Download Slide 1

Unit 4 - Molecular Genetics
Recall Notes on DNA!
Complete Lab Exercise 4.1.1:
Evidence of Hereditary Material
DNA Replication and Repair
During cell division in eukaryotic cells, the
replicated genetic material in the nucleus is _____
________________________________________.
It is important that each _________________has
an ___________of the parent cell’s DNA.
DNA replication is ____________________
Steps to Replication
1. Replication begins at a ________________on the DNA known as
the ___________________.
The two strands of DNA are held together by ______________and
are twisted to form a ________________.
To expose a __________________, the DNA must be ___________.
2. The _________________________________ the double helix by
breaking the __________________between base pairs.
3. Base pairs want to ___________, so ____________________
________________________ bind to the exposed DNA single
strands and ____________________________
4. _________________ is an enzyme that relieves any
_____________ brought about by the _______________ of
the DNA (bacteria)
__________ _____ both strands of DNA, allowing them to
___________, then _____________ the cut strands.
Replication begins in ___________________from the origin(s)
______________________________________
____________________________are built as soon as an area of the
DNA has been unwound.
Where two strands of DNA are unwound, where they are joined is called
_______________________________
DNA replication moves _______________________________________
__________________________________________________________
______________________________are the three enzymes known to
function in _____________________. __________________requires a
template to start synthesizing a new complementary DNA strand.
5. The enzyme _______________ lays down _______________that will be
used by _________________________as a starting point to build
6. DNA polymerase III adds the appropriate ___________________
_______________________________ to the __________of the
new strand using the template strand as a guide.
____________________is built continuously __________ the
replication fork. (5' to 3')
___________________composed of short segments of DNA,
known as ____________________, is built in pieces ______ from
the replication fork.
7. __________________excises the ________________and
replaces them with the appropriate deoxyribonucleotides.
8. ______________joins the gaps in the ______________by the
creation of a ____________________ bond.
9. __________________________________.
If mistakes are found the act as an ____________________,
excising incorrectly paired nucleotides and replacing.
DNA Organization
In the nucleus, the human genome is organized into _____________________
Chromosomes consist of DNA wrapped around protein - called _______________
Every __________ nucleotides, the DNA is coiled around a core group of __________
____________________, known as ___________________. (+ve histones attracted to -ve
charged DNA.
________________= nucleosome
_______________________ coil into chromatin fibres.
Chromatin fibres then ___________________ into chromatin
Chromatin coils again to form a ________________________
Different organisms have different # of chromosomes.
____________________of DNA codes for proteins.
________ of the human genome is _________________.
Noncoding regions are filled ________________________________
(repeating sequences - TAGTAGTAGTAG)
The ____________________________have long sequences of
repetitive noncoding DNA, known ______________________.
Repetitive DNA sequences are also found in the region of the
_____________________, which play a role ___________________.
Chromosomes also contain _________________________.
(sequence similar to a functioning gene _______________________).
Two types
- LINEs ___________________________________________
SINEs ____________________________________________
The function of LINEs and SINEs is not clear.
Protein Synthesis
____________________experiments with garden peas
laid the foundation for genetics.
His results led to the idea that “____________” were
responsible for the patterns of inheritance
Today these are known as ____________, and they direct
the production of ______________.
Garrod’s Hypothesis
The physician Archibald Garrod was the first to hypothesize
that ______________________________________in 1909
George Beadle and Edward Tatum
Thirty-three years later, these 2 were able to demonstrate
_______________ the relationship. Summarized this
relationship as the _______________________________.
Vernon Ingram
Now known as the ___________________________
(genes also code for _____________) V.I.
demonstrated the relationship while studying the
______________________of hemoglobin from
individuals with _____________________.
Even though this an effective way to think of genes,
science has recently ___________________________and
found that there seem to be "only" about _____________.
The problem is humans produce at least ______________
different _____________________ !!
The research is still ongoing today, but it looks like a
___________ can code for _______________. (More later)
So how are proteins made?
DNA contains the __________________, but their seem to be many
complications if it is the DNA that gives rise to protiens:
- DNA is too _________________ to be allowed out of the __________.
- Only ___________of DNA in a cell:
Protein is required ____________________.
