Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998. 49:199–222 c 1998 by Annual Reviews. All rights reserved Copyright ° ABSCISIC ACID SIGNAL TRANSDUCTION Jeffrey Leung and Jérôme Giraudat Institut des Sciences Végétales, Unité Propre de Recherche 40, Centre National de la Recherche Scientifique, 1 Avenue de la Terrasse, 91190 Gif-sur-Yvette, France; e-mail: [email protected] KEY WORDS: guard cell, mutants, second messenger, seed development, stress tolerance ABSTRACT The plant hormone abscisic acid (ABA) plays a major role in seed maturation and germination, as well as in adaptation to abiotic environmental stresses. ABA promotes stomatal closure by rapidly altering ion fluxes in guard cells. Other ABA actions involve modifications of gene expression, and the analysis of ABAresponsive promoters has revealed a diversity of potential cis-acting regulatory elements. The nature of the ABA receptor(s) remains unknown. In contrast, combined biophysical, genetic, and molecular approaches have led to considerable progress in the characterization of more downstream signaling elements. In particular, substantial evidence points to the importance of reversible protein phosphorylation and modifications of cytosolic calcium levels and pH as intermediates in ABA signal transduction. Exciting advances are being made in reassembling individual components into minimal ABA signaling cascades at the single-cell level. CONTENTS INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ABA SIGNAL TRANSDUCTION IN SEEDS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Seed Dormancy and Germination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Reserve Accumulation and Acquisition of Desiccation Tolerance . . . . . . . . . . . . . . . . . . . ABA SIGNAL TRANSDUCTION IN STRESS RESPONSE . . . . . . . . . . . . . . . . . . . . . . . . . . Regulation of Gene Expression in Response to Stress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Regulation of Stomatal Aperture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CONCLUSION AND PERSPECTIVES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200 200 200 202 206 207 209 213 199 1040-2519/98/0601-0199$08.00 P1: ARS/ary/rck P2: ARS/plb March 23, 1998 200 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT INTRODUCTION The scientific origins of abscisic acid (ABA) have been traced to several independent investigations in the late 1940s, but it was only in the 1960s that ABA was isolated and identified (1). Mutants affected in ABA biosynthesis are known in a variety of plant species (39, 146). The characterization of these mutants, together with physicochemical studies, has enabled the pathway of ABA biosynthesis to be elucidated in higher plants (134, 135, 146, 166). Two ABA biosynthetic genes have been recently cloned (88, 135) and should provide insights into the regulation and the sites of ABA biosynthesis. A large body of evidence indicates that ABA plays a major role in adaptation to abiotic environmental stresses, seed development, and germination. The present review focuses on our current knowledge concerning how the ABA signal could be faithfully transduced to mediate these well-characterized physiological and developmental processes. Physicochemical and molecular genetic approaches have already provided fundamental insights into the diversity of ABA perception sites and other downstream components that could couple ABA stimuli to particular responses. It should be emphasized that many concepts about the relative importance of these components in the ABA signaling network are far from firmly established. Nonetheless, it is clear that the present development of single-cell systems should allow some of these components to be assembled into minimal signaling pathways within a cellular context. ABA SIGNAL TRANSDUCTION IN SEEDS Endogenous ABA content peaks during roughly the last two thirds of seed development before returning to lower levels in the dry seed (121). ABA is thus thought to regulate several essential processes occurring during the developmental stages that follow pattern formation of the embryo. These processes include the induction of seed dormancy, the accumulation of nutritive reserves, and the acquisition of desiccation tolerance. Seed Dormancy and Germination Exogenous ABA can inhibit the precocious germination of immature embryos in culture (121). Embryos of the ABA-biosynthetic mutants from maize exhibit precocious germination while still attached to the mother plant or vivipary (91). Seeds of the ABA biosynthetic mutants from Arabidopsis thaliana (71, 77) and Nicotiana plumbaginifolia (88) fail to become dormant. These observations support that endogenous ABA inhibits precocious germination and promotes seed dormancy. Thus far, our knowledge on the signaling elements that mediate the regulation of seed dormancy and germination by ABA is primarily derived from genetic analysis. As summarized in Table 1, mutations that alter the sensitivity to ABA P1: ARS/ary/rck P2: ARS/plb March 23, 1998 QC: ARS/uks 12:33 T1: ARK Annual Reviews AR060-09 201 ABA SIGNALING Table 1 Main characteristics of the various mutations known to affect ABA sensitivity Species Hordeum vulgare Zea mays Mutation Dominancea cool vp1 R rea R Phenotype ABA insensitivity in guard cells ABA insensitivity in seeds ABA insensitivity in seeds Constitutive ABA response in callus Craterostigma cdt-1 plantagineum D Arabidopsis thaliana abi1 SD ABA insensitivity abi2 SD ABA insensitivity abi3 R ABA insensitivity in seeds abi4/5 R era1 R ABA insensitivity in seeds ABA hypersensitivityc era2/3 gca1/8 axr2 R jar1 R jin4 R bri1 R sax R Nicotiana plum- iba1 baginifolia (aba1)g a D R Gene productb Ref. 118 Seed-specific 92, 120 transcription factor 144 Regulatory RNA or short polypeptide Protein phosphatase 2C Protein phosphatase 2C Seed-specific transcription factor 31 72, 78, 97 72, 79 38, 72, 102, 108 27 β subunit of farnesyl transferase ABA hypersensitivityc ABA insensitivityd Resistance to auxin, ethylene, and ABAd Resistance to MeJa and hypersensitivity to ABAc Resistance to MeJa and hyper-sensitivity to ABAc Resistance to brassinosteroids and hypersensitivity to ABAd Hypersensitivity to auxin and ABAe Resistance to auxin, Molybdenum cytokinin, and ABAc cofactor biosynthesis 24 24 10 163 143 11 22 f 13, 80 Dominance of the mutant alleles over wild-type; D, dominant; SD, semidominant; R, recessive. Molecular function of the product of the wild-type gene. c Sensitivity of seed germination to exogenous ABA. d Sensitivity of seedling (root) growth to exogenous ABA. e Sensitivities of root growth and stomatal closing to exogenous ABA. f M. Fellner and G. Ephritikhine, personal communication. g The IBA1 locus was renamed ABA1 when it was found that iba1 and other alleles are in fact ABA-deficient, as a result of a defect in the biosynthesis of a molybdenum cofactor that is required for multiple enzymatic activities including ABA aldehyde oxidase (the last step in ABA biosynthesis). b P1: ARS/ary/rck P2: ARS/plb March 23, 1998 202 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT in seeds have been described in maize and in A. thaliana, and several of the corresponding genes have been cloned. The maize vp1 (viviparous1) (119) and rea (red embryonic axis) (144) mutations lead, like ABA biosynthetic mutations in this species, to vivipary. However, vp1 (120) and rea (144) embryos do not have reduced ABA content but rather exhibit a reduced sensitivity to germination inhibition by exogenous ABA in culture. As is discussed below, the VP1 gene encodes a seed-specific transcription factor (92). The A. thaliana ABA-insensitive ABI1 to ABI5 loci were all identified by selecting for seeds capable of germinating in the presence of ABA concentrations (3–10 µM) that are inhibitory to the wild type (27, 72). The abi1 (72), abi2 (72), and abi3 (72, 101, 108) mutants also exhibit, like A. thaliana ABA-deficient mutants, a marked reduction in seed dormancy. These three loci thus seem to mediate the inhibitory effects of endogenous ABA on seed germination. The ABI1 (78, 97) and ABI2 (79) genes encode homologous protein serine/threonine phosphatase 2C (PP2C) (12, 79). The ABI3 gene is the ortholog of the maize VP1 gene mentioned above (38). It is presently unclear whether the ABI1, ABI2, and ABI3 loci act in the same or in partially distinct ABA signaling cascade in seeds (28, 110). Mutations in the ERA1 to ERA3 (Enhanced Response to ABA) loci of A. thaliana were identified by a lack of seed germination in the presence of low concentrations of ABA (0.3 µM) that are not inhibitory to the wild type (24). The era1 mutations also markedly increase seed dormancy. The ERA1 gene encodes the β subunit of a farnesyl transferase, which may possibly function as a negative regulator of ABA signaling by modifying signal transduction proteins for membrane localization (24). The exact relationships between ERA1 and the above-mentioned ABI loci are unknown. Reserve Accumulation and Acquisition of Desiccation Tolerance The accumulation of nutritive reserves and the acquisition of desiccation tolerance are associated with the expression of specific sets of mRNAs (60, 121). Transcripts encoding either storage proteins or late-embryogenesis-abundant (LEA) proteins thought to participate in desiccation tolerance can be