Download abscisic acid signal transduction

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Protein moonlighting wikipedia , lookup

Organ-on-a-chip wikipedia , lookup

Extracellular matrix wikipedia , lookup

Hepoxilin wikipedia , lookup

Hedgehog signaling pathway wikipedia , lookup

Amitosis wikipedia , lookup

Cellular differentiation wikipedia , lookup

SULF1 wikipedia , lookup

List of types of proteins wikipedia , lookup

Signal transduction wikipedia , lookup

Transcript
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998. 49:199–222
c 1998 by Annual Reviews. All rights reserved
Copyright °
ABSCISIC ACID SIGNAL
TRANSDUCTION
Jeffrey Leung and Jérôme Giraudat
Institut des Sciences Végétales, Unité Propre de Recherche 40, Centre National de la
Recherche Scientifique, 1 Avenue de la Terrasse, 91190 Gif-sur-Yvette, France;
e-mail: [email protected]
KEY WORDS:
guard cell, mutants, second messenger, seed development, stress tolerance
ABSTRACT
The plant hormone abscisic acid (ABA) plays a major role in seed maturation
and germination, as well as in adaptation to abiotic environmental stresses. ABA
promotes stomatal closure by rapidly altering ion fluxes in guard cells. Other
ABA actions involve modifications of gene expression, and the analysis of ABAresponsive promoters has revealed a diversity of potential cis-acting regulatory
elements. The nature of the ABA receptor(s) remains unknown. In contrast,
combined biophysical, genetic, and molecular approaches have led to considerable progress in the characterization of more downstream signaling elements.
In particular, substantial evidence points to the importance of reversible protein phosphorylation and modifications of cytosolic calcium levels and pH as
intermediates in ABA signal transduction. Exciting advances are being made in
reassembling individual components into minimal ABA signaling cascades at the
single-cell level.
CONTENTS
INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ABA SIGNAL TRANSDUCTION IN SEEDS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Seed Dormancy and Germination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Reserve Accumulation and Acquisition of Desiccation Tolerance . . . . . . . . . . . . . . . . . . .
ABA SIGNAL TRANSDUCTION IN STRESS RESPONSE . . . . . . . . . . . . . . . . . . . . . . . . . .
Regulation of Gene Expression in Response to Stress . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Regulation of Stomatal Aperture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
CONCLUSION AND PERSPECTIVES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
200
200
200
202
206
207
209
213
199
1040-2519/98/0601-0199$08.00
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
200
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
INTRODUCTION
The scientific origins of abscisic acid (ABA) have been traced to several independent investigations in the late 1940s, but it was only in the 1960s that
ABA was isolated and identified (1). Mutants affected in ABA biosynthesis
are known in a variety of plant species (39, 146). The characterization of these
mutants, together with physicochemical studies, has enabled the pathway of
ABA biosynthesis to be elucidated in higher plants (134, 135, 146, 166). Two
ABA biosynthetic genes have been recently cloned (88, 135) and should provide
insights into the regulation and the sites of ABA biosynthesis.
A large body of evidence indicates that ABA plays a major role in adaptation to abiotic environmental stresses, seed development, and germination.
The present review focuses on our current knowledge concerning how the ABA
signal could be faithfully transduced to mediate these well-characterized physiological and developmental processes. Physicochemical and molecular genetic approaches have already provided fundamental insights into the diversity
of ABA perception sites and other downstream components that could couple
