Download Investigation of the role of ANKH in ankylosing spondylitis

ARTHRITIS & RHEUMATISM
Vol. 48, No. 10, October 2003, pp 2898–2902
DOI 10.1002/art.11258
© 2003, American College of Rheumatology
Investigation of the Role of ANKH in
Ankylosing Spondylitis
A. E. Timms,1 Y. Zhang,1 L. Bradbury,2 B. P. Wordsworth,2 and M. A. Brown3
Objective. The ank/ank mouse develops a phenotype similar to ankylosing spondylitis (AS) in humans.
ANKH, the human homolog of the mutated gene in the
ank/ank mouse, has been implicated in familial
autosomal-dominant chondrocalcinosis and autosomaldominant craniometaphyseal dysplasia. This study was
undertaken to investigate the role of ANKH in susceptibility to and clinical manifestations of AS.
Methods. Sequence variants were identified by
genomic sequencing of the 12 ANKH exons and their
flanking splice sites in 48 AS patients; variants were
then screened in 233 patients and 478 controls. Linkage
to the ANKH locus was assessed in 185 affected-siblingpair families.
Results. Five single-nucleotide polymorphisms
were identified within the coding region and flanking
splice sites. No association between either susceptibility
to AS or its clinical manifestations and these novel
polymorphisms, or between disease susceptibility and 3
known promoter variants, was seen. No linkage between
the ANKH locus and AS was observed. Multipoint
exclusion mapping rejected the hypothesis of a locus of
a magnitude ␭>1.4 (logarithm of odds score <ⴚ2)
(equivalent to a genetic contribution of >10% to the AS
sibling recurrence risk ratio) within this area contributing to AS.
Conclusion. These findings indicate that ANKH is
not significantly involved in susceptibility to or clinical
manifestations of AS.
Ankylosing spondylitis (AS) is a chronic inflammatory disorder with a prevalence of 1–3 per 1,000 in
white populations (1). It is characterized by inflammation of the spine and sacroiliac joints, initially causing
bone and joint erosion and subsequently, ankylosis.
Arthritis affecting peripheral joints, particularly the hips,
occurs in ⬃40% of cases, and inflammation may also
involve extraarticular sites such as the uvea, tendon
insertions, aorta, lungs, and kidneys. Genetic factors
play a major role in AS: the heritability of susceptibility
to AS assessed in twins is ⬎90% (2), and disease activity
and functional impairment due to AS have heritabilities
of 51% and 68%, respectively (3).
Mice with a loss-of-function mutation in the ank
gene, the human homolog of which is ANKH, develop a
skeletal disorder known as murine progressive arthropathy (4). The phenotype observed in murine progressive arthropathy is similar to that of human spondylarthropathies (5,6). Both murine progressive arthropathy
and AS are characterized by fibrosis and ossification of
articular and periarticular tissues, leading to extensive
spinal ankylosis and the radiographic “bamboo spine”
appearance. The defective gene in the ank/ank mouse
encodes a 54-kd membrane pyrophosphate transporter
with 492 amino acids in 12 exons (7). The protein
contains 7–12 predicted transmembrane spanning domains, each ⬃20 amino acids in length, consistent with
the expected structure of an integral multipass membrane protein (7). In situ hybridization analysis confirms
that the gene is expressed during endochondral and
intramembranous bone development, in tendons and the
superficial layer of articular cartilage (8), as well as in a
variety of other tissues including heart, brain, liver,
spleen, lung, muscle, and kidney.
We have recently identified a mutation in ANKH
which causes familial autosomal-dominant calcium py-
1
A. E. Timms, BSc, Y. Zhang, MB, MSc, DPhil: Wellcome
Trust Centre for Human Genetics, Headington, UK; 2Linda Bradbury,
B. P. Wordsworth, MBBS, MRCP: Oxford University Institute of
Musculoskeletal Sciences, Nuffield Orthopaedic Centre, Headington,
UK; 3M. A. Brown, MBBS, MD, FRACP: Wellcome Trust Centre for
Human Genetics and Oxford University Institute of Musculoskeletal
Sciences, Nuffield Orthopaedic Centre, Headington, UK.
Mr. Timms and Dr. Zhang contributed equally to this work.