precociously induced by exogenous ABA in cultured embryos (60, 121). The characterization of ABA-deficient mutants in A. thaliana (70, 77, 96, 101, 112) and in maize (91, 109) supports a contribution of endogenous ABA in the developmental expression of these genes in seeds. The functional dissection of such ABA-responsive promoters, conducted primarily in transient expression systems, has identified several cis-acting elements involved in ABA-induced gene expression. P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 203 Table 2 cis-acting promoter elements involved in the activation of gene expression by ABA Gene (Species) Element Sequencea Ref. Rab16 (Oryza sativa) Motif I Motif III GTACGTGGC GCCGCGTGGC Em (Triticum aestivum) Em1a Em1b ACACGTGGC ACACGTGCC HVA22 (Hordeum vulgare) ABRE3 CE1 GCCACGTACA TGCCACCGG 138 138 HVA1 (Hordeum vulgare) ABRE2 CE3 CCTACGTGGC ACGCGTGTCCTC 139 139 C1 (Zea mays) Sph CGTGTCGTCCATGCAT 65 AAGCCCAAATTTCACAGCCCGATAACCG 104 CDeT27-45 (Craterostigma plantagineum) 141 107 44 44 a The ACGT core in G-box-type ABREs is underlined. CIS-ACTING PROMOTER ELEMENTS A first category of elements is exemplified by the related motif I of the Rab16 LEA gene from rice (107, 141) and Em1a motif of the wheat Em LEA gene from wheat (44). These sequences share a G-box ACGT core motif (Table 2) and have been designated ABREs, for ABA Response Elements. ABRE-related sequence motifs are present in many other ABA-inducible genes, although their function in ABA signaling often remains speculative in the absence of experimental tests. For instance, only a subset of the multiple ABRE-like motifs present in certain promoters are indeed required for ABA regulation (20, 48, 117, 138, 139). A second type of cis-acting element has been identified in the maize C1 gene, a regulator of anthocyanin biosynthesis in seeds. The ABRE-like motifs present in C1 are not major determinants of the ABA responsiveness of this gene, whereas the distinct sequence motif designated as Sph element (Table 2) is essential for ABA induction of the C1 promoter (65). Multimerized copies of ABREs (107, 141, 155) or of the Sph element (65) can confer ABA responsivity to minimal promoters. Single copies of these elements were, however, not sufficient for ABA response, suggesting that multimerization substituted for other aspects of the native promoter contexts of these elements. In fact, the smallest promoter units designated ABRCs shown to be both necessary and sufficient for ABA induction of gene expression appear to consist of (at least) two essential cis-elements. ABRCs can be composed of two G-boxes as in the case of the wheat Em promoter, where both the Em1a and P1: ARS/ary/rck P2: ARS/plb March 23, 1998 204 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT Em1b G-box motifs (Table 2) contribute to the activity of the 75-bp Complex I (44, 155). In contrast, several other ABRCs consist of an ABRE and of a cis-element not related to G-boxes. The G-box-type motif I and the distinct motif III are essential for the ABA responsiveness of a 40-bp fragment of the rice Rab16B promoter (107). In the barley HVA22 promoter, ABRC1 is a 49-bp fragment that comprises ABRE3 and the Coupling Element CE1 located 20-bp downstream (138). In the barley HVA1 promoter, the 22-bp long ABRC3 consists of the coupling element CE3 directly upstream of ABRE2 (139). These results indicate that a diversity of ABRCs participate in ABA signaling in seeds. TRANS-ACTING FACTORS The nature of the transcription factors that mediate ABA regulation of seed genes via the various above-mentioned cis-elements remains largely unknown. Most proteins that bind DNA sequences with ACGT core motifs contain a basic region adjacent to a leucine-zipper motif (bZIPproteins). Several plant bZIP-proteins that bind to ABREs in vitro and/or are inducible (at the mRNA level) by ABA have been cloned (44, 68, 74, 100, 103, 105). However, few of these genes are known to be expressed in seeds, and thus far none has been unambiguously shown to be involved in ABA signaling in vivo (83). In contrast, genetic and molecular evidence supports that the maize VP1 and A. thaliana ABI3 proteins are homologous transcription factors essential for ABA action in seeds. The vp1 (91, 109) and abi3 (28, 101, 108, 112) mutants are similarly altered in sensitivity to ABA, and in various other aspects of seed maturation including the developmental expression of storage proteins and LEA genes. The maize VP1 (92) and A. thaliana ABI3 (38) genes, as well as the rice OsVP1 (47) and Phaseolus vulgaris PvALF (19) genes, encode homologous proteins (Figure 1). These genes are all exclusively expressed in seeds (19, 47, 92, 112). However, when ectopically expressed in transgenic A. thaliana plants, ABI3 rendered vegetative tissues hypersensitive to ABA and Figure 1 Schematic diagram of the architecture of the VP1/ABI3-like proteins. The maize VP1 (92), A. thaliana ABI3 (38), rice OsVP1 (47), and Phaseolus vulgaris PvALF (19) proteins display a similar and novel structural organization. They contain, in particular, four domains of high amino acid sequence identity: the A domain located in the large acidic (−) N-terminal region and three basic domains designated as B1, B2, and B3 in order from the N terminus. The sizes of these proteins range from 691 (VP1) to 752 (PvALF) amino acids. P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 205 activated expression of several otherwise seed-specific genes in leaves when exogenous ABA was supplied (110, 112). Similarly, in transient expression studies, VP1 (65, 92, 155), OsVP1 (47, 48), and PvALF (18, 19) could trans-activate various seed-specific promoters. When investigated, these trans-activations were found to require the acidic N-terminal domain of the relevant VP1/ABI3like protein (48, 92), and domain-swapping experiments showed that the acidic N-terminal regions of VP1 (92) and PvALF (19) are indeed functional transcriptional activation domains. Thus, taken together, the above-mentioned results indicate that VP1/ABI3-like proteins act as transcription factors. The maize vp1 (56, 91, 109) and A. thaliana abi3 (70, 77, 101, 108, 112) mutants exhibit a larger spectrum of seed phenotypes than the ABA-deficient mutants in the corresponding species. A possible explanation would be that the physiological roles of VP1 and ABI3 are not strictly confined to ABA signaling and rather that these proteins integrate ABA and other seed developmental factors. This model is also consistent with the observation that VP1/ABI3like proteins can substantially trans-activate seed promoters in the absence of (added) ABA (19, 48, 92, 110), and that, within a given promoter, the ciselements involved in VP1 responsiveness are partially separable from those involved in ABA responsiveness (65, 155). In the wheat Em promoter, the ABRE Em1a (Table 2) that is essential for ABA induction also mediates transactivation by VP1 and synergism between ABA and VP1 (155). The conserved domain B2 of VP1 is required for Em transactivation (54), but its exact role in this process remains unclear (54, 131). Furthermore, no specific binding of VP1 to G-box-like ABREs has been observed thus far (54, 92, 145), suggesting that VP1 is a coactivator protein that physically interacts with G-box-binding proteins (91, 155). Unlike for Em, the combined response of the maize C1 promoter to ABA and VP1 is less than additive , and transactivation of the C1 promoter by VP1 is mediated exclusively by the sequence CGTCCATGCAT located within the Sph promoter element (Table 2) (65). The conserved basic domain B3 of VP1 is essential for C1 transactivation, and the isolated B3 domain binds specifically to the above-mentioned sequence element in vitro (145). VP1 is, however, likely to interact with other DNA-binding proteins involved in ABA regulation of C1, because the entire Sph element is required for responsiveness of C1 to both ABA and VP1 (65). The VP1/ABI3-like proteins thus appear to be multifunctional transcription factors that integrate ABA and other regulatory signals of seed maturation, most likely by interacting with distinct trans-acting factors that remain to be identified. Genetic studies in A. thaliana have identified a few other intermediates in the ABA regulation of gene expression in seeds. The already mentioned abi4 and abi5 mutants share with abi3 mutants UPSTREAM SIGNALING ELEMENTS P1: ARS/ary/rck P2: ARS/plb March 23, 1998 206 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT a decreased ABA sensitivity in germinating seeds, as well as a reduced developmental expression of certain LEA genes. These three loci have thus been proposed to act in a common regulatory pathway of seed maturation (27). In addition, the recent analysis of abi3 fus3 and abi3 lec1 double mutants indicates that ABI3 acts synergistically with the FUSCA3 (FUS3) and LEAFY COTYLEDON1 (LEC1) genes to control multiple elementary processes during seed maturation, including sensitivity to ABA and accumulation of storage protein mRNAs (111). The ABI4, ABI5, FUS3, and LEC1 gene products are currently unknown. Studies on barley aleurone protoplasts indicate that reversible protein phosphorylation is likely to be implicated in the regulation of gene expression by ABA in seeds. ABA rapidly stimulated the activity of a MAP kinase, and