Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Eukaryotic DNA replication wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA replication wikipedia , lookup
Microsatellite wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA polymerase wikipedia , lookup
DO Now- 2/27 • Blonde hair is dominant to blonde hair. A heterozygous female is crossed with a heterozygous male… Punnett’s Square and phenotype/genotype ratios OR • What is DNA? OR • Where is DNA found? TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Zebrafish booklets and test: last day TODAY! DNA (Deoxyribonucleic Acid) Genetic material of cells… • GENES – units of genetic material that CODES FOR A SPECIFIC TRAIT – Called NUCLEIC ACIDS • DNA is made up of repeating molecules called NUCLEOTIDES DNA STRUCTURE •DNA had specific pairing between the nitrogen bases: ADENINE (A) – THYMINE (T) CYTOSINE (C) – GUANINE (G) •“Complementary Rule”: DNA made of 2 long stands of nucleotides arranged in a specific way Nucleotides – DRAW THIS!!! Phosphate Nitrogenous Base (A, T, C, G) Sugar Nitrogenous Bases • PURINES 1. Adenine (A) 2. Guanine (G) A or G • PYRIMIDINES 3. Thymine (T) 4. Cytosine (C) T or C DNA Double Helix “Rungs of ladder” Nitrogenous Base (A,T,G or C) “Legs of ladder” Phosphate & Sugar Backbone 5 O 3 3 O P 5 O C G 1 P 5 3 2 4 4 2 3 1 P T 5 A P 3 O O P 5 O 3 5 P Chargaff’s Rule • Adenine must pair with Thymine • Guanine must pair with Cytosine • Their amounts in a given DNA molecule will be about the same. T A G C BASE-PAIRINGS H-bonds G C T A DNA Structure Review Questions 1. What does DNA stand for? 2. DNA is made of repeating units of __________________ 3. A nucleotide is made of: …? 4. Draw a nucleotide. 5. What are the 4 nitrogenous bases? 6. What are the two PURINES? Are they Big or little? DO Now- 2/28 • What makes up DNA? OR • Draw a picture of what DNA looks like? OR • What are the 4 bases? TAKE YOUR MITOSIS PROJECTS HOME!!!! I’m throwing them out tmw. Students Run Quiz Thursday A HISTORY OF DNA • Discovery of the DNA double helix A. Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless bacteria into deadly bacteria (1928) B. Rosalind Franklin - X-ray photo of DNA. (1952) C. Watson and Crick - described the DNA molecule from Franklin’s X-ray. (1953) History Continued • Hershey & Chase– • Chargaff— Chargaff’s rules. • 1952, proved DNA determined proteins • Using ratio of nitrogenous bases • Used bacteria and in DNA, showed bacteria viruses to complimentary show DNA bases. responsible for heredity Genetic Diversity… • Different arrangements of NUCLEOTIDES in a nucleic acid (DNA) provides the key to DIVERSITY among living organisms. The Code of Life… • The “code” of the chromosome is the SPECIFIC ORDER that bases occur. A T C G T A T G C G G… See p. 297 DNA is wrapped tightly around histones and coiled tightly to form chromosomes • Questions: • Complete the questions on page 202 on a separate piece of paper (1 – 11). Please write the question and just your answer. – Skip question 2 and 10 • #5 just the definitions of the 3 words Do Now – 3 /19 1.What is the structure of DNA? OR 1.What are nucleotide bases? STEP 1: Helicase unwinds, unzips STEP 2: DNA polymerase adds bases as it reads strand (leading and lagging strand) STEP 3: Ligase checks and binds all fragments together (finishing touch) DNA Replication • DNA must be copied • The DNA molecule produces 2 IDENTICAL new complementary strands following the rules of base pairing: A-T, G-C •Replicates using the enzyme DNA polymerase DNA Replication • Semiconservative Model: 1. Watson and Crick showed: the two strands of the parental molecule separate, and each functions as a template for synthesis of a new complementary strand. . DNA Template Parental DNA New DNA DNA Polymerase – Enzyme for DNA Replication Reads original strand 3’ 5’ New strand created 5’ 3’ DNA Helicase – Enzyme that unwinds the DNA DRAW THIS!!!!!!!!! (1961) Watson & Crick proposed… • …DNA controlled cell function by serving as a template for PROTEIN structure. • 3 Nucleotides = a triplet or CODON (which code for a specific AMINO ACID) • AMINO ACIDS are the building blocks of proteins. Replication – Checking for Understanding 1. Why is replication necessary? 