Proteins need to be _______________________________
The answer is _____________________.
DNA is ________________ into an RNA message and then ____________
Transcription
Transcription can be divided into three sequential
processes:
1. __________________
2. __________________
3. __________________.
1. Initiation
Transcription begins when the ______________________binds to
the segment of DNA that is to be ____________________and
______________________________________
It binds to the DNA molecule _____________ of the gene to be
transcribed.
This region is a sequence on one strand of DNA called the
_________________. In most genes it looks like
___________________________________________________
____________________binds to the
_______________ which is the strand of DNA that is
used as a ____________ to build
_________________________________
The other strand of DNA is the _______________and
is ___________transcription. It will be identical in
sequence to ________
2. Elongation
-The __________________________opens the double helix
- It starts building _________ in the direction of ____________.
- RNA polymerase __________________________________.
- The ________________ itself does not _______________.
- The process is similar to that of _______________________.
AGCTTCCGAGATACAGTAATAGC
3. Termination
Elongation continues until __________________recognizes the
end of the gene - ________________________.
At the _____________________, the newly synthesized mRNA
disassociates, ____________________ and the RNA polymerase
released.
Posttranscriptional Modifications
The mRNA (known as ____________________________) needs to be ___________
before leaving the nucleus.
A ____________is added to the start of the primary transcript.
This __________protects the _________________________as it exits the
nucleus. It also plays a role in the ________________________.
A string of approximately ______________are added to the ________________
Genes also contain ___________ regions (_________________) and _________
regions (known as ________________). The __________ are interspersed
among _______________;
_____________________must be removed. The _______ are removed by
________________________.
_______________cut out the _________ and join the remaining _______.
The _______________________.
Unlike DNA replication, there is
____________________enzyme.
This results in more _________________.
Genes are transcribed ________________, so ______
______________________compared to DNA replication.
Only 30000 genes???
T IM E
mRNA TRANSLATION
Once in the ___________ the mRNA it can be ________________.
_____________________ is the process of ____________________of the mRNA into
________________
___________________ind to the mRNA, recognizing the ___________in eukaryotes.
The ribosome consists of two subunits, _____________________________________.
The two subunits clamp around the mRNA and proceed along the mRNA in the ____
____________________________________________________________________ to
the growing polypeptide chain
Reading Code
There are _______________but only _________________in
mRNA.
To code for ________________, a sequence of _________
is used for each amino acid. Each _________ is called a
__________.
Each __________________________________ and more
than one __________ can code for a __________________.
This redundancy minimizes _________ that may
lead to ___________________.
One _______ serves as the ______________and
others serve as _______________
The mRNA is ___________________
Using the genetic code, decipher the following mRNA
sequence:
5' - GGCAUGGGACAUUAUUUUGCCCGUUGUGGUGGGGCGUGA - 3'
The genetic code is _____________. The same
______________is used for translation in ______
____________ from ________________ with only
a few isolated exceptions.
tRNA
In order to synthesize the ____________the
ribosome requires the ______________ to
be delivered to it.
__________________________________.
tRNA's structure resembles a _____________where one arm of tRNA, a
sequence of _________________________________recognizes the
_________________________
The other arm carries the ____________________________
Every tRNA carries only ___________________
(aminoacyl-tRNA)
Therefore at least _____ different ______ are
required, but ________________means ____
possible different types of _______
It has been observed that sometimes ____________of an
anticodon are needed _______________. For example the
anticodon ______________________________which both
code for ____________.
This flexibility makes it possible for ________________to
be added despite ___________________________of
mRNA.
The first codon is the ____________________.
This means that every ______________________
__________________________
The ribosome has two sites for tRNA:
Here is how it works:
1. The tRNA that carries _________________________.
2. The next tRNA ______________________.
3. ____________ is bonded to the _________________.
4.Next the ribosome ____________________________.
This process continues, growing the ____________________
The tRNAs that have been released are recycled by
____________________________________________
The ribosome will eventually reach ________________.
A protein known as a release factor recognizes that the
ribosome has stalled and releases the polypeptide chain
from the ribosome by releasing the 2 subunits of the
ribosome.
Final modifications may include sugars (glycosylation) or
phosphate being added to some of the amino acid residues
and the peptide may also be cleaved at specific places