Address correspondence and reprint requests to M. A.
Brown, MBBS, MD, FRACP, Spondyloarthritis and Bone Disease
Research Group, Oxford University Institute of Musculoskeletal Sciences, Nuffield Orthopaedic Centre, Windmill Road, Headington,
Oxford, UK. E-mail: [email protected].
Submitted for publication February 19, 2003; accepted in
revised form June 13, 2003.
2898
ANKH IN AS
2899
Table 1. Characteristics of the unrelated AS patients and the control
subjects*
AS patients
(n ⫽ 233)
Controls
(n ⫽ 478)
No. (%) male/no. (%)
148 (63.5)/85 (36.5) 264 (55.2)/214 (44.8)
female
BASDAI
3.9 ⫾ 2.0
BASFI
3.2 ⫾ 2.5
Age at disease onset, years
21.5 ⫾ 6.5
Disease duration, years
13.4 ⫾ 8.8
* Except where indicated otherwise, values are the mean ⫾ SD. AS ⫽
ankylosing spondylitis; BASDAI ⫽ Bath AS Disease Activity Index;
BASFI ⫽ Bath AS Functional Index.
rophosphate dihydrate chondrocalcinosis (9) (OMIM
118600), and this finding has been confirmed in other
study populations (10). The mutation in the ank/ank
mouse causes elevation of intracellular pyrophosphate
(PPi) and reduction of extracellular PPi, resulting in
deposition of hydroxyapatite crystals. In contrast, in
human calcium pyrophosphate dihydrate chondrocalcinosis the mutation in the ANKH gene is thought to be a
gain-of-function mutation, leading to elevated extracellular PPi (11). Mutations of the ANKH gene have also
been implicated in autosomal-dominant craniometaphyseal dysplasia (OMIM 123000), a rare autosomally inherited condition characterized by abnormal mineralization of membranous and enchondral bone causing
thickening of craniofacial bones, widened long-bone
metaphyses, and increased cortical thickness (12,13).
Because of the similarity of the disease phenotype in the ank/ank mouse to human AS, we sought to
test the hypothesis that variation in the ANKH gene is
involved in the susceptibility to, or the clinical manifestations of, AS.
PATIENTS AND METHODS
Unrelated AS patients (n ⫽ 233) and 185 AS affectedsibling-pairs were identified from several sources: the Royal
National Hospital for Rheumatic Disease AS Database, patients attending the Nuffield Orthopaedic Centre, in response
to public appeals, and by referral from British rheumatologists.
All patients had been seen by a qualified rheumatologist to
confirm AS, as defined by the modified New York criteria (14).
White British healthy control subjects (n ⫽ 478) were blood
donors recruited from the National Blood Service (Oxford).
Data on the unrelated AS cases and controls are summarized
in Table 1. The 185 families included 422 affected and
genotyped individuals (277 [66%] male, 145 [34%] female),
comprising 236 affected-sibling-pairs, 69 parent-child pairs,
and 43 other affected-relative pairs.
Patients completed a questionnaire containing a selfassessment of clinical features, including the Bath Ankylosing
Spondylitis Functional Index (BASFI) (15) and the Bath
Ankylosing Spondylitis Disease Activity Index (BASDAI) (16).
Age at disease onset was defined as the age at the onset of
spondylarthropathy symptoms. This study was approved by the
Central Oxford Research Ethics Committee (project CM
95.061).
Direct sequencing was used to screen the ANKH
coding region and upstream 550-bp promoter region for
polymorphisms. Polymerase chain reaction (PCR) products
were sequenced using ABI Big Dye chemistry (PE Applied
Biosystems, Warrington, UK) and run on ABI 377 automated
DNA sequencers (PE Applied Biosystems). Sequences were
compared using Factura and Sequence Navigator (PE Applied
Biosystems). Because of difficulty obtaining a clean sequence,
the region from 550 bp to 1,300 bp 5⬘ of the ANKH coding
region was cloned and then sequenced. The region was
first amplified by PCR, after which products were checked
for purity and size in 2% agarose gels, and the DNA bands
purified using a gel extraction kit (Qiagen, Crawley, UK).
