Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
DNA sequencing wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA & Protein Synthesis Notes 2. Name___________________________assign.#______ UNIT GOALS: – Distinguish between ________ and __________. – Explain the role of DNA in ___________________ and ____________________ cellular information. – Describe the relationships between changes in DNA and potential appearance of __________ __________ including – alterations during replication, insertions, deletions, substitutions, mutagenic factors, radiation, chemicals. – Examine the use of DNA _______________ in forensics, medicine and agriculture. DNA 4. Location Function 5.-9. Person/persons Time Period Conclusions / What we learned from them Fredrick Griffith Oswald Avery Rosalind Franklin & Maurice Wilkins Erwin Chargaff Watson & Crick 13. STRUCTURE of DNA: 1- ________________ ____________ 2- ______________ A Nucleotide _______________ 3- Held together by _______________ _____________. Made of _______________ ______________________. 14. DNA is a ________________ ________________. Nucleic acids are made of _____________________. 15. DNA is a long chain of _______________. There are ___ nucleotides. Nucleotide parts 1: _______________________ DNA molecule. 2: _______________________ 3:________________________ 16. 4 Bases The sides of the ladder are made up of ______________ and __________________. What is the sugar? ________________________ 17. ___ always pairs with ___, & ___ always pairs with ____. (Chargaff’s Rule) 18. Would thymine be able to pair up with guanine? _______ 20. The sequence of nucleotides forms the __________ _______________ information of an organism. 1 DNA Replication (Making Copies) 21 Before a cell divides it needs to ______________ ___ _____________ of its DNA. 22. DNA has the unique ability to make an _______ copy of itself in a process called ___________. Chromosome Structure: 23. DNA is packed very ____________ in the _____________. Human nucleus has ____ meter of DNA! Smallest human chromosome has 30 _______________ base pairs. 24. A chromosome has DNA and protein-___________. Tiny sections of DNA are called __________. 25. Before cell division, the DNA must be _____________________ exactly. Each strand can be used to make __________ _______________ strand. 26. Many ________________ are involved. 27. -29. Steps 1. The two parent strands are unwound and unzipped with the help of DNA ___________. 2. DNA polymerase attaches new _________________ to the parent strands **Each new strand formed is a complement of one of the original, or parent, strands. 31. The replication of DNA is called _______-_______________________ replication. Because the parent strand is used to _________ the two _______ strands. The parent strands are unwound with the help of __________ _____________ (an enzyme). It is unwound at the __________________________ bubble. 32. **When all of the DNA in the chromosomes of the cell have been copied by replication, there are now ______ ___________ of the genetic information that will be ________ _____ to new cells during ______________ or to new generations through the process of ____________. What’s the other side? Enzymes involved in replication: Why does the cell need to make copies of the DNA? 34: 35. Title:”___________________ ______________________” Process called: Process called: 31. Where are proteins made? _____________ Can the DNA leave the nucleus? _________ How does the “code” get to the ribosome? _______________________________________ 2 37.-47. Protein Synthesis Step 2: ________________________ Step 1: _______________________ Location:___________ Location:___________ A _____________________ of the DNA is made…the copy is called _________________ ______ or mRNA. The mRNA ___________ ______ _________ to the ribosome. During transcription the DNA__________________ and RNA nucleotide are ______________ _____ with the DNA bases. The section that is copied is called a ___________. The gene contains the ____________for a protein. Once the mRNA copy is made, it can _____ _____ the ribosome to be to make a ____________ (translated) To have the correct translation of the code, mRNA __________ must join with the correct ______________ of the tRNA. There are _______ amino acids. _______ brings the amino acids to the ribosome. o The three letter code on the mRNA is called a ______________. o The three letter code on the tRNA that is matched up with the mRNA is called an ____________________.. 40. Compare and Contrast: Transcription/ Translation Practice: DNA What is the correct Amino Acid Sequence? RNA DNA: A C G T A T C G A T C G T A C # of Strands Bases DNA: T C C C G T A T G C T A G T C G T A Sugar Leave the nucleus? 