2. Who proposed the replication concept? 3. What is the replication process called? 4. Use the complementary rule to create the complementary strand: A---? G---? C---? T---? A---? G---? A---? G---? C---? A---? G---? T---? Questions: • Answer the questions on page 200 (section 3 review) in your notebook • I will check and grade them before you leave. DNA Replication Review Question • Draw a picture of DNA replication at the replication fork. • What are the 2 enzymes involved in replication? • What is DNA replication called (the name of the model proposed by Watson and Crick)? • What is the difference between the leading and lagging strands? • What is the complementary strand to the following: ATTAGCTAGGACT EXIT TICKET 1. Draw a picture of a DNA strand. 2. Write the complementary strand to the following: AAATTTCCCGGG Do Now – 3/9 1.What are the 3 parts of DNA 2.What are the two enzymes in DNA replication? 3.What is the shape of DNA CHOOSE ONE!!!!!!! CLASSWORK 3/9 • Define the words on page 221 on back of worksheet (Section 1 vocab) • Any 6 questions from the worksheet – Chapter 9 Classwork: • Turn to page 202 in the Biology textbook • One a SEPARATE SHEET OF PAPER: – Answer questions 2, 4, 5, and 8-15 – You MUST write the question Do Now – 4/10 1.What are the 3 parts of DNA 2.What are the 3 steps in DNA replication 3.What are the steps of transcription? CHOOSE ONE!!!!!!! Transcription and Translation: An Overview (aka the Central Dogma) DNA Transcription – in nucleus RNA Translation – in cytoplasm, on ribosomes Protein RNA vs. DNA DNA • Double stranded • Deoxyribose sugar • Bases: C,G A,T RNA • Single stranded • Ribose sugar • Bases: C,G,A,U Both contain a sugar, phosphate, and base. • DNA can “unzip” itself and RNA nucleotides match up to the DNA strand. • Both DNA & RNA are formed from NUCLEOTIDES and are called NUCLEIC acids. Transcription • DNA RNA • Happens in the NUCLEUS • RNA forms base pairs with DNA – C-G – A-U • mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus STEP 1: RNA Primer binds to the parent DNA strand before gene to be transcribed • STEP 2: Unwind DNA sequence (RNA Polymerase) • STEP 3: Produce primary transcript by stringing together the chain of RNA nucleotides (RNA Polymerase) RNA polymerasecomplex of enzymes, like DNA polymerase mRNA Processing • Primary transcript is not mature mRNA • DNA sequence has coding regions (exons) and noncoding regions (introns) • Introns must be spliced out before mRNA can leave nucleus TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACU Classwork: 1. In your notebook, fill out the two charts below with 3 facts in each box: RNA DNA Transcription Translation 2. What is RNA polymerase? 3. What would be the corresponding mRNA sequence for the following DNA strand: ATTCGATTCGATATACTAGCTAGCT Do Now 4/11 1. What is RNA polymerase? OR 2. What would be the corresponding mRNA sequence for the following DNA strand: ATTCGATTCGATATACTAGCTAGCT Q4 Project: Genetic Disease In your paper: In your visual: • 2 pages single spaced handwritten Can be a powerpoint, poster, brochure, etc. • 2 pages double spaced typed • You MUST include a bibliography of 3 sources (Textbook is ok) Aesthetics do count!!! Should have pictures and info Q4 Project: Genetic Disease • In your paper: • Symptoms and problems associated • How it is passed through generations (dominant, recessive, sex linked) • When it was discovered, how it was discovered, and by whom (which scientists) • Outcomes and treatments In your visual: Pictures of disease (if appropriate) Major information in bullet point format Should include all information outlined in your paper DUE DATES • Disease Choice: TODAY (10 Points) look on page 181 for ideas (if you have another make sure I clear it first • Rough Draft Due: Friday, April 20th (40 Points) • Final (Visual and