ABA stimuli to particular responses. It should be emphasized that many concepts about the relative importance of these components in the ABA signaling
network are far from firmly established. Nonetheless, it is clear that the present
development of single-cell systems should allow some of these components to
be assembled into minimal signaling pathways within a cellular context.
ABA SIGNAL TRANSDUCTION IN SEEDS
Endogenous ABA content peaks during roughly the last two thirds of seed development before returning to lower levels in the dry seed (121). ABA is thus
thought to regulate several essential processes occurring during the developmental stages that follow pattern formation of the embryo. These processes
include the induction of seed dormancy, the accumulation of nutritive reserves,
and the acquisition of desiccation tolerance.
Seed Dormancy and Germination
Exogenous ABA can inhibit the precocious germination of immature embryos
in culture (121). Embryos of the ABA-biosynthetic mutants from maize exhibit
precocious germination while still attached to the mother plant or vivipary
(91). Seeds of the ABA biosynthetic mutants from Arabidopsis thaliana (71, 77)
and Nicotiana plumbaginifolia (88) fail to become dormant. These observations
support that endogenous ABA inhibits precocious germination and promotes
seed dormancy.
Thus far, our knowledge on the signaling elements that mediate the regulation
of seed dormancy and germination by ABA is primarily derived from genetic
analysis. As summarized in Table 1, mutations that alter the sensitivity to ABA
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
QC: ARS/uks
12:33
T1: ARK
Annual Reviews
AR060-09
201
ABA SIGNALING
Table 1 Main characteristics of the various mutations known to affect ABA sensitivity
Species
Hordeum
vulgare
Zea mays
Mutation Dominancea
cool
vp1
R
rea
R
Phenotype
ABA insensitivity
in guard cells
ABA insensitivity
in seeds
ABA insensitivity
in seeds
Constitutive ABA
response in callus
Craterostigma cdt-1
plantagineum
D
Arabidopsis
thaliana
abi1
SD
ABA insensitivity
abi2
SD
ABA insensitivity
abi3
R
ABA insensitivity
in seeds
abi4/5
R
era1
R
ABA insensitivity
in seeds
ABA hypersensitivityc
era2/3
gca1/8
axr2
R
jar1
R
jin4
R
bri1
R
sax
R
Nicotiana plum- iba1
baginifolia
(aba1)g
a
D
R
Gene productb
Ref.
118
Seed-specific
92, 120
transcription
factor
144
Regulatory
RNA or short
polypeptide
Protein phosphatase 2C
Protein phosphatase 2C
Seed-specific
transcription
factor
31
72, 78, 97
72, 79
38, 72,
102, 108
27
β subunit
of farnesyl
transferase
ABA hypersensitivityc
ABA insensitivityd
Resistance to auxin,
ethylene, and ABAd
Resistance to MeJa and
hypersensitivity to ABAc
Resistance to MeJa
and hyper-sensitivity
to ABAc
Resistance to brassinosteroids and hypersensitivity to ABAd
Hypersensitivity to auxin
and ABAe
Resistance to auxin,
Molybdenum
cytokinin, and ABAc
cofactor
biosynthesis
24
24
10
163
143
11
22
f
13, 80
Dominance of the mutant alleles over wild-type; D, dominant; SD, semidominant; R, recessive.
Molecular function of the product of the wild-type gene.
c
Sensitivity of seed germination to exogenous ABA.
d
Sensitivity of seedling (root) growth to exogenous ABA.
e
Sensitivities of root growth and stomatal closing to exogenous ABA.
f
M. Fellner and G. Ephritikhine, personal communication.
g
The IBA1 locus was renamed ABA1 when it was found that iba1 and other alleles are in fact ABA-deficient, as
a result of a defect in the biosynthesis of a molybdenum cofactor that is required for multiple enzymatic activities
including ABA aldehyde oxidase (the last step in ABA biosynthesis).
b
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
202
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
in seeds have been described in maize and in A. thaliana, and several of the
corresponding genes have been cloned.
The maize vp1 (viviparous1) (119) and rea (red embryonic axis) (144) mutations lead, like ABA biosynthetic mutations in this species, to vivipary. However, vp1 (120) and rea (144) embryos do not have reduced ABA content but