The PCR products were then cloned using the TOPO
cloning system (Invitrogen, Leek, The Netherlands). Positive
clones were identified by PCR and grown in LB medium
overnight, prior to DNA extraction using a Qiagen Miniprep
kit. The inserted sequence in the extracted DNA was then
sequenced.
The polymorphisms ⫺978DEL and IVS8⫹15 T⬎G
were genotyped by PCR–restriction digest using the primers
shown for promoter ⫺978 and exon 8 in Table 2, and the
respective restriction enzyme (either Hinp I or Bsp EI), and
visualized by electrophoresis on 4% agarose gels. The variants
⫺4 T⬎C, 294 G⬎A, 963 A⬎G, and IVS2⫹8 G⬎A were all
typed by SNaPshot (PE Applied Biosystems) using the primers
listed in Table 2. Electrophoresis was performed on ABI 3700
automated DNA sequencers, and base calling was done using
the program Genotyper (PE Applied Biosystems). Primers
D5S478, D5S2081, D5S1991, D5S1989, and D5S1954 were
used to assess linkage around the ANKH gene. Primers for
typing the microsatellites and the ⫺378–379INS (GGC) and
⫺75–76INS (CCCGTCGC) promoter polymorphisms (see Table 2 for primer sequence) were PCR-amplified using
fluorescence-tagged primers, pooled, and electrophoresed on
an ABI 373 or ABI 377 automated DNA sequencer (PE
Applied Biosystems). Products were sized using GeneScan 672,
version 3.1 (PE Applied Biosystems), and genotypes were
assigned using Genotyper.
Mendelian inheritance was checked manually within
the Genotyper program and automatically with the program
GAS (ftp://ftp.ox.ac.uk/pub/users/ayoung). GAS was also used
to convert the size data into discrete allele numbers. The
program Downfreq (17) was used to calculate allele frequencies. Marker positions were obtained from public databases
(Ensemble [http://www.ensembl.org/], The Human Genome
Project Working Draft [http://genome.ucsc.edu/], and the
Marshfield genetic map [http://www.ncbi.nlm.nih.gov/]).
Two-point nonparametric linkage analyses were performed using Analyze (18). Multipoint nonparametric linkage
analysis was performed using the ALL statistic from the
program Genotyper-Plus (19). ASPEX was used to carry out
multipoint model-free exclusion linkage analysis (20).
Associations between alleles, genotypes, and discrete
variables were assessed by chi-square analysis. Association with
TGACCCACTCTGGGTAGAGG
TGCAGTCCTTCACTCCACTG
CCCCTGTGCTTCTGTCAGTC
GGCTTGTGATTAACATACGAAGG
CGTGCTTCGTCACCTACTGT
GCCCGAGAGACACTCAACAT
AGCAAGCAGGTGGCAGATCTG
ACCCTGGCAGGAAGATGAG
GAAGCCAGCAGATGGAGAAC
AGAATGAATAAGGCACGGGACG
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
3
4
5
6
7
8
9
10
11
12
CCACGTTTCTTTCGCCCCCTC
CGCCCGCCCCTGATTTCCTC
GAGCAGCCGCGCTCGGAGAA
AGATGTGTGTGGGGTCAGC
ACCCTATAAGCTACTTAGTG
Promoter ⫺978
Promoter ⫺378
Promoter ⫺75
Exon 1
Exon 2
Forward PCR primer
CCTGCCATTAAGCTGTACACAC
CAGTTACACACGCCAGAAGG
CTGTCTTTCCCTGCAGACATC
CACCGAACGAGATCTTTATGG
CCCCAACGTCACATTAACCT
TGCCCCTTTACAAAAACCAA
AGTGAAATTTTACATTTGTG
CCCAAACTCCCTGACAACAT
ACCATCCAACCTGGTCAGTG
ACAACGTCAACCGTGAGGCAG
ACTGCGGAGGAGGCAGCTTG
TTCTGCTGACAGCGGCTCCAT
GAAGTCGATGGCTATGTTGG
GCTGGAAAAGTCACCCTTGA
AGAAACATTTGATAATTAGTG
Reverse primer
AAACTGGTGAGCACGAGCAACACAGTCACGGC (963 A⬎G)
GAGCGCCGGGAATTTCACCATAGT (⫺4 T⬎C)
CACCTATCAGTGTGTGAAAGAC (IVS2⫹8 G⬎A)
AAAAAAAACACACTGATAGGTGAGGCC (294 G⬎A)
SNaPshot extension primer
Primers used in polymerase chain reaction (PCR) and SNaPshot reaction studies of ANKH exons and flanking splice sites
Region
Table 2.