Paper): Friday, April 27th (150 Points) • TOTAL: 200 Points, Test Grade Q4 Project: Genetic Disease • RUBRICS Do Now 4/12 1. What are the 4 steps in transcription? OR 2. Compare DNA and RNA. Answers 1. RNA Primer, Unwind DNA, RNA Synthesis (adding new bases), RNA Processing (Introns/Exons)… all steps performed by RNA Polymerase 2. DNA = double stranded, ATCG, deoxyribose RNA = Single stranded, AUCG, ribose Translation • Second stage of protein production • mRNA is on a ribosomes in the cytoplasm • tRNA brings amino acids to the ribosome rRNA = Ribosomes • 2 subunits, separate in cytoplasm until they join to begin translation – Large – Small • Contain 3 binding sites –E –P –A tRNA • Transfer RNA • Bound to one amino acid on one end • Anticodon on the other end complements mRNA codon Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code Reading the DNA code • Every 3 DNA bases pairs with 3 mRNA bases • Every group of 3 mRNA bases encodes a single amino acid • Codon- 3 mRNA bases Translation: Big Picture 1. 2. 3. 4. mRNA binds with the ribosome (rRNA) rRNA “reads” mRNA (every 3 letters) tRNA brings amino acid (3 letters=amino acid) Happens until stop codon, amino acid chain (aka protein) released from rRNA The Genetic Code ACGATA CCC TGA ATTGCGTTAGCTATCG UGCUAUGGGACU UAA What would the amino acids be for the sequence above? Do Now 4/18 1. What are the 4 steps of transcription? OR 2. What are the 4 steps of translation? 1. Transcription - Nucleus 1. RNA primer, Unwinds DNA, RNA Synthesis, mRNA Processing (RNA Polymerase, Intron – junk DNA/Exons - codes) 2. Translation – cytoplasm 1. mRNA binds to ribosomes, rRNA read the mRNA, tRNA brings amino acids, happens till stop codon Practice Problem DNA: TAC TTC CGA AGT AAA mRNA: A.A.: Practice Problem DNA: TAC ATT CGA CGT TAG CAA mRNA:AUG UAA GCU GCA AUC GUU A.A.: Met – Stop – Ala – Ala AUG – Start/ Met Transcription vs. Translation Review Transcription • Process by which genetic information encoded in DNA is copied onto messenger RNA • Occurs in the nucleus • DNA mRNA Translation • Process by which information encoded in mRNA is used to assemble a protein at a ribosome • Occurs on a Ribosome • mRNA protein Which codons code for which amino acids? • Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for • A gene is a segment of RNA that brings about transcription of a segment of RNA DNA Translation • The cell uses information from “messenger” RNA to produce proteins Transcription/Translation Questions 1. Why is transcription necessary? 2. Describe transcription. 3. Why is translation necessary? 4. Describe translation. 5. What are the main differences between DNA and RNA. 6. Using the chart on page 303, identify the amino acids coded for by these codons: UGGCAGUGC 1. Why is transcription necessary? Transcription makes messenger RNA (MRNA) to carry the code for proteins out of the nucleus to the ribosomes in the cytoplasm. 2. Describe transcription. RNA polymerase binds to DNA, separates the strands, then uses one strand as a template to assemble MRNA. 3. Why is translation necessary? Translation assures that the right amino acids are joined together by peptides to form the correct protein. 4. Describe translation. The cell uses information from MRNA to produce proteins. 5. What are the main differences between DNA and RNA. DNA has deoxyribose, RNA has ribose; DNA has 2 strands, RNA has one strand; DNA has thymine, RNA has uracil. 6. Using the chart on page 303, identify the amino acids coded for by these codons: UGGCAGUGC tryptophan-glutamine-cysteine AMAZING DNA FACTS… • DNA from a single human cell extends in a single thread for almost 2 meters long!!! • It contains information equal to some 600,000 printed pages of 500 words each!!! (a library of about 1,000 books) LET’S REVIEW DNA… LM p.44 1. List the conclusions Griffith & Avery, Hershey & Chase drew from their experiments. 2. Summarize the relationship between genes & DNA. 3. Describe the overall structure of the DNA molecule. 4. What are the 4 kinds of bases?