Download multiple choice

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Replisome wikipedia, lookup

Helitron (biology) wikipedia, lookup

DNA replication wikipedia, lookup

United Kingdom National DNA Database wikipedia, lookup

DNA polymerase wikipedia, lookup

DNA nanotechnology wikipedia, lookup

Microsatellite wikipedia, lookup

DNA profiling wikipedia, lookup

Eukaryotic DNA replication wikipedia, lookup

Homologous recombination wikipedia, lookup

DNA repair wikipedia, lookup

Helicase wikipedia, lookup

Telomere wikipedia, lookup

Transcript
Multiple Choice.
_____The base thymine is always paired with ___.
A.
B.
C.
D.
Adenine
Guanine
Cytosine
Thymine
_____The sequence of one strand of DNA is 5’ TCGATC 3’. The sequence of the complementary strand would be
A.
B.
C.
D.
E.
5’ AGCTAG 3’
5’ TCGATC 3’
5’ CTAGCT 3’
5’ GCTAGC 3’
5’ GATCGA 3
_____ DNA polymerase III is thought to add nucleotides
A.
B.
C.
D.
E.
to the 5' end of the RNA primer
to the 3' end of the RNA primer
in the place of the primer RNA after it is removed
on single stranded templates without need for an RNA primer
in the 3' to 5' direction
_____ DNA replication in vivo is discontinuous due to
A.
B.
C.
D.
E.
polymerase slippage
trinucleotide repeats
being restricted to synthesis in the 5' to 3' direction
topoisomerases cutting the DNA in a random fashion
sister chromatid exchange
_____ Considering the structure of double stranded DNA, what kinds of bonds hold one complementary strand to the other?
A.
B.
C.
D.
E.
ionic
covalent
Van der Waals
hydrogen
hydrophobic and hydrophilic
_____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA
polymerase is able to initiate chains.
A.
B.
C.
D.
E.
origin of replication
restriction endonuclease
palindrome
primer
promoter
_____ The RNA polymerase that produces the primer necessary for DNA synthesis is called the ___.
A.
B.
C.
D.
E.
origin of replication
convertase
primase
ligase
topoisomerase
_____ ___ is an enzyme that catalyzes the formation of a covalent bond between adjacent 5'-P and 3'-OH termini of separate
fragments of DNA.
A.
B.
C.
D.
E.
origin of replication
convertase
primase
ligase
topoisomerase
_____ __ are enzymes that introduce single strand breaks, change the relationship of the strands and then seal the break to remove
underwinding or overwinding of the DNA helix.
A.
B.
C.
D.
E.
helicases
twistases
shoutases
topoisomerases
ligases
_____ The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups
are called ____ bonds.
A.
B.
C.
D.
E.
phosphodiester
hydrogen
hydrophobic
hydrophilic
ionic
_____ Which of the following is not an essential attribute that a biological molecule would need to be a useful genetic material?
A.
B.
C.
D.
E.
It must carry all of the information needed to direct the specific organization and metabolic activities of the cell
It must replicate accurately so that the information it contains is precisely inherited by the daughter cells
It must be capable of undergoing occasional mutations, such that the information it carries is altered in a heritable way
It must have highly repetitive DNA sequences.
All are essential attributes of useful genetic material.
_____ Clusters of highly repetitive DNA located near the centromeres and telomeres are called
A.
B.
C.
D.
E.
Nucleosomes
Euchromatin
Chromatids
Heterochromatin
30 nm chromatin
_____ E. coli genomic DNA differs from a eukaryotic chromosome in that E. coli DNA
A.
B.
C.
D.
Has a single centromere
Has telomeres
Is circular
Does not undergo supercoiling
_____ A chromosome with its centromere in the terminal end is a
A.
B.
C.
D.
Submetacentric chromosome
Metacentric chromosome
Acrocentric chromosome
Telocentric chromosome
_____ Which of the following is true regarding RNA processing?
A.
B.
C.
D.
E.
Spliceosomes are present in organelles and nuclei
Involves removal of exons
Involves removal of one or more introns.
Occurs in prokaryotes
None of the above
_____ Which of the following features is common to both DNA replication and transcription?
A.
B.
C.
D.
E.
Nucleotides are added to the 5' end of the newly synthesized strand
A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate
Deoxyribonucleotides are incorporated into the growing sequence
Both RNA and DNA polymerase require oligonucleotide priming
Both RNA and DNA polymerase initiate at promoter sequences
_____ Normal self-termination of transcription occurs due to the presence of
A.
B.
C.
D.
stem-loop sequences in mRNA
Termination proteins
Multiple RNA polymerase molecules
Polyribosome formation
_____ The four ribonucleotide triphosphates incorporated into mRNA are
A.
B.
C.
D.
E.
Inosine, Guanine, Uracil, Thymine
Adenine, Guanine, Cytosine, Thymine
Cytosine, Uracil, Adenine, Guanine
Thymine, Uracil, Guanine, Cytosine
Inosine, Guanine, Adenine, Cytosine
_____ To describe the genetic code as degenerate indicates that
A.
B.
C.
D.
E.
mRNA is rapidly degraded
The code is not universal among organisms
Some amino acids have more than one codon
Frameshift mutations are tolerated
Stop codons may have corresponding tRNA molecules