2900
TIMMS ET AL
ANKH IN AS
2901
Table 3. ANKH polymorphisms, genotype, and allele frequencies in ankylosing spondylitis patients and control subjects
Location (position [bp])/
change
Promoter (⫺978)†/⫺1 bp
Promoter (⫺378)†/⫹8 bp
Promoter (⫺75)†/⫹3 bp
5⬘-UTR‡ (⫺4)†/C⬎T
Exon 2 (294)/G⬎A
Intron 2 (⫹8)/G⬎A
Exon 8 (963)/A⬎G
Intron 8 (⫹15)/T⬎G
Patients*
Allele 1
Allele 2
1,1
Controls*
1,2
2,2
239 (56.4) 185 (43.6) 73 (34.4) 93 (43.9) 46 (21.1)
208 (48.8) 218 (51.2) 52 (24.4) 104 (48.8) 57 (26.8)
167 (47.2) 187 (52.8) 36 (20.3) 95 (53.7) 46 (26)
385 (90.8) 39 (9.2) 174 (82.1) 37 (17.4) 1 (0.5)
365 (79.3) 95 (20.7) 145 (63)
75 (32.6) 10 (4.4)
416 (89.6) 48 (10.4) 189 (81.4) 38 (16.4) 5 (2.2)
422 (94.6) 24 (5.4) 199 (89.2) 24 (10.8) 0 (0)
367 (80.1) 91 (19.9) 147 (64.2) 73 (31.9) 9 (3.9)
Allele 1
Allele 2
1,1
515 (54.7)
456 (48.2)
444 (47.1)
858 (92.1)
731 (77.8)
803 (89)
903 (95.1)
725 (80.9)
427 (45.3)
490 (51.8)
498 (52.9)
74 (7.9)
209 (22.2)
99 (11)
47 (4.9)
171 (19.1)
147 (31.2)
116 (21.8)
115 (24.4)
394 (84.6)
277 (58.9)
369 (81.8)
428 (90.1)
297 (66.3)
1,2
2,2
221 (46.9) 103 (21.8)
224 (47.4) 133 (28.1)
214 (45.4) 142 (30.2)
70 (15)
2 (0.4)
177 (37.7) 16 (3.4)
65 (14.4) 17 (3.7)
47 (9.9)
0 (0)
131 (29.2) 20 (4.5)
* Values in parentheses are the percentage of each allele or genotype (for each variant, some subjects were not succesfully genotyped). The exonic
single-nucleotide polymorphisms (SNPs) are counted from codon 1 for each exon; the intronic SNPs are counted from the first codon of the intron.
† Distance from ATG start codon.
‡ 5⬘UTR ⫽ 5⬘-untranslated region.
continuous variables was assessed by analysis of covariance
using the program SuperAnova (Abacus Concepts, Berkeley,
CA). A previous segregation study has shown a correlation
within families between the BASFI and disease duration, and
no correlation of age, disease duration, or sex with the
BASDAI (3); therefore, uncorrected values of the BASDAI
were used, whereas BASFI values were corrected for disease
duration.
RESULTS
Direct genomic sequencing of the 12 ANKH
exons and their flanking splice sites in 48 AS patients
identified 5 novel single-nucleotide polymorphisms
(SNPs): 2 within the coding region (294 G⬎A and 963
A⬎G), 2 at intron–exon boundaries (IVS2⫹8 G⬎A and
IVS8⫹15 T⬎G), and 1 in the 5⬘-untranslated region (⫺4
T⬎C). The genotype findings for these polymorphisms
and 3 previously reported ANKH variants are presented
in Table 3. No association was demonstrated between
ANKH variants and AS susceptibility, disease severity as
measured by the BASDAI or BASFI (corrected for
disease duration), or age at disease onset. The study had
⬎90% power at a P value of ⬍0.05 (2-tailed) to detect
allelic association with susceptibility to AS with a relative risk of ⱖ1.5–2.1, depending on the SNP concerned.
