Download From Genes to Proteins - Yale Center for Teaching and Learning

The Case of PKU:
From Genes to Proteins
Team EUREKA!
Norris Armstrong
Bill Barstow
Peggy Brickman
Phil Cunningham
Mike Hanna
Dave Njus
Bill Wischusen
Michelle Withers
Facilitators: Lillian Tong & Millard Susman
Teaching Challenge
• Students:
– have difficulty visualizing the role of
the key components in translation.
– become mired in the details of
transcription/translation & miss
larger concept about how genotype
determines phenotype.
– see molecular processes of gene
expression as separate from
classical genetics/inheritance.
Learning Objectives
• Science Content:
– Students will learn that genes
influence phenotype by determining
amino acid sequence of proteins.
– Students will learn the mechanisms
for transcribing RNA from DNA.
– Students will learn the mechanisms
for translating RNA to protein.
Learning Objectives
• Science Skills:
– Predict from a nucleotide sequence
the appropriate amino acid
sequence.
– Predict how a change in nucleotide
sequence would potentially affect
protein structure.
– Evaluate the impact of different
alleles on phenotype.
– Communicate the relationship
between genotype and phenotype.
Learning Objectives
• General Skills:
– Students will acquire information
and knowledge through
investigation.
– Students will interpret data and
solve problems.
Pre-Activity Assessment
Which of the following best describes the
relationship between a gene and DNA?
a) A gene is composed of many DNA molecules
b) A gene is converted into DNA in the nucleus
c) A gene is a portion of a DNA molecule
d) A gene is used to make DNA
e) There is no relationship between the two
How is the information stored in DNA?
a) In the sequence of amino acids
b) In the sequence of nucleotides
c) In the sequence of covalent bonds
d) In the sequence of phosphate groups
Group Activity
Within the following DNA sequence,
which nucleotides would produce the
amino acid chain shown below?
3’CGGTCGTACAGGTGACGCCAG
5’GCCAGCATGTCCACTGCGGTC
Met-Ser-Thr-Ala-Val
(What information do you need to know in
order to determine this sequence of amino acids? )
Post-Activity Assessment
If the DNA sequence below were shortened by
removing the highlighted nucleotide what would
be the expected result when compared to the
original?
3’CGGTCGTACAGGTGACGCCAGC5’
a) The amino acid sequence would be unchanged.
b) The sequence will be shortened by one amino acid.
c) The amino acid sequence would shortened by several
amino acids.
d) There would be a different sequence of amino acids after
the deletion.
e) No product would be produced.
Day 2
• Prior Knowledge Assessment
• Student Group Activity
– Mechanics of translation
(Chain Elongation)
• Mini-lecture/discussion on
initiation and termination.
• Post Activity Assessment
Day 3
• Open with video clip of PKU
patient.
• Student Activity: Correlate the
changes in nucleotide sequence
of PKU alleles with amino acid
and phenotypic changes with
embedded assessment.
• Summative assessment.
Core Themes: Diversity
• Diversity of the student population:
– High level of Nutrasweet® exposure.
– PKU that affects all populations at significant
frequency.
• Diversity of learning styles:
– Reading and unguided exploration.
– Discussion, reflection, and prediction during
activities.
– Visuals like animations, video clips, and
figures.
Core Themes: Diversity
• Diverse Teaching Techniques:
– Collaborative-team learning activities that
include communicating different problem
solving strategies.
– Inquiry-driven mini-lectures
– Teacher-guided discussions
– Student-guided web searches.
Core Themes: Active Learning
• Exploration and emotional hook using
PKU
• Collaborative Group Activities
– Students uncover the genetic code
and relationships between gene and
protein by converting PKU gene to
protein.
– Instead of covering the stages of
translation, students uncover by
ordering the stages of an unmarked
cartoon.
Arrange the following in order:
A
C
Core Themes: Assessment
• During each class period students will
complete a pre-activity assessment
including in-class questions testing prior
knowledge and/or comprehension of
previously covered material.
• Each class periods’ activities are either
followed by in-class questions or embedded
assessment utilizing student presentations
or written explanations a specific process or
concept. These will be evaluated using a
assessment rubric.
• At the end of the teachable module students
will be assessed using a variety of in class
questions.