this stimulation appeared to be correlated with the induction of the Rab16 mRNA (69). Okadaic acid (an inhibitor of the PP1 and PP2A classes of serine/threonine protein phosphatases) inhibited the induction of the HVA1 (73) and Rab16 (51) mRNAs by ABA, and phenylarsine oxide (an inhibitor of tyrosine protein phosphatases) blocked the induction of Rab16 (51). The protein kinase and phosphatases revealed by these studies remain to be isolated. Finally, suggestive evidence indicates that modifications of intracellular cytosolic free Ca2+ levels ([Ca]i) and cytoplasmic pH (pHi) may act as intracellular second messengers in the ABA regulation of gene expression in seeds. In barley aleurone protoplasts, ABA triggers an increase in pHi (153) and a decrease in [Ca]i (35, 158). However, the exact contribution of these alterations in [Ca]i and pHi to the regulation of gene expression by ABA could not be clearly established (152, 153). ABA SIGNAL TRANSDUCTION IN STRESS RESPONSE During vegetative growth, endogenous ABA levels increase upon conditions of water stress, and ABA is an essential mediator in triggering the plant responses to these adverse environmental stimuli (166). As is discussed below, substantial evidence supports that the increased ABA levels limit water loss through transpiration by reducing stomatal aperture. ABA is also involved in other aspects of stress adaptation. For instance, ABA-deficient mutants of A. thaliana are impaired in cold acclimation (87) and in a root morphogenetic response to drought (drought rhizogenesis) (154). The role of ABA in signaling stress conditions has also been extensively documented by molecular studies showing that ABA-deficient mutants are affected in the regulation of numerous genes by drought, salt, or cold (39, 60, 140). It should, however, be noted that the adaptation to these adverse environmental conditions also involves ABA-independent pathways (140). Finally, ABA is involved in the induction of gene expression by mechanical damage (116). P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 207 Regulation of Gene Expression in Response to Stress PROMOTER STUDIES The regulation of gene expression by ABA in vegetative tissues appears to involve several signaling pathways. The ABA induction of distinct genes exhibit differential requirements for protein synthesis (164). In addition, several types of cis-acting elements are involved in ABA-induced gene expression in vegetative tissues. Many of the LEA genes that are abundantly expressed in desiccating seeds are also responsive to drought stress and ABA in vegetative tissues (60, 121). For several of these genes, the G-box-type ABREs already described (Table 2) are required for ABA induction both in seeds and in vegetative tissues (20, 44, 48, 107, 117). In contrast, ABRE-like motifs are not involved in the ABA regulation of other stress-inducible genes such as the A. thaliana RD22 (63) and the Craterostigma plantagineum CDeT27-45 genes (104). The distinct sequence motif shown in Table 2 is essential for ABA responsiveness of CDeT27-45 (104). In this case, as for ABREs (see section on ABA Signal Transduction in Seeds), the corresponding physiological trans-acting factors are presently unknown. Genes that are induced by ABA and encode other types of potential transcription factors include the A. thaliana homeobox gene ATHB-7 (142) and several myb homologues from A. thaliana (151) and Craterostigma (62). The role of these genes in ABA signaling has, however, not been tested experimentally. POTENTIAL INTERMEDIATES Studies performed on various model systems have identified several potential signaling intermediates in the ABA activation of gene expression in response to stress. The resurrection plant Craterostigma plantagineum can tolerate extreme dehydration. However, in vitro propagated callus derived from this plant has a strict requirement for exogenously applied ABA in order to survive a severe dehydration (31). This property has been exploited for isolation of dominant mutants by activation tagging, in which high expression of resident genes activated by insertion of a foreign promoter would confer desiccation tolerance to the transformed cells without prior ABA treatments. One gene was identified (CDT-1), whose high expression did confer the expected phenotypes in calli and led to constitutive expression of several ABA- and dehydration-inducible genes (31). The function of the CDT-1 gene is not immediately obvious, because it encodes a transcript with no large open reading frame. It is possible that the biologically active product of CDT-1 is a regulatory RNA or a short polypeptide (31). The ABA regulation of gene expression in vegetative tissues is likely to involve reversible protein phosphorylation events. Several stress- and ABAinducible mRNAs that encode protein kinases have been identified (57–59). In epidermal peels of Pisum sativum, the ABA-induced accumulation of dehydrin mRNA was reduced by K-252a (an inhibitor of serine/threonine protein kinases) P1: ARS/ary/rck P2: ARS/plb March 23, 1998 208 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT and also by okadaic acid and cyclosporin A (an inhibitor of the PP2B class of serine/threonine protein phosphatases) (53). The involvement of particular protein phosphatases 2C was revealed by the cloning of the ABI1 (78, 97) and ABI2 (79) genes of A. thaliana. Their corresponding mutants show decreased sensitivities to the ABA inhibition of seedling growth, and defects in various morphological and molecular responses to applied ABA in vegetative tissues (28, 41, 72). Despite the highly similar architecture of the ABI1 and ABI2 proteins (79), their functions are unlikely to be completely redundant for all ABA actions. The abi1-1 and abi2-1 mutations lead to identical amino acid substitutions at equivalent positions in the ABI1 and ABI2 proteins, respectively (79), but have (at least quantitatively) different effects on some of the responses to exogenous ABA or water stress (25, 33, 41, 124, 142, 154). The identification of stress- and ABA-inducible mRNAs that code for a Ca2+binding membrane protein in rice (30) and for a phosphatidylinositol-specific phospholipase C in A. thaliana (55), respectively, provides circumstantial evidence for the possible involvement of Ca2+ in ABA signaling in vegetative tissues. In addition, ABA has been shown to induce increases in [Ca]i and pHi in cells of corn coleoptiles and of parsley hypocotyls and roots (32). SINGLE-CELL SYSTEMS Ambitious attempts are being made to reconstruct minimal stress and ABA signaling pathways by reassembling candidate components in single-cell systems. In maize leaf protoplasts, the barley HVA1 promoter fused to reporter genes could be activated by applied ABA or by various stress conditions (136). In the absence of these stimuli, expression of the reporter gene could be induced by treating the protoplasts with 1 mM Ca2+ plus Ca2+ ionophores, or by overexpressing constitutively active forms of the normally Ca2+-dependent ATCDPK1 and ATCDPK1a protein kinases from A. thaliana. Overexpressing the catalytic domain of the wild-type A. thaliana ABI1 PP2C inhibited the activation of HVA1 by ABA or by ATCDPK1 (136). Microinjection experiments were conducted in hypocotyl cells of the tomato aurea mutant to investigate the signaling cascade that mediates ABA activation of the A. thaliana rd29A (165) and kin2/cor6.6 (157) promoters fused to the GUS reporter gene. This work supports the existence of a minimal linear cascade in which (a) ABA triggers a transient accumulation of cyclic ADPribose (cADPR) (for information on cADPR, see 3), (b) cADPR induces a release of Ca2+ from internal stores, and (c) a K-252a-sensitive kinase acting downstream of Ca2+ is required for activation of rd29A and kin2 (Y Wu & N-H Chua, personal communication). Microinjection of the mutant abi1-1 protein inhibited ABA-, cADPR-, and Ca2+-induced gene expression, and these P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 209 effects could be reversed by an excess of wild-type ABI1 protein (Y Wu, A Himmelbach, E Grill & N-H Chua, personal communication). These two sets of results illustrate that combining genetics with single-cell analyses represents a promising approach for deciphering possible epistatic relationships between candidate components in ABA signaling cascades. Regulation of Stomatal Aperture The stomatal pore is defined by a pair of surrounding guard cells. The closing and opening of the pore result from osmotic shrinking and swelling of these guard cells, respectively. In conditions of water stress, the increase in cellular ABA (45) or in apoplastic ABA at the surface of guard cells (161) is thought to provoke a reduction in turgor pressure of the guard cells, which in turn leads to stomatal closure to limit transpirational water loss. Applied ABA inhibits the opening and promotes the closure of stomatal pores (8, 16, 159). The enhanced transpiration of ABA-biosynthetic mutants (71, 77, 88) and transgenic plants expressing an anti-ABA antibody (7) provides evidence for such a role of endogenous ABA. Unlike most other cells in higher-plant tissues, guard cells at maturity lack plasmodesmata (162). This property has afforded a single-cell system, directly accessible in planta, to investigate how ABA is perceived