With regard to the BASDAI, BASFI, and age at disease
onset, the effect size (in standard deviations) that could
be detected with the same power and significance ranged
from 0.3 to 0.7.
No significant linkage with disease susceptibility
was observed with the microsatellite markers D5S478,
D5S2081, D5S1991, D5S1989, and D5S1954. With
model-free multipoint exclusion mapping, the hypothesis that a locus of a magnitude ␭ⱖ1.4 within this region
contributes to AS (logarithm of odds score ⬍⫺2) (equivalent to a genetic contribution of ⱖ10% to the AS
sibling recurrent risk ratio, assuming multiplicative interaction between loci [21]) was rejected.
DISCUSSION
This study provides strong evidence that ANKH is
not significantly involved in ankylosing spondylitis. Sequencing identified 5 polymorphisms within the coding
region and exonic flanking sites, which were genotyped
along with 3 known polymorphisms within the promoter
region. No association of any ANKH variant with disease
susceptibility, disease severity as measured by the BASDAI and BASFI, or age at disease onset was seen. With
multipoint exclusion mapping of the region where
ANKH maps, the presence of a gene contributing ⱖ10%
of the recurrence risk in AS (␭ ⫽ 1.4) was excluded.
The ectopic calcium hydroxyapatite deposits seen
in the ank/ank mouse are thought to be due to defective
transport of PPi, resulting in low extracellular levels of
PPi, and hydroxyapatite deposition (7). The association
between disordered pyrophosphate metabolism and spinal ossification can also be seen in the tiptoe-walking
mouse (ttw), a model of the human condition ossification of the posterior longitudinal ligament (OPLL), in
which spinal ossification and hydroxyapatite arthropathy
also develop (22). The ttw mouse phenotype is caused by
a non-sense mutation causing dysfunction of the gene
that encodes nucleotide pyrophosphatase (NPPS), an
enzyme that produces PPi from nucleotide pyrophosphate. The human homolog of this gene is encoded at
chromosome 6q22-23, and variants of the gene have
been associated with development of OPLL (23). Decreased serum NPPS activity, which would be expected
to promote hydroxyapatite deposition, has been reported in human AS (24).
2902
TIMMS ET AL
Thus, in both ank/ank and ttw mice, low extracellular PPi fails to inhibit calcium hydroxyapatite deposition, resulting in spinal ossification with some resemblance to human disorders such as diffuse idiopathic
skeletal hyperostosis, OPLL, and AS (for review, see ref.
11). Whether other genes involved in PPi metabolism
and transport are involved in human AS remains an
untested hypothesis, but the ANKH gene has no significant role in AS in our population.
REFERENCES
1. Calin A. Ankylosing apondylitis. In: Maddison PJ, Isenberg DA,
Woo P, Glass DN, editors. Oxford Textbook of Rheumatology.
Vol. 2. Oxford: Oxford University Press; 1998. p. 1058–70.
2. Brown MA, Kennedy LG, MacGregor AJ, Darke C, Duncan E,
Shatford JL, et al. Susceptibility to ankylosing spondylitis in twins:
the role of genes, HLA, and the environment. Arthritis Rheum
1997;40:1823–8.
3. Hamersma J, Cardon LR, Bradbury L, Brophy S, van der HorstBruinsma I, Calin A, et al. Is disease severity in ankylosing
spondylitis genetically determined? Arthritis Rheum 2001;44:
1396–400.
4. Sweet HO, Green MC. Progressive ankylosis, a new skeletal
mutation in the mouse. J Hered 1981;72:87–93.
5. Mahowald ML, Krug H, Taurog J. Progressive ankylosis in mice:
an animal model of spondylarthropathy. I. Clinical and radiographic findings. Arthritis Rheum 1988;31:1390–9.
6. Mahowald ML, Krug H, Halverson P. Progressive ankylosis (ank/
ank) in mice: an animal model of spondyloarthropathy. II. Light
and electron microscopic findings. J Rheumatol 1989;16:60–6.