48. Eukaryotic DNA processing: Sometimes the DNA is cut up before it leaves the nucleus. Exon - RNA sequences in the primary transcript that are found in the mRNA Intron - RNA sequences between exons that are removed by splicing 49. Answer:_____ #1 DNA 50. Answer:______ T A C C G C 51. Answer:______ T C C G C C 52. Answer:______ G T C G A C A A T There are ________different amino acids. ______ bases ______ for each amino acid. A C C A C T mRNA _____________________________________________________________________________ tRNA _____________________________________________________________________________ AAs _____________________________________________________________________________ #2 DNA ________________________________________________________________________________ mRNA A U G tRNA ________________________________________________________________________________ AAs ________________________________________________________________________________ A C U A G C U G G G G G U A U U A C U U U U A G 3 Mutations • • Every so often genes do change. A sudden change in the genetic code is called a ___________. • Most mutations have little or no ___________ on the organism. • Mutations can be spontaneous or may be caused by environmental factors called ________________. Mutations in DNA usually occur through one of two processes: 1- DNA damage from environmental agents such as : ____________, ______________, ________________, ___________________ (ex: substances in tobacco products) 2- Errors that occur when a cell replicates its DNA in preparation for cell division. • • 56. ______________ An enzyme may “fix” the wrong base. Types of Mutations 1. _______ _______ ________________ The substitution of one amino acid for another during protein synthesis. Can be harmless or it change the entire protein. Ex: _______-________ anemia 2. _________________ mutation _____________ or _______________ When one or more base pairs are __________ into a DNA molecule or __________ from it. Causes a reading frame shift during _____________. DNA Technology 61. Forensics: DNA fingerprinting is used to __________________ people through a process known as DNA fingerprinting. 63. Gel electrophoresis: Scientist ____________ up DNA into ____________ using enzymes. They load the pieces into a ____________ and run electricity through the _______. The pieces of DNA move to the other end of the gel. The smaller pieces move farther. The gel is then __________________ to a known sample. 66. Medicine: Researchers use recombinant DNA technology to analyze genetic changes. They cut, splice together, and insert the modified DNA molecules from different species into bacteria or another type of cell that rapidly replicates and divides. The cells copy the foreign DNA right along with their own DNA. An example of this is the gene for ___________ ______________ inserted into a bacterium. This is how human insulin is mass produced. 68. Agriculture: Sheep are used in the production of alpha-1 antitrypsin, which is used in the treatment of emphysema. • Goats are also producing the CFTR protein used in the treatment of cystic fibrosis. • The buds of ____________plants are vulnerable to worm attacks. The buds of a modified cotton plant resist these ____________, resulting in increased cotton production. • These gene insertions are ecologically ____________ than pesticides. They affect only the _______________ pest. Cloning • Plant biologists have used DNA technology to produce plants with many _____________ _________. These include increased disease resistance, herbicide resistance, and increased nutritional content. 4 73. Scientists today have developed genetically ____________ __________. Among them are strains of bacteria that • eat up ________ ___________ • manufacture alcohol and other _____________ • process _______________. Make human ___________ There is ______________about possible ____________ to the environment and the general population as genetically engineered bacteria are introduced. DNA - The Double Helix DNA & RNA COLORING In 1953, James Watson and Francis Crick established the structure of DNA. The structure is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates pink (one is labeled with a "p"). Color all the deoxyriboses blue (one is labeled with a "D") . The rungs of the ladder are pairs of 4 types of nitrogen bases The bases are known by their coded letters A, G, T, C. These bases always bond in a certain way. Adenine will only bond to thymine. Guanine will only bond with cytosine. This is known as the "Base-Pair Rule Color the thymines orange. Color the adenines green. Color the guanines purple. Color the cytosines yellow. Note that that the bases attach to the sides of the ladder at the sugars and not the phosphate. The two sides of the DNA ladder are held together loosely by hydrogen bonds. Color the hydrogen bonds gray. Messenger RNA So, now, we know the nucleus controls the cell's activities through the chemical DNA, but how? It is the sequence of bases that determine which protein is to be made. The only problem is that the DNA is too big to go through the nuclear pores. So a chemical is used read the DNA in the nucleus. That chemical is messenger RNA It takes the "message" of the DNA to the ribosomes and "tells them" what proteins are to be made. Messenger RNA is similar to DNA, except that it is a single strand, and it has no thymine. Instead of thymine, mRNA contains the base Uracil. In addition to that difference, mRNA has the sugar ribose instead of deoxyribose. RNA stands for Ribonucleic Acid. Color the mRNA as you did the DNA, except: **Color the ribose a DARKER BLUE, and the uracil brown. Color the images according to the instructions DNA - The Double Helix 5 Online Biology Activities Name__________________________________________________ Part I. DNA Workshop Click “DNA Workshop”. Click “DNA Replication” 1) Match up the bases. What were the last three bases you had to put in the new strand? ___, ___, ___ Click Protein Synthesis 2) What is the 1st codon that you produced (start at the top) ___________________ Click OK 3) What are the 3 amino acids in the protein? _________________, _________________, _______________ Part II. GEL ELECTROPHORESIS VIRTUAL LAB Go through the tutorial. Answer the questions as you go. 1. How can scientist sort and measure pieces of DNA? 2. What is the gel made of? 3. Where do you place the DNA? 4. What makes the DNA move? 5. Which strands move the quickest? 