Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Epigenetics in stem-cell differentiation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Telomerase reverse transcriptase wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Genetics of Cancer Part 2 Review • Two mutations must occur: Review • Two mutations must occur: • Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division Review • Two mutations must occur: • Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division • Tumor Suppressor Gene inactivated (brakes disconnected from accelerating car) What else must happen? • External controls overcome • Cells not limited by: Crowding Lack of attachment Lack of nutrients What else must happen? • Telomerase must be present to create cellular immortality. What else must happen? • Telomerase must be present to create cellular immortality. • Most human cells divide 50-100 times before entering G0 permanently or committing cell suicide (apoptosis) Telomerase • OK, but…how does a cell know it has divided 50-100 times??? Telomerase • OK, but…how does a cell know it has divided 50-100 times??? • Tips of chromosomes are capped with a sequence of bases (TTAGGG) repeated 1000’s of times. • Each division removes 50-200 of these bases Telomerase, con’t • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG Shortening… • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG Shortening, until… • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG Shortening, until… • TTAGGGTTAGGGTTAGGG • It can’t divide any longer! Stem Cells • Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly must keep dividing! Stem Cells • Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly - must keep dividing! • Telomerase is an enzyme that rebuilds the telomeres (adds TTAGGG) • If telomeres don’t get shorter, cells don’t get older Back to cancer cells… • Cancer cells have a mutation that allows the production of telomerase. • Leads to cells being immortal that should die out. • Telomerase = gas tank! Metastasis must spread cancerous cells • Cells spread via the circulatory or lymphatic system • 99% of cancer cells die en route, but some lodge in capillaries or lymph nodes • Cancer cells can break down material between cells to travel within tissues, leading to new colonies Cancer and inheritance • Two-hit hypothesis: TSG’s are inherited in pairs (as are all genes) and both copies must be mutated since they function as recessive alleles Cancer and inheritance • Inherited one mutant TSG? You’re prone to developing cancer early in life (middle age or earlier) • Two good TSG’s? Cancer may come later in life, if at all. Cancer and inheritance • Inheritance is only a small part of developing cancer (15% of the risk of colon cancer is due to inheritance, breast cancer 7%) • Environmental factors often more important determinant p53 • “THE GUARDIAN OF THE GENOME” p53 • “THE GUARDIAN OF THE GENOME” • Your primary TSG • Mutated in 55% of all cancers p53 • Activated when DNA damage is bad • 1st - Halts cell cycle p53 • Activated when DNA damage is bad • 1st - Halts cell cycle • 2nd - Starts DNA repair and restarts cell cycle if successful p53 • Activated when DNA damage is bad • 1st - Halts cell cycle • 2nd - Starts DNA repair and restarts cell cycle if successful • 3rd - Causes apoptosis (cell suicide) if repair unsuccessful Review • Gas pedal = Review • Gas pedal = protooncogene Review • Gas pedal = protooncogene • Brake = Review • Gas pedal = protooncogene • Brake = tumor suppressor gene Review • Gas pedal = protooncogene • Brake = tumor suppressor gene • Gas tank = Review • Gas pedal = protooncogene • Brake = tumor suppressor gene • Gas tank = Telomerase (adds telomeres TTAGGG) Review • Two-hit hypothesis? Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell? Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell = p53 Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell = p53 • Cell suicide? Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell = p53 • Cell suicide = apoptosis