and transduced to trigger integrated physiological responses. Available evidence suggests that guard cells possess at least two sites of ABA perception involved in the regulation of stomatal aperture, one located at the plasma membrane and a second located intracellularly. Stomatal closure can be triggered by extracellular application of ABA. However, the protonated form of the weak acid ABA (ABAH) readily permeates the lipid bilayer of the cell membrane (64). Guard cells of Commelina communis appear to have, in addition, a significant carrier-mediated uptake of ABA (86, 133). The requirement for an extracellular ABA receptor is indicated by the failure of ABA to inhibit the stomatal opening when microinjected directly into the cytosol of Commelina guard cells (5). In this species, extracellular ABA was, however, less effective in regulating stomatal aperture at high than at low external pH (that favors passive uptake of ABAH), providing indirect evidence for an intracellular ABA receptor (5, 106, 113, 133). This conclusion is also supported by the reports that stomatal closure could be triggered in Commelina by ABA released inside guard cells from caged ABA microinjected into the cytosol (2), and by ABA microinjected into guard cells in the presence of 1 µM extracellular ABA (133). ABA closes stomatal pores by inducing net efflux of both K+ and Cl− from the vacuole to the cytoplasm, and from the cytoplasm to the outside of guard ABA PERCEPTION P1: ARS/ary/rck P2: ARS/plb March 23, 1998 210 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT cells (85, 86). Tracer flux studies, measuring rate of loss of 86Rb+ from isolated Commelina guard cells, also indicate multiple actions of ABA, both inside and outside the cell. It has been proposed that internal receptors regulate tonoplast ion channels for release of vacuolar ions, whereas external receptors mediate the stimulation of ion efflux at the plasma membrane (85, 86). ION CHANNELS REGULATED BY ABA Electrophysiological studies, either by whole cell impalement or by patch clamping of the plasma membrane of guard cell protoplasts or of isolated vacuoles, have identified a number of ionic channels present in these guard cell membranes. The nature of the tonoplast ion channels involved in the regulation of stomatal aperture by ABA is not yet clearly identified (159). Attention is thus focused here on ion transport mechanisms across the plasma membrane of guard cells. ABA causes a depolarization of the plasma membrane (149). Two types of anion channels, which may reflect different states of a single channel protein (26, 132), have been identified in the plasma membrane of guard cells (50, 129). One of these types of anion channels (S-type) shows slow and sustained activation properties and is active over a wide range of voltage. Inhibitor studies (132) and the recent demonstration that ABA activates S-type anion channels (43, 114) indicate that these channels can account for the membrane depolarization and prolonged anion efflux required for ABA-mediated stomatal closure. Inactivation of the plasma membrane H+-ATPase by ABA may, however, also contribute to the membrane depolarization during stomatal closure (40). The guard cell plasma membrane contains two types of K+ channels. The inward-rectifying K+ channel is responsible for K+ influx to the guard cell and is inhibited by ABA (76, 130, 149). The outward-rectifying K+ channel is active only at membrane potentials positive to the equilibrium potential for K+, and mediates K+ efflux required for stomatal closure (14, 130, 149). The ABA-induced membrane depolarization mentioned above will thus activate outward-rectifying K+ channels, and the magnitude of this outward K+ current is further enhanced by ABA in a largely voltage-independent manner (14, 76). One of the earliest responses of guard cells to ABA is an increase in the concentration of cytosolic free Ca2+ ([Ca]i) (2, 34, 61, 88a, 89, 128). The origin of the Ca2+ required to elevate [Ca]i in response to ABA is unclear (90), but evidence favoring influx across the plasma membrane (128) or release from internal stores mediated by inositol 1,4,5-trisphosphate (17, 37, 75) and/or cyclic ADP-ribose (3, 90) has been presented. Experimental elevation of [Ca]i is sufficient to induce stomatal closure (37) and mimics several of the above-mentioned effects of ABA on ion channels in the plasma membrane of guard cells. Increased [Ca]i activates the S-type anion channel and inhibits SECOND MESSENGERS P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 211 the inward-rectifying K+ channel (50, 127). These results thus provide strong evidence for the involvement of Ca2+-coupled signal transduction cascade(s) in the regulation of guard cell turgor by ABA. Several observations, however, indicate that Ca2+-independent signaling pathways are also involved. The extent of ABA-induced increase in [Ca]i is variable, and stomata could even close in response to ABA without any detectable change in [Ca]i (2, 34, 89). It remains, however, unclear whether ABA always produces a local increase in [Ca]i that does not systematically translate into global cytoplasmic change (89), or whether ABA can produce stomatal closure using only Ca2+-independent signaling pathways (2). In any case, the fact that the outward-rectifying K+ channel is insensitive to increases in [Ca]i (76, 127) indicates that other second messengers must be involved in the regulation of plasma membrane ion channels by ABA. In particular, ABA increases the cytoplasmic pH (pHi) of guard cells (15, 61). Studies in which guard cells were loaded with pH buffers or pHi was experimentally modified support that the ABA-induced cytoplasmic alkalinization can account for ABA activation of the outward-rectifying K+ channel and also contribute to ABA inactivation of the inward-rectifying K+ channel (15, 42, 76, 98). The ABA regulation of ion channels in guard cells thus appears to involve, at least, both Ca2+-dependent and pHi-dependent signaling pathways. How the ABA-induced Ca2+ and pHi signals are then decoded and relayed by other cellular components in the transduction chain is not clear. The recent report that pHi regulates the outwardrectifying K+ channel in isolated membrane patches from Vicia faba guard cells suggests that the signaling elements acting downstream of the pHi signal are membrane associated (98). The Ca2+ signal is possibly relayed by particular protein kinases and phosphatases. Both Ca2+-dependent protein kinases (115) and phosphatases (4, 23, 84) have been inferred to be potential candidates in modulating the activity of various ion channels in guard cells, but their precise roles in ABA signaling have not been clearly established at present. There is nonetheless incontrovertible evidence that protein phosphorylation is a critical component in the ABA signal transduction controlling stomatal closure. In Vicia faba and Commelina, stomatal closure induced by ABA was abolished by kinase inhibitors while enhanced by inhibitors of the protein phosphatases PP1 and/or PP2A (125). These protein phosphatases, whose actions are Ca2+-independent, have been implicated in the regulation of the inward-rectifying K+ channel (82, 148), outward-rectifying K+ channel (148), and S-type anion channel (114, 125) in Vicia faba and Commelina guard cells. Recent reports described two protein kinases whose activities are rapidly stimulated by ABA in protoplasts from guard cells but not mesophyll cells in DOWNSTREAM SIGNALING ELEMENTS P1: ARS/ary/rck P2: ARS/plb March 23, 1998 212 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT Vicia faba (81, 99). Although they have a similar apparent molecular weight, the two protein kinases are probably distinct because they differ in their ability to autophosphorylate and in their substrate specificity in vitro (81, 99). The cellular targets of these kinases are not yet known, but because their activities are detectable minutes after induction by physiological concentrations of ABA, these kinases may be involved in the modulation of ion channel activities that are essential for rapid stomatal responses. Genetic dissection of ABA signaling in guard cells has been rather limited despite an initial and promising report of the barley mutant cool, which displayed excessive transpiration and ABA-insensitive guard cells (118). Mutants with specific impairment in ABA-induced stomatal closure have not yet been identified in A. thaliana. However, among the gca1-gca8 (Growth Control by ABA) mutants that were isolated based on their reduced sensitivities to the inhibition of seedling growth by exogenous ABA, the gca1 and gca2 mutants display a disturbed stomatal regulation (10). The abi1-1 and abi2-1 mutants mentioned earlier also have ABA-insensitive guard cells as part of their pleiotropic phenotypes (114, 122). What are the roles of the Ca2+-independent (12) ABI1 and ABI2 protein phosphatases 2C (PP2Cs) in stomatal regulation by ABA? Taking advantage of the fact that the abi1-1 mutation is dominant (72, 78), the mutant A. thaliana gene was introduced into the diploid tobacco Nicotiana benthamiana to facilitate electrophysiological measurements (6). Voltage clamp studies found that the mutant abi1-1 transgene had no detectable effect on anion channels, but decreased ABA sensitivity of