rather exhibit a reduced sensitivity to germination inhibition by exogenous
ABA in culture. As is discussed below, the VP1 gene encodes a seed-specific
transcription factor (92).
The A. thaliana ABA-insensitive ABI1 to ABI5 loci were all identified by
selecting for seeds capable of germinating in the presence of ABA concentrations (3–10 µM) that are inhibitory to the wild type (27, 72). The abi1
(72), abi2 (72), and abi3 (72, 101, 108) mutants also exhibit, like A. thaliana
ABA-deficient mutants, a marked reduction in seed dormancy. These three
loci thus seem to mediate the inhibitory effects of endogenous ABA on seed
germination. The ABI1 (78, 97) and ABI2 (79) genes encode homologous protein serine/threonine phosphatase 2C (PP2C) (12, 79). The ABI3 gene is the
ortholog of the maize VP1 gene mentioned above (38). It is presently unclear
whether the ABI1, ABI2, and ABI3 loci act in the same or in partially distinct
ABA signaling cascade in seeds (28, 110).
Mutations in the ERA1 to ERA3 (Enhanced Response to ABA) loci of A.
thaliana were identified by a lack of seed germination in the presence of low
concentrations of ABA (0.3 µM) that are not inhibitory to the wild type (24).
The era1 mutations also markedly increase seed dormancy. The ERA1 gene
encodes the β subunit of a farnesyl transferase, which may possibly function as a
negative regulator of ABA signaling by modifying signal transduction proteins
for membrane localization (24). The exact relationships between ERA1 and the
above-mentioned ABI loci are unknown.
Reserve Accumulation and Acquisition
of Desiccation Tolerance
The accumulation of nutritive reserves and the acquisition of desiccation tolerance are associated with the expression of specific sets of mRNAs (60, 121).
Transcripts encoding either storage proteins or late-embryogenesis-abundant
(LEA) proteins thought to participate in desiccation tolerance can be precociously induced by exogenous ABA in cultured embryos (60, 121). The characterization of ABA-deficient mutants in A. thaliana (70, 77, 96, 101, 112) and
in maize (91, 109) supports a contribution of endogenous ABA in the developmental expression of these genes in seeds.
The functional dissection of such ABA-responsive promoters, conducted primarily in transient expression systems, has identified several cis-acting elements
involved in ABA-induced gene expression.
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
203
Table 2 cis-acting promoter elements involved in the activation of gene
expression by ABA
Gene (Species)
Element
Sequencea
Ref.
Rab16
(Oryza sativa)
Motif I
Motif III
GTACGTGGC
GCCGCGTGGC
Em
(Triticum aestivum)
Em1a
Em1b
ACACGTGGC
ACACGTGCC
HVA22
(Hordeum vulgare)
ABRE3
CE1
GCCACGTACA
TGCCACCGG
138
138
HVA1
(Hordeum vulgare)
ABRE2
CE3
CCTACGTGGC
ACGCGTGTCCTC
139
139
C1
(Zea mays)
Sph
CGTGTCGTCCATGCAT
65
AAGCCCAAATTTCACAGCCCGATAACCG
104
CDeT27-45
(Craterostigma
plantagineum)
141
107
44
44
a
The ACGT core in G-box-type ABREs is underlined.
CIS-ACTING PROMOTER ELEMENTS A first category of elements is exemplified
by the related motif I of the Rab16 LEA gene from rice (107, 141) and Em1a
motif of the wheat Em LEA gene from wheat (44). These sequences share
a G-box ACGT core motif (Table 2) and have been designated ABREs, for
ABA Response Elements. ABRE-related sequence motifs are present in many
other ABA-inducible genes, although their function in ABA signaling often
remains speculative in the absence of experimental tests. For instance, only
a subset of the multiple ABRE-like motifs present in certain promoters are
indeed required for ABA regulation (20, 48, 117, 138, 139). A second type of
cis-acting element has been identified in the maize C1 gene, a regulator of
anthocyanin biosynthesis in seeds. The ABRE-like motifs present in C1 are
not major determinants of the ABA responsiveness of this gene, whereas the
distinct sequence motif designated as Sph element (Table 2) is essential for
ABA induction of the C1 promoter (65).