_____ Which of the following is unique to eukaryotic mRNA synthesis?
A.
B.
C.
D.
Polycistronic mRNA
Coupled transcription-translation
Removal of introns
Polysomes
_____ Which of the following is unique to prokaryotic mRNA synthesis?
A.
B.
C.
D.
E.
Coupled transcription-translation
Exon processing
3' polyadenylation
mRNA capping
Promoter sequences
_____ Which of the following is true regarding the machinery of translation?
A.
B.
C.
D.
E.
Initiation usually begins at an AUG codon
Eukaryotes have nuclear ribosomes
Polycistronic mRNA usually has a single ribosome binding site
tRNAs released from the ribosome are degraded
Termination is at inverted repeats
_____ Nutritional mutants
A.
B.
C.
D.
E.
Grow on minimal medium
Lack an essential metabolic protein
Are also called prototrophs
Are the same as carbon-source mutants
Are usually antibiotic resistant
_____ The process of producing a RNA polymer from a DNA template is called __.
A.
B.
C.
D.
replication
transcription
translation
duplication
_____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __.
A.
B.
C.
D.
replication
transcription
translation
duplication
_____ Which of the following is not true for histones?
A.
B.
C.
D.
E.
They are rich in basic amino acids
They are associated with the nucleosome.
H1, H2, H3 and H4 form the nucleosome core.
They are found in the nucleus.
H1 functions as a monomer.
_____ Which of the following is not true about chromosome structure?
A.
B.
C.
D.
E.
A telomere is always on the end of a eukaryotic chromosome.
A centromere is always in the middle of a eukaryotic chromosome
A chromatid is a chromosome that has been replicated but has not yet separated from its sister chromatid.
The kinetichore is the site of attachment of the centromere to the nuclear spindle apparatus.
Heterochromatin are primarily associated with the centromere and telomere regions.
Short Answer. (variable points)
The table to the right shows the results of a series of experiments
to determine the sequence of intermediates in a biochemical
pathway. 5 independent auxotrophic mutants which all require
compound G (an amino acid) as a nutritional supplement were
analyzed with 5 compounds that are precursors in the synthesis of
compound G. Each mutant was grown on a minimal medium
supplemented with each of the indicated compounds. + indicates
growth that is supported by the indicated precursor. What is the
order of the intermediates in the pathway and indicate which step
in the pathway is catalyzed by each mutant.
Compound tested
M
u
t
a
n
t
1
2
3
4
5
A
+
B
+
+
+
C
+
+
D
+
+
+
+
E
-
G
+
+
+
+
+
The following 5 questions refer to the numbers on this figure.
A. What end (5' or 3') of the molecule is indicated by arrow number 1?
B. What end (5' or 3') of the molecule is indicated by arrow number 8?
C. What kind of nucleic acid is indicated by arrow number 4?
D. What do you call the short DNA fragments indicated by arrow number 5?
E. What enzyme functions to join the short fragments indicated by arrow number 6?
F. Which enzyme is indicated by arrow number 2?
Translate the following mRNA
5’ GAGGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAU
GGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’
Meselson and Stahl used a heavy form of nitrogen to demonstrate semi-conservative DNA replication. Bacterial cells were grown in
the presence of heavy nitrogen until all the DNA contained the heavy form. The bacteria were then transferred to a medium that only
contained the light form of nitrogen. At different time points, DNA was isolated from the bacteria and subjected to density gradient
ultracentrifugation. Use the following test tube pictures to indicate the location of the DNA band(s) at the beginning of the
experiment, after 1 generation, after 2 generations and after 4 generations.
Starting DNA.
1 Generation
2 Generations
4 Generations
Complete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group.
Short Essay (6pts). Answer one of the following three questions.
1. List the enzymes and proteins involved in DNA replication. Describe the function of each.
2. Describe the structure of eukaryotic chromatin from the basic building blocks to the compact structure found in metaphase cells.
Include all proteins involved in forming the structure and all intermediate structures
3. Using boxes or lines as a schematic representation of template DNA, mRNA and protein, diagram the parts indicated below (from a
prokaryote).
A) Promoter -10 and -35
B) AUG
C) Ribosome binding site
D) Coding sequence
E) Transcriptional terminator
F) Amino and carboxyl ends of the resulting protein.
Bonus question. (4 pts)
One of the earliest drugs used to treat patients with HIV infections was the nucleotide analog AZT. A nucleotide analog has a
structure and function similar to a nucleotide. Some of the nucleotide analogs being used to treat HIV infections are called dideoxy
nucleotides. Dideoxy nucleotides include a ribose sugar that lacks both a 2’ and 3’ hydroxyl group. Based on what you know about
nucleic acid synthesis, what effect do you think these analogs have on viral nucleic acid synthesis.