both the inward- and outward-rectifying K+ channels in the guard cell plasma membrane (6, 43). ABA sensitivity of these K+ channels and ABA-induced stomatal closure could be partially reestablished in the abi1-1 transgenic plants by adding protein kinase inhibitors (6). Recent and important advances made in single-cell techniques have permitted measurements of ion channel activities in A. thaliana guard cells, which had previously posed technical difficulties because of their small sizes (114, 123). In patch-clamp studies of A. thaliana guard cell protoplasts, the ABA response of S-type anion channels was impaired in the abi1-1 mutant. However, consistent with the reversibility of the effects of the abi1-1 transgene in tobacco (6), treatment with the protein kinase inhibitor K-252a could partially restore ABA regulation of the anion channel and ABA-induced stomatal closure in the A. thaliana abi1-1 mutant (114). The abi2-1 mutation also suppressed the ABA activation of Stype anion channels, but curiously, this inhibition could not be counterbalanced by K-252a treatments (114). In addition, the abi2-1 mutation also diminished the background activity of inward-rectifying K+ channels (114), an effect observed neither in the abi1-1 A. thaliana mutant (114) nor in the abi1-1 transgenic tobacco plants (6). The differential effects of the abi1 and abi2 mutations on P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 213 the background activity of inward-rectifying K+ channels, and the differential sensitivity of these mutants to K-252a, thus indicate that, although the ABI1 and ABI2 proteins are homologous PP2Cs, the functions of these proteins in stomatal regulation, as in other physiological responses, are nonredundant. The apparent discrepancies between the above-mentioned results on abi1-1 transgenic tobacco and abi1-1 mutant A. thaliana plants may be indicative of the functional flexibility of ABI1 in maintaining an integrated ABA regulation of both K+ and anion channels, depending on the imposed (environmental or experimental) conditions. This would be analogous to the relative importance of the ABA-induced increase in [Ca]i, which is subjected to both experimental (89) and environmental (2) influences. A more serious problem in terms of formulating a unified model of stomatal regulation, however, is how many species-dependent differences exist in ABA signaling. For instance, various pharmacological studies indicate that PP1/PP2A protein phosphatases (distinct from the ABI1 and ABI2 PP2Cs) act as positive regulators of anion currents in A. thaliana guard cells (114), but as negative regulators in Vicia, Commelina, and N. benthamiana (43, 125). Therefore, it seems that detailed comparative studies with different species would be necessary before a fuller understanding of the signaling cascades that mediate stomatal regulation by ABA would emerge. ABA SIGNALING TO GUARD CELL NUCLEUS As described above, stomatal guard cells have been used extensively as a cellular system to explore the transduction pathways that target the ABA signal to ion channels during stomatal closing. These responses are rapid and are thus thought to be operationally distinct from long-term ABA responses that require RNA and protein synthesis (166). However, hormone induction of gene expression at the transcriptional level can also take place within minutes, as has been observed in the case of auxin (93). The relevance of ABA in gene activation in guard cells has only been explored recently. Several promoters or mRNAs have been shown to be induced in guard cells by exogenous ABA treatment (53, 110, 137, 147, 157). These studies demonstrate that guard cells are competent to relay ABA signals to the nucleus. Initial attempts are being made to analyze whether identical or distinct signaling pathways mediate the ABA regulations of ion channels and gene expression in guard cells (53). It also remains to be established whether there are gene products directly implicated in controlling stomatal movements that are regulated by ABA transcriptionally. CONCLUSION AND PERSPECTIVES In recent years, the research into the molecular and physiological action of ABA has benefited tremendously from cross-fertilization of different expertise P1: ARS/ary/rck P2: ARS/plb March 23, 1998 214 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT and ideas. Studies with optically pure ABA analogues revealed that the stereochemical requirements of ABA are not identical in all ABA responses (21, 156), indicating that higher plants may contain several types of ABA receptors. Evidence for ABA perception sites located both at the cell surface and intracellularly has come from analyses on the regulation of ion fluxes in guard cells. Whether this model is applicable to other cell types, and to more long-term responses involving changes in gene expression, are important questions to be explored (for instance, see 36). In addition, even though locations of these reception sites can be detected physiologically, we have no firm idea whether they are functionally distinct, and if so, what physiological relevance they may harbor. Cloning genes of ABA receptors and creating corresponding mutants would thus constitute a major step toward dissecting these initial events of ABA action. Besides reception sites, we also need to improve further our understanding of the more downstream events in the transduction cascades triggered by ABA signals. Recent advances point to the central role of reversible protein phosphorylation in mediating several of the physiological responses to ABA. Much work, however, is clearly needed to identify the pertinent kinases and phosphatases, and cellular targets of their action. The ectopic expression of the seed-specific ABI3 gene in leaves resulted in activation of several otherwise seed-specific genes. This observation and the pleiotropic phenotypes of some ABA response mutants raise the question of the degree of similarity between signaling cascades in the different tissues (or cell types in the same tissue). It might be possible that many core components of the ABA signaling network exist in different tissues. A simple model would be that these central cascades are then regulated by cell-specific factors such as the VP1/ABI3-like proteins. In this light, ABA-stimulated protein kinases with apparent specificity to guard cells may play similar deterministic roles in activating a branch of the ABA pathway in this cell type. Isolation of additional mutants by judicious genetic screens (taking into account the potential for redundancy in signaling components) will no doubt enrich our knowledge about regulatory points in ABA action, which might include modulation in the activity of synthetic enzymes and transport of the hormone (150). These two latter points have not been the subject of intense investigations. Furthermore, mutations that simultaneously alter the responsiveness to ABA and other hormones or developmental clues, will permit a fuller appreciation of cross-talk between ABA and other cellular signals. Several mutants of this type have already been isolated in A. thaliana (Table 1). The eventual cloning of the genes identified by mutational analyses will reveal their molecular identity and, in some cases, suggest possible functions based on homologies with known proteins. Genes with unexpected structural features P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 215 (such as CDT-1 in C. plantagineum) will divulge novel signal transduction mechanisms, to the delight of researchers with iconoclastic tendencies. The isolation of genes responsive to ABA, coupled with promoter analyses, are vital to our understanding of how combinatorial and synergistic actions of cis-acting elements and trans-acting factors are involved in the versatile control of the output response. Other approaches, such as biochemical purification and those based on interaction cloning, will undoubtedly complement the more established technologies in unraveling additional signaling elements or even signaling complexes. Investigators with a pioneering spirit have already attempted to reconstruct particular signaling cascades by reassembling individual components suspected to play the relevant roles. These are much welcome advances, since these cellular systems will complement the more established guard cell model. It is certain that continuation of such a multidisciplinary approach will yield ever deeper insight not only into ABA signal transduction itself but also into how ABA and other signaling molecules jointly coordinate physiological responses. ACKNOWLEDGMENTS Work in the authors’ laboratory is supported by the Centre National de la Recherche Scientifique and grants from the International Human Frontier Science Program (RG-303/95), the European Community BIOTECH program (BIO4-CT96-0062), and the Groupement de Recherches et d’Etudes sur les Génomes (Décision 9-95). Visit the Annual Reviews home page at http://www.AnnualReviews.org. Literature Cited 1. Addicott FT, Carns HR. 1983. History and introduction. In Abscisic Acid, ed. FT Addicott, pp. 1–21. New York: Praeger Sci. 2. Allan AC, Fricker MD, Ward JL, Beale MH, Trewavas AJ. 1994. Two transduction pathways mediate rapid effects of abscisic acid in Commelina guard cells. Plant Cell 6:1319–28 3. Allen GJ, Muir SR, Sanders D. 1995. Release of Ca2+ from individual plant vacuoles by both InsP3 and cyclic ADPribose. Science 268:735–37 4. Allen GJ, Sanders D. 1995. Calcineurin, a type 2B protein phosphatase, modulates the Ca2+-permeable slow vacuolar ion channel of stomatal guard cells. Plant Cell 7:1473–83 5. Anderson BE, Ward JM, Schroeder JI. 1994. Evidence for an extracellular reception site for abscisic acid in Commelina guard cells. Plant Physiol. 