosis Egg n To make haploid sex cells so that when they come together, the zygote has the normal amount of DNA (2n) Sperm n Fertilization → Mitosis Zygote 2n Embryo Steps of Meiosis Germ Cell (2n) in G1 (46 single chromosomes) S-Phase – copy all DNA so after have 46 double chromosomes When Chromosomes form in meiosis I – 46 doubles Chromosomes form and homologous pairs come together Crossing over in Prophase I Homologous Pairs line up down center Still 46 doubles or 23 double pairs Each daughter cell has 23 double chromosomes – no longer have pairs – just one of each pair Meiosis I is the reduction division because the cell went from 46 chromosomes or 23 pairs to just 23 chromosomes The daughter cells are now haploid but they don’t yet have ½ of the DNA of the orginial germ cell, they must undergo meiosis II Chromosomes reform in the two daughter cells Each individual chromosome lines up down the center and sister chromatids split Now that sister chromatids split – we have 23 single chromosomes – ½ the DNA of a normal cell – this is the finished sex cell Summary Meiosis happens only in ovaries and testes to make sperm and egg Sperm and egg have only 1 of each pair of chromosomes and are haploid Sex cells come together to make a zygote that contains a pair of each chromosomes again and is diploid Meiosis Animation Mitosis vs. Meiosis Egg vs. Sperm Each germ cell forms 4 sperm of equal size Sperm form everyday throughout life in a male Each germ cell forms 1 large egg (cytoplasm divides unequally and small cells disintegrate) Females are born with all of the eggs they will ever have Sexual Reproduction Brings about Variation by: Crossing Over Independent Assortment Random Fertilization Amount of variation due to IA – 2n In humans = 2 23 = 8 million 8 million x 8 million = 64 TRILLION combinations Crossing Over makes this almost infinite Chromosomal Abnormalities Trisomy or Monosomy due to non-disjunction during meiosis Chromosomal deletions (a piece of a chromosome breaks off) Chromosomal Translocations (whole or parts of chromosomes) Chromosomal Inversions Non-disjunction causes trisomy’s, monosomy’s, and aneuploidy Chromosomal Abnormalities Translocation of chromosome 13 and 14 – normal phenotype Translocation Abnormality Philadelphia Chromosome A piece of chromosome 22 is translocated to chromosome 9 causing Chronic Myelogenous Leukemia Chromosomal Deletions Each chromosome 22 on the right of each pair is missing a piece Cri-du-chat – have a deletion from chromosome #5 and the babies sound like a cat crying – mental retardation and heart disease Mendel Mendelian Principles Alleles – different forms of the same gene Dominant – gene that is seen Recessive – only seen if with another recessive allele Homozygous – having 2 like alleles Heterozygous – having 2 different alleles Genotypes – actual gene make-up for a particular locus or trait Phenotypes – visible trait Mendelian Laws Law of Segregation - When the gametes form – each gamete receives only 1 of each pair of alleles. Law of Independent Assortment – If genes aren’t on the same chromosome (linked) they will not have to remain together in the gamete Independent Assortment Pairs: Red and Green Yellow and Black Brown and White Brown String and White String Line up you pairs as in Metaphase I Pick a side to be the gamete Independent Assortment Red = red hair, thin eyebrows, long fingers, and genetic disease for cystic fibrosis, light skin Green = brown hair, bushy eyebrows, short fingers, normal, dark skin Yellow = big nose, hairy fingers, can’t taste sour things, tall Black = small nose, no hair on fingers, can taste sour things, short Brown = slow metabolism, blue eyes, great cholesterol receptors, 5 fingers on each hand, dark skin White = fast metabolism, brown eyes, slightly misshapen cholesterol receptrs. 6 fingers on each hand, light skin White String = light skin, unibrow, mishappen clotting enzyme Brown String = dark skin, separated brows, normal clotting enzyme Punett Squares – Mono and Di-Hybrid Crosses Used to calculate the probability of having certain traits in offspring Figure out all possible gametes for male and females Place them on the outside of the square Cross the gametes to come up with the possible genotypes and phenotypes of the offspring Story of Mendel and Punnett Squares Beyond Mendel Incomplete Dominance – the phenotype in the heterozygous condition is a mix of the two (white and red snapdragons make pink) Co-dominance – both alleles are expressed in heterozygous condition (A,B blood types, Roan cattle) This can become a “gray” area in diseases – Tay Sachs – make ½ normal protein and ½ misshapen – do not exhibit disease so recessive but moleculary have both expressed so is it co-dominance or even incomplete if has a slight effect ???? Multiple Alleles More than two allele choices although always only have 2 alleles at each gene locus Example: Human Blood Types Alleles = A, B, & O (also an example of co-dominance) Paternity Testing? Blood Types Blood Type A B AB O Antigens on blood cells Genotype Body will make Ab against Person can Donate to: Person can Receive From: Sex-Linked Located on a sex chromosome Usually is X-linked (few known genes on the Y) X-linked usually show more in males since only have 1 allele – only need 1 recessive allele to show Pedigrees Used to figure out genotypes of family members to see if someone is carrying a disease gene Used to determine the mode of inheritance Practice Higher Genetics Pleiotropy – one gene effects many traits Polygenic – one trait determined by many genes – continuous pattern Multifactorial – may be multiple genes and the environment Chromosomal Inheritance Aneuploidy – abnormal chromosome # (ex. Trisomy) Polyploidy – 3n, 4n (nondisjunction of all chromosomes) More normal than aneuploid – some plants live fine but can only reproduce with other polyploid plants 2n egg and 1n sperm = 3n Or Zygote replicates DNA but doesn’t divide = 4n Sex Chromosomes and Chromosomal Inheritance Non-disjuction of sex chromosomes XXY – Klinefelter’s (small testes, sterile, breasts) XYY – taller, more aggressive?? Males XXX – normal female XO – Turner’s Syndrome (no secondary sex characteristics, sterile, short)