7. Ho AM, Johnson MD, Kingsley DM. Role of the mouse ank gene
in control of tissue calcification and arthritis. Science 2000;289:
265–70.
8. Sohn P, Crowley M, Slattery E, Serra R. Developmental and
TGF-beta-mediated regulation of Ank mRNA expression in cartilage and bone. Osteoarthritis Cartilage 2002;10:482–90.
9. Williams CJ, Zhang Y, Timms A, Bonavita G, Caeiro F, Broxholme J, et al. Autosomal dominant familial calcium pyrophosphate
dihydrate deposition disease is caused by mutation in the transmembrane protein ANKH. Am J Hum Genet 2002;71:985–91.
10. Pendleton A, Johnson MD, Hughes A, Gurley KA, Ho AM,
Doherty M, et al. Mutations in ANKH cause chondrocalcinosis.
Am J Hum Genet 2002;71:933–40.
11. Timms AE, Zhang Y, Russell RG, Brown MA. Genetic studies of
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
disorders of calcium crystal deposition. Rheumatology (Oxford)
2002;41:725–9.
Nurnberg P, Thiele H, Chandler D, Hohne W, Cunningham ML,
Ritter H, et al. Heterozygous mutations in ANKH, the human
ortholog of the mouse progressive ankylosis gene, result in craniometaphyseal dysplasia. Nat Genet 2001;28:37–41.
Reichenberger E, Tiziani V, Watanabe S, Park L, Ueki Y,
Santanna C, et al. Autosomal dominant craniometaphyseal dysplasia is caused by mutations in the transmembrane protein ANK.
Am J Hum Genet 2001;68:1321-6.
Van der Linden SM, Valkenburg HA, de Jongh BM, Cats A. The
risk of developing ankylosing spondylitis in HLA–B27 positive
individuals: a comparison of relatives of spondylitis patients with
the general population. Arthritis Rheum 1984;27:241–9.
Calin A, Garrett S, Whitelock H, Kennedy LG, O’Hea J, Mallorie
P, et al. A new approach to defining functional ability in ankylosing spondylitis: the development of the Bath Ankylosing Spondylitis Functional Index. J Rheumatol 1994;21:2281–5.
Garrett S, Jenkinson T, Kennedy LG, Whitelock H, Gaisford P,
Calin A. A new approach to defining disease status in ankylosing
spondylitis: the Bath Ankylosing Spondylitis Disease Activity
Index. J Rheumatol 1994;21:2286–91.
Ott J. Strategies for characterizing highly polymorphic markers in
human gene mapping. Am J Hum Genet 1992;51:283–90.
Satsangi J, Parkes M, Louis E, Hashimoto L, Kato N, Welsh K, et
al. Two stage genome-wide search in inflammatory bowel disease
provides evidence for susceptibility loci on chromosomes 3, 7 and
12. Nature Genet 1996;14:199–202.
Kong A, Cox NJ. Allele-sharing models: LOD scores and accurate
linkage tests. Am J Hum Genet 1997;61:1179–88.
Hauser ER, Boehnke M, Guo S-W, Risch N. Affected-sib-pair
interval mapping and exclusion for complex genetic traits: sampling considerations. Genet Epidemiol 1996;13:117–37.
Brown MA, Laval SH, Brophy S, Calin A. Recurrence risk
modelling of the genetic susceptibility to ankylosing spondylitis.
Ann Rheum Dis 2000;59:883–6.
Okawa A, Ikegawa S, Nakamura I, Goto S, Moriya H, Nakamura
Y. Mapping of a gene responsible for twy (tip-toe walking Yoshimura), a mouse model of ossification of the posterior longitudinal ligament of the spine (OPLL). Mamm Genome 1998;9:
155–6.
Nakamura I, Ikegawa S, Okawa A, Okuda S, Koshizuka Y,
Kawaguchi H, et al. Association of the human NPPS gene with
ossification of the posterior longitudinal ligament of the spine
(OPLL). Hum Genet 1999;104:492–7.
Mori K, Chano T, Ikeda T, Ikegawa S, Matsusue Y, Okabe H, et
al. Decrease in serum nucleotide pyrophosphatase activity in
ankylosing spondylitis. Rheumatology (Oxford) 2003;42:62–5.