104:1177–83 6. Armstrong F, Leung J, Grabov A, Brearley J, Giraudat J, Blatt MR. 1995. Sensitivity to abscisic acid of guard cell K+ channels is suppressed by abi1-1, a mutant Arabidopsis gene encoding a putative protein phosphatase. Proc. Natl. Acad. Sci. USA 92:9520–24 7. Artsaenko O, Peisker M, zur Nieden U, Fiedler U, Weiler EW, et al. 1995. Expression of a single chain Fv antibody against abscisic acid creates a wilty phenotype in transgenic tobacco. Plant J. 8:745–50 8. Assmann SM. 1993. Signal transduction in guard cells. Annu. Rev. Cell Biol. 9:345–75 P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 216 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT 9. Deleted in proof 10. Benning G, Ehrler T, Meyer K, Leube M, Rodriguez P, Grill E. 1996. Genetic analysis of ABA-mediated control of plant growth. Proc. Workshop Abscisic Acid Signal Transduction Plants, Madrid, pp. 34. Madrid: Juan March Found. 11. Berger S, Bell E, Mullet JE. 1996. Two methyl jasmonate-insensitive mutants show altered expression of AtVsp in response to methyl jasmonate and wounding. Plant Physiol. 111:525–31 12. Bertauche N, Leung J, Giraudat J. 1996. Protein phosphatase activity of abscisic acid insensitive 1 (ABI1) protein from Arabidopsis thaliana. Eur. J. Biochem. 241:193–200 13. Bitoun R, Rousselin P, Caboche M. 1990. A pleiotropic mutation results in crossresistance to auxin, abscisic acid and paclobutrazol. Mol. Gen. Genet. 220:234– 39 14. Blatt MR. 1990. Potassium channel currents in intact stomatal guard cells: rapid enhancement by abscisic acid. Planta 180:445–55 15. Blatt MR, Armstrong F. 1993. K+ channels of stomatal guard cells: abscisic acid–evoked control of the outward rectifier mediated by cytoplasmic pH. Planta 191:330–41 16. Blatt MR, Thiel G. 1993. Hormonal control of ion channel gating. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44:543– 67 17. Blatt MR, Thiel G, Trentham DR. 1990. Reversible inactivation of K+ channels of Vicia stomatal guard cells following the photolysis of caged inositol 1,4,5trisphosphate. Nature 346:766–69 18. Bobb AJ, Chern M-S, Bustos MM. 1997. Conserved RY-repeats mediate transactivation of seed-specific promoters by the developmental regulator PvALF. Nucleic Acids Res. 25:641–47 19. Bobb AJ, Eiben HG, Bustos MM. 1995. PvAlf, an embryo-specific acidic transcriptional activator enhances gene expression from phaseolin and phytohemagglutinin promoters. Plant J. 8:331–43 20. Busk PK, Jensen AB, Pagès M. 1997. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize. Plant J. 11:1285– 95 21. Chandler JW, Abrams SR, Bartels D. 1997. The effect of ABA analogs on callus viability and gene expression in Craterostigma plantagineum. Physiol. Plant. 99:465–69 22. Clouse SD, Langford M, McMorris TC. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 1996. A brassinosteroid-insensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development. Plant Physiol. 111:671–78 Cousson A, Cotelle V, Vavasseur A. 1995. Induction of stomatal closure by vanadate or a light/dark transition involves Ca2+calmodulin-dependent protein phosphorylations. Plant Physiol. 109:491–97 Cutler S, Ghassemian M, Bonetta D, Cooney S, McCourt P. 1996. A protein farnesyl transferase involved in abscisic acid signal transduction in Arabidopsis. Science 273:1239–41 de Bruxelles GL, Peacock WJ, Dennis ES, Dolferus R. 1996. Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol. 111:381–91 Dietrich P, Hedrich R. 1994. Interconversion of fast and slow gating modes of GCAC1, a guard cell anion channel. Planta 195:301–4 Finkelstein RR. 1994. Mutations at two new Arabidopsis ABA response loci are similar to the abi3 mutations. Plant J. 5:765–71 Finkelstein RR, Somerville CR. 1990. Three classes of abscisic acid (ABA)– insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses. Plant Physiol. 94:1172–79 Deleted in proof Frandsen G, Müller-Uri F, Nielsen M, Mundy J, Skriver K. 1996. Novel plant Ca2+-binding protein expressed in response to abscisic acid and osmotic stress. J. Biol. Chem. 271:343–48 Furini A, Koncz C, Salamini F, Bartels D. 1997. High level transcription of a member of a repeated gene family confers dehydration tolerance to callus tissue of Craterostigma plantagineum. EMBO J. 16:3599–608 Gehring CA, Irving HR, Parish RW. 1990. Effects of auxin and abscisic acid on cytosolic calcium and pH in plant cells. Proc. Natl. Acad. Sci. USA 87:9645–49 Gilmour SJ, Thomashow MF. 1991. Cold acclimation and cold-regulated gene expression in ABA mutants of Arabidopsis thaliana. Plant Mol. Biol. 17:1233–40 Gilroy S, Fricker MD, Read ND, Trewavas AJ. 1991. Role of calcium in signal transduction of Commelina guard cells. Plant Cell 3:333–44 Gilroy S, Jones RL. 1992. Gibberellic acid and abscisic acid coordinately regulate cytoplasmic calcium and secretory activity in barley aleurone protoplasts. Proc. Natl. Acad. Sci. USA 89:3591–95 P1: ARS/ary/rck March 23, 1998 P2: ARS/plb 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 36. Gilroy S, Jones RL. 1994. Perception of gibberellin and abscisic acid at the external face of the plasma membrane of barley (Hordeum vulgare L.) aleurone protoplasts. Plant Physiol. 104:1185–92 37. Gilroy S, Read ND, Trewavas AJ. 1990. Elevation of cytoplasmic calcium by caged calcium or caged inositol trisphosphate initiates stomatal closure. Nature 343:769–71 38. Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM. 1992. Isolation of the Arabidopsis ABI3 gene by positional cloning. Plant Cell 4:1251–61 39. Giraudat J, Parcy F, Bertauche N, Gosti F, Leung J, et al. 1994. Current advances in abscisic acid action and signaling. Plant Mol. Biol. 26:1557–77 40. Goh C-H, Kinoshita T, Oku T, Shimazaki K-I. 1996. Inhibition of blue light–dependent H+ pumping by abscisic acid in Vicia guard-cell protoplasts. Plant Physiol. 111:433–40 41. Gosti F, Bertauche N, Vartanian N, Giraudat J. 1995. Abscisic acid–dependent and –independent regulation of gene expression by progressive drought in Arabidopsis thaliana. Mol. Gen. Genet. 246:10– 18 42. Grabov A, Blatt MR. 1997. Parallel control of the inward-rectifier K+ channel by cytosolic free Ca2+ and pH in Vicia guard cells. Planta 201:84–95 43. Grabov A, Leung J, Giraudat J, Blatt MR. 1997. Alteration of anion channel kinetics in wild-type and abi1-1 transgenic Nicotiana benthamiana guard cells by abscisic acid. Plant J. 12:203–13 44. Guiltinan MJ, Marcotte WR, Quatrano RS. 1990. A plant leucine zipper protein that recognizes an abscisic acid response element. Science 250:267–71 45. Harris MJ, Outlaw WH Jr. 1991. Rapid adjustment of guard-cell abscisic acid levels to current leaf-water status. Plant Physiol. 95:171–73 46. Deleted in proof 47. Hattori T, Terada T, Hamasuna S. 1994. Sequence and functional analyses of the rice gene homologous to the maize Vp1. Plant Mol. Biol. 24:805–10 48. Hattori T, Terada T, Hamasuna S. 1995. Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1. Plant J. 7:913–25 49. Deleted in proof 50. Hedrich R, Busch H, Raschke K. 1990. Ca2+ and nucleotide dependent regulation of voltage dependent anion channels 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 217 in the plasma membrane of guard cells. EMBO J. 9:3889–92 Heimovaara-Dijkstra S, Nieland TJF, van der Meulen RM, Wang M. 1996. Abscisic acid–induced gene-expression requires the activity of protein(s) sensitive to the protein-tyrosine phosphatase inhibitor phenylarsine oxide. Plant Growth Regul. 18:115–23 Deleted in proof Hey SJ, Bacon A, Burnett E, Neill SJ. 1997. Abscisic acid signal transduction in epidermal cells of Pisum sativum L. Argenteum: Both dehydrin mRNA accumulation and stomatal responses require protein phosphorylation and dephosphorylation. Planta 202:85–92 Hill A, Nantel A, Rock CD, Quatrano RS. 1996. A conserved domain of the Viviparous-1 gene product enhances the DNA binding activity of the bZIP protein EmBP-1 and other transcription factors. J. Biol. Chem. 271:3366–74 Hirayama T, Ohto C, Mizoguchi T, Shinozaki K. 1995. A gene encoding a phosphatidylinositol-specific phospholipase C is induced by dehydration and salt stress in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 92:3903–7 Hoecker U, Vasil IK, McCarty DR. 1995. Integrated control of seed maturation and germination programs by activator and repressor functions of Viviparous-1 of maize. Genes Dev. 9:2459–69 Holappa LD, Walker-Simmons MK. 1995. The wheat abscisic acid-responsive protein kinase mRNA, PKABA1, is upregulated by dehydration, cold temperature, and osmotic stress. Plant Physiol. 108:1203–10 Hong SW, Jon JH, Kwak JM, Nam HG. 1997. Identification of a receptor-like protein kinase gene rapidly induced by abscisic acid, dehydration, high salt, and cold treatments in Arabidopsis thaliana. Plant Physiol. 