Download Final Quiz - GEP Community Server

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Biochemistry wikipedia, lookup

Nucleic acid analogue wikipedia, lookup

Deoxyribozyme wikipedia, lookup

Genetic code wikipedia, lookup

Point mutation wikipedia, lookup

Amino acid synthesis wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

Gene wikipedia, lookup

Biosynthesis wikipedia, lookup

RNA-Seq wikipedia, lookup

Vectors in gene therapy wikipedia, lookup

Genomic library wikipedia, lookup

Community fingerprinting wikipedia, lookup

Exome sequencing wikipedia, lookup

Silencer (genetics) wikipedia, lookup

Promoter (genetics) wikipedia, lookup

Transcript
Final Quiz
BIMM 173
Spring 2010
Name:_______________________________
Log on to UCSC Genome browser and find Contig 30 from D. mojavensis Sept. 2008.
You will be focusing just on Contig 30.4.
1. List the steps, in order, that you would use to determine what gene is in Contig
30.4.
2A. What is the name of this gene? (note that gene names are written in lower case)
2B. What chromosome is this gene on in D. melanogaster?
3. How many exons are in this gene?
4. What tool did you use to figure out the number of exons?
5. How many partial or complete exons are predicted for this particular gene by
Genscan?
6. What is Genscan?
7. Name 2 features that Genscan uses to identify genes?
8A. Write the first 8 amino acids of exon #1 from D.melanogaster.
8B. What are the first 8 amino acids of your exon 1 sequence?
8C. Describe as specifically as you can how you figured out the first 8 amino acids of
your exon 1 sequence. What tool(s) and sequence(s) did you use? Make sure you
indicate the type of sequence(s) you used (i.e. DNA, RNA, protein?) and list the steps.
9. What frame is exon 1 in?
10. Where does exon 1 end in your contig? Provide base numbers and explain how
you know where the end of the exon is.
11A. Locate the beginning of exon 2. What is the base number?
11B. What is the phase and the frame of exon 2?
12. Is the entire gene on this contig? How do you know?
13. When switching from exon to exon, we must maintain: (circle correct answer)
A. Phase
B. Frame
C. Both
D. Neither
14. You are given the amino acid sequence listed below. Identify the splice sites,
phase, and any abnormalities that may have occurred in each of the DNA
sequences.
MPATGSL
ATGCCGGCATGGGTTCATTTCATACTTGGTACTGAAGGGTAGCTTATAA
Phase:
Any Abnormality?
ATATGCCGGCATGGGGGCAGGATTTGAAAAAGTAAATGGTAGTAGCTTATAA
Phase:
Abnormality?
GATGCCGGCATGGGTTCATTTCATACTTGGTACTGAAGGTAGCTTATAA
Phase:
Any abnormality?
15A. What 3 elements of conservation are most important when annotating
orthologs?
15B. What is an ortholog?
16. What do the number 28, 29, and 30 represent?
17. What do the jagged lines and the triangular lines above the gray bars in the
above figure indicate?
18. Which tool in consed generates the curved black line between 41 and 43 and
what does it identify?
19. There are 10 different rows of letters. Please answer the following
questions about this screen shot.
A. Which of them contains actual data?
B. What is the definition of a consensus sequence?
C. What is the difference between the capital letters and the small letters?
D. What does an * signify?
E. What do the arrows indicate?
20. What does an in silico digest examine about the completed contig?
21. In general terms, what do Phred/Phrap perform in Consed?
22. Crossmatch looks for specific regions within the sequence. What does it
analyze?
23. What critical role does a dideoxyribonucleoside triphosphate play in a
Sanger sequencing reaction?
24. Identify the sequencing read errors that caused the following errors.
25. You have just discovered a brand new species of 12-legged spider and you are
dying to analyze its DNA sequence, to be able to compare it to other spiders.
Fortunately (or not) for you, you accidentally start off the process by accidentally
stepping on the spider and killing it. Beginning with scooping up the dead spider off
the floor, list the main steps (5 or less) that you would use to get to the point of
putting DNA into a sequencing machine.
Ala
Asn
Cys
Glu
His
Leu
Met
Pro
Thr
Tyr
A
N
C
E
H
L
M
P
T
Y
Alanine
Asparagine
Cysteine
Glutamic acid (Glutamate)
Histidine
Leucine
Methionine
Proline
Threonine
Tyrosine
Arg R
Asp D
Gln Q
Gly G
Ile I
Lys K
Phe F
Ser S
Trp W
Val V
Arginine
Aspartic acid (Aspartate)
Glutamine
Glycine
Isoleucine
Lysine
Phenylalanine
Serine
Tryptophan
Valine