6. Why do we stain the DNA? Now it’s your turn! 7. What was the purpose of putting the combs into the gel? 8. What is the purpose of the loading buffer? 9. What was the purpose of the size standard? 10. What do you think the charge on a DNA molecule is? 11. Why did you stain the gel? 12. What are the sizes of the 3 pieces of DNA that you ran? Look carefully! (“bp” stands for base pairs) 13. Give an example of the usefulness of gel electrophoresis. 14. What are restriction Enzymes? Part III. Genetics Science Learning Center What is DNA? (http://gslc.genetics.utah.edu/) ***Click on the link that says "Tour the Basics" ***Keep clicking “next”. 1. What does DNA stand for? __________________________________________________________________ 2. Why is DNA called a blueprint? _______________________________________________________________ 3. The "twisted ladder" shape of the DNA molecule is called a __________________________________________ 4. Name the four bases found in a DNA molecule. ___________________________________________________ 5. A DNA strand is made of ______________ which make up _______________ which make up sentences. 6. These “sentences” are called ________________________________________________________________ On the top bar click: What is a Gene? Hint - Look at the navigation bar at the top, you'll need to click on "What is a Gene" to continue. 6 7. What is a gene? __________________________________________________________________________ 8. Blood cells use a protein called _______________________ to capture and carry oxygen. 9. When a gene is changed, it is said to be _______________________________________________________ 10. A mutation in the hemoglobin gene cause what disorder? ___________________________________________ On the top bar click: What is a Chromosome? 11. If you stretched the DNA from a cell out, how long would it be? _______________ 12. How many chromosomes are in a human cell? ___________ in a mosquito? ________ a carp? _________ On the top bar click: What is a protein? 13. How is a protein like a car engine? ____________________________ 14. Receptor proteins are responsible for picking up ___________________ 15. Each gene in DNA encodes information on how to make a _________________________ 16. Once in the cytoplasm, the _______________ reads the message. Part IV: Engineer a Crop – Transgenic Manipulation ***Read and answer the questions as you complete the animation. 1. How do you create a transgenic plant? 2. What does the gene from the bacterium Bt (Bacillus thuringiensis) produce? Click “Begin” – Follow the steps and read the information after each step to answer the questions. 1. What did you add to the vector? 2. What is a vector? 3. Once the bacterium is inside a plant cell, what is it capable of doing? 4. Why did you put the bacterium in the growth medium? 5. Why did you add small pieces of tomato plant leaves to the Argobacterium? 6. Why did you move the plant cells to the growth medium? 7. What happens to the cells when you spray the herbicide on the leaf cuttings? Which cells are capable of growing as a result of the herbicide? 8. Why did you add the plant to the growth chamber? 9. How did you test to see if the tomato plant was resistant? VIDEO CLIPS ON WEBSITE: RNA & DNA Manipulation 7 1. What is in the nucleus? 2. What is DNA responsible for? 3. How is RNA different from DNA? How is it similar? 4. How many Amino acids are there? 5. What do restriction enzymes do? Where were they first found? 6. Give 2 things we can now do with recombinant DNA. Understanding the impact of Gene Alteration (video clip on website) 1. What did the “Human Genome Project” do in 2003? Transgenics 1. What is a transgenic organism? 2. How did they alter the cow? What can the cow now do? 3. What are the pigs growing for people? Manipulation of DNA- Using genes therapy to replaces defective or missing genes 1. What is gene therapy? 2. How do the genes get into the cell? Manipulation of DNA- Separation of DNA Fragments Using Gel Electrophoresis 1. How did they get the fragments of DNA? (What cut them up?) 2. What is Gel Electrophoresis used for? 3. What do the fragments of DNA do in the gel when electricity is run through it? DNA and Protein Synthesis Review name_______________________________ DNA STRUCTURE: 8 1. What do the letters DNA stand for?___________________________________________________ 2. The “backbone” of the DNA molecule is made up of two components, what are these? _______________________________ and _______________________________ 3. What are the four different bases? a. _______________________________ _______________________________ c. _______________________________ _______________________________ b. d. 4. Write the complementary sequence to following DNA strand: AATTCGCCGGTATTAGACGTT 5. DNA REPLICATION: 6. Why would a strand of DNA need to replicate? ______________________________________ 7. Describe what happens when a strand replicates? _____________________________________ _____________________________________________________________________________ 8. Why is it called semi-conservative replication? _______________________________________ _____________________________________________________________________________ PROTEIN SYNTHESIS: 9. Consider the following DNA strand: Write the sequence of bases for the product of transcription here: Remember! transcription produces RNA using the DNA strand as a template! ½ DNA Strand: TAC CGT TCT GCT AAA TAT ACC ACT 10. What is the third codon in the mRNA you produced in? ______ 11. What would be the the third anticodon? ______ 12. What is the function of the following in translation? Messenger RNA: _____________________________________ Ribosome: __________________________________________ Transfer RNA: ______________________________________ 13. What is the relationship between codon and anticodon? Why is it important? _________________ _____________________________________________________________________________ _____________________________________________________________________________ 14. Using the mRNA you produced in #9, what is the sequence of amino acids in the protein? _______________________________________________________ MUTATIONS: 15. What is a mutation? ____________________________________________________________ 9 16. Are mutations good or bad? Explain? ________________________________________________ ____________________________________________________________________________ 17. What are 3 basic types of mutation? ________________________________________________ 18. Fill in the missing information: DNA TECHNOLOGY: 19. How can DNA technology (information) be used in medicine? _______________________________ _____________________________________________________________________________ 20. How can DNA technology (information) be used in agriculture? ______________________________ _____________________________________________________________________________ 21. How can DNA technology (information) be used in Forensics? _______________________________ _____________________________________________________________________________ 22. Which suspect is responsible for the crime (sample DNA taken from crime scene)? ____________ 23. What is a transgenic organism? ______________________ ______________________________________________ 24. What are restriction enzymes? ______________________ ______________________________________________ 25. What is recombinant DNA? _________________________ ______________________________________________ BIOLOGY ACTIVITY: Gene Mutations and Proteins 10 Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: 1. Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. 3. Use the table on page 303 to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. Original Strand of DNA Original ½ of DNA strand A A T T G A A C A C A T G C G C C C mRNA from Protein (Amino Acid Sequence) 4. 1st MUTATION: If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. Original ½ of DNA strand A A T T G A A C A C A T G C G C C C mRNA Protein (Amino Acid Sequence) How is this protein different from the original protein in #3 (before the mutation)? _________________________________________________________________________________________ What type of mutation took place? __________________________________ 5. 2nd MUTATION: If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Original ½ of DNA strand A A T T G A A C A C A T G C G C C C mRNA Protein (Amino Acid Sequence) How is this protein different from the original protein in #3 (before the mutation)? _________________________________________________________________________________________ What type of mutation took place? __________________________________ Mutation information: There are five possible results of a mutation. 11 1. Silent mutation: When a base pair is substituted but the change still codes for the same amino acid in the sequence: ________________________________ Ex: TCT and TCC both code for the amino acid Serine Original Strand: AGTAGCTAGCTGACGT 7. What type of mutation is this? Mutated Strtand: AGTAGCAAGCTGACGT 2. Substitution: When a base pair is substituted and the new codon codes for a different amino acid: Ex: TCT codes for Serine and CCT codes for Proline ________________________________ FROM YOUR BOOK: 3. Premature Stop: When a substitution results in the formation of a STOP codon before all of the codons have been read and translated by the ribosome. Ex: GTGGTCCGAAACACC –– GTGGTCTGAAACACC Val-Val-Pro-Asn-Thr Val-Val-STOP 4. Codon Deletion or Insertion: A whole new amino acid is added, or one is missing from the mutant proton: Ex: GTGGTCCGAAACACC –– GTGGTCTGCCGAAACACC Val-Val-Pro-Asn-Thr Val-Val-Cys-Pro-Asn-Thr 5. Frame Shift: When a deletion or insertion results in a different base pair being the beginning of the next codon, changing the whole sequence of amino acids Ex: GTGGTCCGAAACACCT ––-- GTGGTCGAAACACCT Val-Val-Pro-Asn-Thr Val-Val-Glu-Thr-Pro QUESTIONS: 1. Which type of mutation is responsible for new variations (alleles) of a trait? _____________________________ 2. Which type of mutation results in abnormal amino acid sequence? ___________________________________ 3. Which type of mutation stops the translation of the mRNA? _____________________________________ 4. Are all mutations bad? Explain. _________________________________________ _________________________________________ _________________________________________ 5. What type of mutation is this? Original Strand: AGTAGCTAGCTGACGT Mutated Strtand: AGTAGCCTAGCTGACGT ________________________________ 6. What type of mutation is this? Original Strand: AGTAGCTAGCTGACGT Mutated Strtand: AGTAGCTAGTGACGT 12