113:1203–12 Hwang IW, Goodman HM. 1995. An Arabidopsis thaliana root-specific kinase homolog is induced by dehydration, ABA, and NaCl. Plant J. 8:37–43 Ingram J, Bartels D. 1996. The molecular basis of dehydration tolerance in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47:377–403 Irving HR, Gehring CA, Parish RW. 1992. Changes in cytosolic pH and calcium of guard cells precede stomatal movements. Proc. Natl. Acad. Sci. USA 89:1790– 94 Iturriaga G, Leyns L, Villegas A, Gharaibeh R, Salamini F, Bartels D. 1996. P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 218 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73. QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT A family of novel myb-related genes from the resurrection plant Craterostigma plantagineum are specifically expressed in callus and roots in response to ABA or desiccation. Plant Mol. Biol. 32:707–16 Iwasaki T, Yamaguchi-Shinozaki K, Shinozaki K. 1995. Identification of a cisregulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis. Mol. Gen. Genet. 247:391–98 Kaiser WM, Hartung W. 1981. Uptake and release of abscisic acid by isolated photoautotrophic mesophyll cell, depending on pH gradients. Plant Physiol. 68:202–6 Kao C-Y, Cocciolone SM, Vasil IK, McCarty DR. 1996. Localization and interaction of the cis-acting elements for abscisic acid, VIVIPAROUS1, and light activation of the C1 gene of maize. Plant Cell 8:1171–79 Deleted in proof Deleted in proof Kim SY, Chung H-J, Thomas TL. 1997. Isolation of a novel class of bZIP transcription factors that interact with ABAresponsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system. Plant J. 11:1237–51 Knetsch MLW, Wang M, Snaar-Jagalska BE, Heimovaara-Dijkstra S. 1996. Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone protoplasts. Plant Cell 8:1061–67 Koornneef M, Hanhart CJ, Hilhorst HWM, Karssen CM. 1989. In vivo inhibition of seed development and reserve protein accumulation in recombinants of abscisic acid biosynthesis and responsiveness mutants in Arabidopsis thaliana. Plant Physiol. 90:463–69 Koornneef M, Jorna ML, Brinkhorst-van der Swan DLC, Karssen CM. 1982. The isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in nongerminating gibberellin sensitive lines of Arabidopsis thaliana (L.) Heynh. Theor. Appl. Genet. 61:385–93 Koornneef M, Reuling G, Karssen CM. 1984. The isolation and characterization of abscisic acid-insensitive mutants of Arabidopsis thaliana. Physiol. Plant. 61:377–83 Kuo A, Cappelluti S, Cervantes-Cervantes M, Rodriguez M, Bush DS. 1996. Okadaic acid, a protein phosphatase inhibitor, blocks calcium changes, gene expression, and cell death induced by gib- 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. berellin in wheat aleurone cells. Plant Cell 8:259–69 Kusano T, Berberich T, Harada M, Suzuki N, Sugawara K. 1995. A maize DNAbinding factor with a bZIP motif is induced by low temperature. Mol. Gen. Genet. 248:507–17 Lee YS, Choi YB, Suh S, Lee J, Assmann SM, et al. 1996. Abscisic acid–induced phosphoinositide turnover in guard cell protoplasts of Vicia faba. Plant Physiol. 110:987–96 Lemtiri-Chlieh F, MacRobbie EAC. 1994. Role of calcium in the modulation of Vicia guard cell potassium channels by abscisic acid: a patch clamp study. J. Membr. Biol. 137:99–107 Léon-Kloosterziel KM, Gil MA, Ruijs GJ, Jacobsen SE, Olszewski NE, et al. 1996. Isolation and characterization of abscisic acid-deficient Arabidopsis mutants at two new loci. Plant J. 10:655–61 Leung J, Bouvier-Durand M, Morris P-C, Guerrier D, Chefdor F, Giraudat J. 1994. Arabidopsis ABA-response gene ABI1: features of a calcium-modulated protein phosphatase. Science 264:1448–52 Leung J, Merlot S, Giraudat J. 1997. The Arabidopsis ABSCISIC ACIDINSENSITIVE 2 (ABI2) and ABI1 genes encode redundant protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell 9:759–71 Leydecker M-T, Moureaux T, Kraepiel Y, Schnorr K, Caboche M. 1995. Molybdenum cofactor mutants, specifically impaired in xanthine dehydrogenase activity and abscisic acid biosynthesis, simultaneously overexpress nitrate reductase. Plant Physiol. 107:1427–31 Li JX, Assmann SM. 1996. An abscisic acid-activated and calcium-independent protein kinase from guard cells of Fava bean. Plant Cell 8:2359–68 Li WW, Luan S, Schreiber SL, Assmann SM. 1994. Evidence for protein phosphatase 1 and 2A regulation of K+ channels of two types of leaf cells. Plant Physiol. 106:963–70 Lu GH, Paul A-L, McCarty DR, Ferl RJ. 1996. Transcription factor veracity: Is GBF3 responsible for ABA-regulated expression of Arabidopsis Adh? Plant Cell 8:847–57 Luan S, Li WW, Rusnak F, Assmann SM, Schreiber SL. 1993. Immunosuppressants implicate protein phosphatase regulation of K+ channels in guard cells. Proc. Natl. Acad. Sci. USA 90:2202–6 MacRobbie EAC. 1995. Effects of ABA on 86Rb+ fluxes at plasmalemma and P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 86. 87. 88. 88a. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. tonoplast of stomatal guard cells. Plant J. 7:835–43 MacRobbie EAC. 1995. ABA-induced ion efflux in stomatal guard cells: multiple actions of ABA inside and outside the cell. Plant J. 7:565–76 Mäntylä E, Lang V, Palva ET. 1995. Role of abscisic acid in drought-induced freezing tolerance, cold acclimation, and accumulation of LTI78 and RAB18 proteins in Arabidopsis thaliana. Plant Physiol. 107:141–48 Marin E, Nussaume L, Quesada A, Gonneau M, Sotta B, et al. 1996. Molecular identification of zeaxanthin epoxidase of Nicotiana plumbaginifolia, a gene involved in abscisic acid biosynthesis and corresponding to ABA locus of Arabidopsis thaliana. EMBO J. 15:2331–42 McAinsh MR, Brownlee AM, Hetherington AM. 1990. Abscisic acid-induced elevation of guard cell cytosolic Ca2+ precedes stomatal closure. Nature 343:186– 88 McAinsh MR, Brownlee C, Hetherington AM. 1992. Visualizing changes in cytosolic-free Ca2+ during the response of stomatal guard cells to abscisic acid. Plant Cell 4:1113–22 McAinsh MR, Brownlee C, Hetherington AM. 1997. Calcium ions as second messengers in guard cell signal transduction. Physiol. Plant. 100:16–29 McCarty DR. 1995. Genetic control and integration of maturation and germination pathways in seed development. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:71–93 McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil IK. 1991. The viviparous-1 developmental gene of maize encodes a novel transcriptional activator. Cell 66:895–905 McClure BA, Hagen G, Brown CS, Gee MA, Guilfoyle TJ. 1989. Transcription, organization, and sequence of an auxinregulated gene cluster in soybean. Plant Cell 1:229–39 Deleted in proof Deleted in proof Meurs C, Basra AS, Karssen CM, van Loon LC. 1992. Role of abscisic acid in the induction of desiccation tolerance in developing seeds of Arabidopsis thaliana. Plant Physiol. 98:1484–93 Meyer K, Leube MP, Grill E. 1994. A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264:1452–55 Miedema H, Assmann SM. 1996. A 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 219 membrane-delimited effect of internal pH on the K+ outward rectifier of Vicia faba guard cells. J. Membr. Biol. 154:227–37 Mori IC, Muto S. 1997. Abscisic acid activates a 48-kilodalton protein kinase in guard cell protoplasts. Plant Physiol. 113:833–39 Nakagawa H, Ohmiya K, Hattori T. 1996. A rice bZIP protein, designated OSBZ8, is rapidly induced by abscisic acid. Plant J. 9:217–27 Nambara E, Keith K, McCourt P, Naito S. 1995. A regulatory role for the ABI3 gene in the establishment of embryo maturation in Arabidopsis thaliana. Development 121:629–36 Nambara E, Naito S, McCourt P. 1992. A mutant of Arabidopsis which is defective in seed development and storage protein accumulation is a new abi3 allele. Plant J. 2:435–41 Nantel A, Quatrano RS. 1996. Characterization of three rice basic/leucine zipper factors, including two inhibitors of EmBP-1 DNA binding activity. J. Biol. Chem. 271:31296–305 Nelson D, Salamini F, Bartels D. 1994. Abscisic acid promotes novel DNA-binding activity to a desiccationrelated promoter of Craterostigma plantagineum. Plant J. 5:451–58 Oeda K, Salinas J, Chua N-H. 1991. A tobacco bZip transcription activator (TAF1) binds to a G-box-like motif conserved in plant genes. EMBO J. 10:1793–802 Ogunkami AB, Tucker DJ, Mansfield TA. 1973. An improved bioassay for abscisic acid and other antitranspirants. New Phytol. 72:277–78 Ono A, Izawa T, Chua N-H, Shimamoto K. 1996. The rab16B promoter of rice contains two distinct abscisic acid-responsive elements. Plant Physiol. 112:483–91 Ooms JJJ, Léon-Kloosterziel KM, Bartels D, Koornneef M, Karssen CM. 1993. Acquisition of desiccation tolerance and longevity in seeds of Arabidopsis thaliana. A comparative study using abscisic acid–insensitive abi3 mutants. Plant Physiol. 102:1185–91 Paiva R, Kriz AL. 1994. Effect of abscisic acid on embryo-specific gene expression during normal and precocious germination in normal and viviparous maize (Zea mays) embryos. Planta 192:332–39 Parcy F, Giraudat J. 1997. Interactions between the ABI1 and the ectopically expressed ABI3 genes in controlling abscisic acid responses in Arabidopsis vegetative P1: ARS/ary/rck P2: ARS/plb March 23, 1998 220 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT tissues. Plant J. 11:693–702 111. Parcy F, Valon C, Kohara A, Miséra S, Giraudat J. 1997. The ABSCISIC ACID-INSENSITIVE 3 (ABI3), FUSCA 3 (FUS3) and LEAFY COTYLEDON 1 (LEC1) loci act in concert to control multiple aspects of Arabidopsis seed development. Plant Cell. 9:1265–77 112. Parcy F, Valon C, Raynal M, GaubierComella P, Delseny M, Giraudat J. 1994. Regulation of gene expression programs during Arabidopsis seed development: roles of the ABI3 locus and of endogenous abscisic acid. Plant Cell 6:1567– 82 113. Paterson NW, Weyers JDB, Brook RA. 1988. The effect of pH on stomatal sensitivity to abscisic acid. Plant Cell Environ. 11:83–89 114. Pei Z-M, Kuchitsu K, Ward JM, Schwarz M, Schroeder JI. 1997. Differential abscisic acid regulation of guard cell slow anion channels in Arabidopsis wild-type and abi1 and abi2 mutants. Plant Cell 9:409–23 115. Pei Z-M, Ward JM, Harper JF, Schroeder JI. 1996. A novel chloride channel in Vicia faba guard cell vacuoles activated by the serine/threonine kinase, CDKP. EMBO J. 15:6564–74 116. Pena-Cortes H, Fisahn J, Willmitzer L. 1995. Signals involved in wound-induced proteinase inhibitor II gene expression in tomato and potato plants. Proc. Natl. Acad. Sci. USA 92:4106–13 117. Pla M, Vilardell J, Guiltinan MJ, Marcotte WR, Niogret M-F, et al. 1993. The cisregulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28. Plant Mol. Biol. 21:259–66 118. Raskin I, Ladyman JAR. 1988. Isolation and characterization of a barley mutant with abscisic acid-insensitive stomata. Planta 173:73–78 119. Robertson DS. 1955. The genetics of vivipary in maize. Genetics 40:745–60 120. Robichaud C, Sussex IM. 1986. The response of viviparous-1 and wild-type embryos of Zea mays to culture in the presence of abscisic acid. J. Plant Physiol. 126:235–42 121. Rock CD, Quatrano RS. 1995. The role of hormones during seed development. In Plant Hormones, ed. PJ Davies, pp. 671– 97. Dordrecht: Kluwer 122. Roelfsema MRG, Prins HBA. 1995. Effect of abscisic acid on stomatal opening in isolated epidermal strips of abi mutants of Arabidopsis thaliana. Physiol. Plant. 95:373–78 123. Roelfsema MRG, Prins HBA. 1997. Ion channels in guard cells of Arabidopsis thaliana. Planta 202:18–27 124. Savouré A, Hua X-J, Bertauche N, Van Montagu M, Verbruggen N. 1997. Abscisic acid-independent and abscisic aciddependent regulation of proline biosynthesis following cold and osmotic stresses in Arabidopsis thaliana. Mol. Gen. Genet. 254:104–9 125. Schmidt C, Schelle I, Liao Y-J, Schroeder JI. 1995. Strong regulation of slow anion channels and abscisic acid signaling in guard cells by phosphorylation and dephosphorylation events. Proc. Natl. Acad. Sci. USA 92:9535–39 126. Deleted in proof 127. Schroeder JI, Hagiwara S. 1989. Cytosolic calcium regulates ion channels in the plasma membrane of Vicia faba guard cells. Nature 338:427–30 128. Schroeder JI, Hagiwara S. 1990. Repetitive increases in cytosolic Ca2+ of guard cells by abscisic acid activation of nonselective Ca2+-permeable channels. Proc. Natl. Acad. Sci. USA 87:9305–9 129. Schroeder JI, Keller BU. 1992. Two types of anion channel currents in guard cells with distinct voltage regulation. Proc. Natl. Acad. Sci. USA 89:5025–29 130. Schroeder JI, Raschke K, Neher E. 1987. Voltage dependence of K+ channels in guard cells protoplasts. Proc. Natl. Acad. Sci. USA 84:4108–12 131. Schultz TF, Spiker S, Quatrano RS. 1996. Histone H1 enhances the DNA binding activity of the transcription factor EmBP1. J. Biol. Chem. 271:25742–45 132. Schwartz A, Ilan N, Schwarz M, Scheaffer J, Assmann SM, Schroeder JI. 1995. Anion-channel blockers inhibit S-type anion channels and abscisic responses in guard cells. Plant Physiol. 109:651–58 133. Schwartz A, Wu W-H, Tucker EB, Assmann SM. 1994. Inhibition of inward K+ channels and stomatal response by abscisic acid: an intracellular locus of phytohormone action. Proc. Natl. Acad. Sci. USA 91:4019–23 134. Schwartz SH, Léon-Kloosterziel KM, Koornneef M, Zeevaart JAD. 1997. Biochemical characterization of the aba2 and aba3 mutants in Arabidopsis thaliana. Plant Physiol. 114:161–66 135. Schwartz SH, Tan BC, Gage DA, Zeevaart JAD, McCarty DR. 1997. Specific oxidative cleavage of carotenoids by VP14 of maize. Science 276:1872–74 136. Sheen J. 1996. Ca2+-dependent protein kinases and stress signal transduction in plants. Science 274:1900–2 P1: ARS/ary/rck P2: ARS/plb March 23, 1998 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 ABA SIGNALING 137. Shen LM, Outlaw WH, Epstein LM. 1995. Expression of an mRNA with sequence similarity to pea dehydrin (Psdhn1) in guard cells of Vicia faba in response to exogenous abscisic acid. Physiol. Plant. 95:99–105 138. Shen QX, Ho T-HD. 1995. Functional dissection of an abscisic acid (ABA)inducible gene reveals two independent ABA-responsive complexes each containing a G-box and a novel cis-acting element. Plant Cell 7:295–307 139. Shen QX, Zhang PH, Ho T-HD. 1996. Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley. Plant Cell 8:1107–19 140. Shinozaki K, Yamaguchi-Shinozaki K. 1996. Molecular responses to drought and cold stress. Curr. Opin. Biotechnol. 7:161–67 141. Skriver K, Olsen FL, Rogers JC, Mundy J. 1991. Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc. Natl. Acad. Sci. USA 88:7266–70 142. Söderman E, Mattson J, Engström P. 1996. The Arabidopsis homeobox gene ATHB-7 is induced by water deficit and by abscisic acid. Plant J. 10:375–81 143. Staswick PE, Su WP, Howell SH. 1992. Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. Proc. Natl. Acad. Sci. USA 89:6837– 40 144. Sturaro M, Vernieri P, Castiglioni P, Binelli G, Gavazzi G. 1996. The rea (red embryonic axis) phenotype describes a new mutation affecting the response of maize embryos to abscisic acid and osmotic stress. J. Exp. Bot. 47:755–62 145. Suzuki M, Kao CY, McCarty DR. 1997. The conserved B3 domain of VIVIPAROUS1 has a cooperative DNA binding activity. Plant Cell 9:799–807 146. Taylor IB. 1991. Genetics of ABA synthesis. In Abscisic Acid Physiology and Biochemistry, ed. WJ Davies, HG Jones, pp. 23–37. Oxford: Bios Sci. 147. Taylor JE, Renwick KF, Webb AAR, McAinsh MR, Furini A, et al. 1995. ABAregulated promoter activity in stomatal guard cells. Plant J. 7:129–34 148. Thiel G, Blatt MR. 1994. Phosphatase antagonist okadaic acid inhibits steady state K+ currents in guard cells of Vicia faba. Plant J. 5:727–33 149. Thiel G, MacRobbie EAC, Blatt MR. 1992. Membrane transport in stomatal 150. 151. 152. 153. 154. 155. 156. 157. 158. 159. 160. 161. 221 guard cells: the importance of voltage control. J. Membr. Biol. 126:1–18 Trejo CL, Clephan AL, Davies WJ. 1995. How do stomata read abscisic acid signals? Plant Physiol. 109:803–11 Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K. 1993. An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5:1529–39 Van der Meulen RM, Visser K, Wang M. 1996. Effects of modulation of calcium levels and calcium fluxes on ABAinduced gene expression in barley aleurone. Plant Sci. 117:75–82 van der Veen R, Heimovaara-Dijkstra S, Wang M. 1992. Cytosolic alkalinization mediated by abscisic acid is necessary, but not sufficient, for abscisic acid–induced gene expression in barley aleurone protoplasts. Plant Physiol. 100:699–705 Vartanian N, Marcotte L, Giraudat J. 1994. Drought rhizogenesis in Arabidopsis thaliana. Differential responses of hormonal mutants. Plant Physiol. 104:761– 67 Vasil V, Marcotte WR Jr, Rosenkrans L, Cocciolone SM, Vasil IK, et al. 1995. Overlap of Viviparous1 (VP1) and abscisic acid response elements in the Em promoter: G-box elements are sufficient but not necessary for VP1 transactivation. Plant Cell 7:1511–18 Walker-Simmons MK, Anderberg RJ, Rose PA, Abrams SR. 1992. Optically pure abscisic acid analogs—tools for relating germination inhibition and gene expression in wheat embryos. Plant Physiol. 99:501–7 Wang H, Cutler AJ. 1995. Promoters from kin1 and cor6.6, two Arabidopsis thaliana low-temperature- and ABA-inducible genes, direct strong βglucuronidase expression in guard cells, pollen and young developing seeds. Plant Mol. Biol. 28:619–34 Wang M, Van Duijn B, Schram AW. 1991. Abscisic acid induces a cytosolic calcium decrease in barley aleurone protoplasts. FEBS Lett. 278:69–74 Ward JM, Pei Z-M, Schroeder JI. 1995. Roles of ion channels in initiation of signal transduction in higher plants. Plant Cell 7:833–44 Deleted in proof Wilkinson S, Davies WJ. 1997. Xylem sap pH increase: a drought signal received at the apoplastic face of the guard cell that involves the suppression of saturable abscisic acid uptake by the epidermal sym- P1: ARS/ary/rck P2: ARS/plb March 23, 1998 222 12:33 QC: ARS/uks T1: ARK Annual Reviews AR060-09 LEUNG & GIRAUDAT plast. Plant Physiol. 113:559–73 162. Wille AC, Lucas WJ. 1984. Ultrastructural and histochemical studies on guard cells. Planta 160:129–42 163. Wilson AK, Pickett FB, Turner JC, Estelle M. 1990. A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid. Mol. Gen. Genet. 222:377–83 164. Yamaguchi-Shinozaki K, Shinozaki K. 1993. The plant hormone abscisic acid mediates the drought-induced expression but not the seed-specific expression of rd22, a gene responsive to dehydration stress in Arabidopsis thaliana. Mol. Gen. Genet. 238:17–25 165. Yamaguchi-Shinozaki K, Shinozaki K. 1993. Characterization of the expression of a desiccation-responsive rd29 gene of Arabidopsis thaliana and analysis of its promoter in transgenic plants. Mol. Gen. Genet. 236:331–40 166. Zeevaart JAD, Creelman RA. 1988. Metabolism and physiology of abscisic acid. Annu. Rev. Plant Physiol. Plant Mol. Biol. 39:439–73