Multimerized copies of ABREs (107, 141, 155) or of the Sph element (65)
can confer ABA responsivity to minimal promoters. Single copies of these
elements were, however, not sufficient for ABA response, suggesting that multimerization substituted for other aspects of the native promoter contexts of
these elements. In fact, the smallest promoter units designated ABRCs shown
to be both necessary and sufficient for ABA induction of gene expression appear
to consist of (at least) two essential cis-elements. ABRCs can be composed of
two G-boxes as in the case of the wheat Em promoter, where both the Em1a and
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
204
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
Em1b G-box motifs (Table 2) contribute to the activity of the 75-bp Complex
I (44, 155). In contrast, several other ABRCs consist of an ABRE and of a
cis-element not related to G-boxes. The G-box-type motif I and the distinct
motif III are essential for the ABA responsiveness of a 40-bp fragment of the
rice Rab16B promoter (107). In the barley HVA22 promoter, ABRC1 is a 49-bp
fragment that comprises ABRE3 and the Coupling Element CE1 located 20-bp
downstream (138). In the barley HVA1 promoter, the 22-bp long ABRC3 consists of the coupling element CE3 directly upstream of ABRE2 (139). These
results indicate that a diversity of ABRCs participate in ABA signaling in
seeds.
TRANS-ACTING FACTORS The nature of the transcription factors that mediate
ABA regulation of seed genes via the various above-mentioned cis-elements
remains largely unknown. Most proteins that bind DNA sequences with ACGT
core motifs contain a basic region adjacent to a leucine-zipper motif (bZIPproteins). Several plant bZIP-proteins that bind to ABREs in vitro and/or are inducible (at the mRNA level) by ABA have been cloned (44, 68, 74, 100, 103, 105).
However, few of these genes are known to be expressed in seeds, and thus far
none has been unambiguously shown to be involved in ABA signaling in vivo
(83).
In contrast, genetic and molecular evidence supports that the maize VP1
and A. thaliana ABI3 proteins are homologous transcription factors essential
for ABA action in seeds. The vp1 (91, 109) and abi3 (28, 101, 108, 112) mutants are similarly altered in sensitivity to ABA, and in various other aspects
of seed maturation including the developmental expression of storage proteins
and LEA genes. The maize VP1 (92) and A. thaliana ABI3 (38) genes, as
well as the rice OsVP1 (47) and Phaseolus vulgaris PvALF (19) genes, encode
homologous proteins (Figure 1). These genes are all exclusively expressed
in seeds (19, 47, 92, 112). However, when ectopically expressed in transgenic
A. thaliana plants, ABI3 rendered vegetative tissues hypersensitive to ABA and
Figure 1 Schematic diagram of the architecture of the VP1/ABI3-like proteins. The maize VP1
(92), A. thaliana ABI3 (38), rice OsVP1 (47), and Phaseolus vulgaris PvALF (19) proteins display
a similar and novel structural organization. They contain, in particular, four domains of high amino
acid sequence identity: the A domain located in the large acidic (−) N-terminal region and three
basic domains designated as B1, B2, and B3 in order from the N terminus. The sizes of these
proteins range from 691 (VP1) to 752 (PvALF) amino acids.
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
205
activated expression of several otherwise seed-specific genes in leaves when exogenous ABA was supplied (110, 112). Similarly, in transient expression studies, VP1 (65, 92, 155), OsVP1 (47, 48), and PvALF (18, 19) could trans-activate
various seed-specific promoters. When investigated, these trans-activations
were found to require the acidic N-terminal domain of the relevant VP1/ABI3like protein (48, 92), and domain-swapping experiments showed that the acidic
N-terminal regions of VP1 (92) and PvALF (19) are indeed functional transcriptional activation domains. Thus, taken together, the above-mentioned results
indicate that VP1/ABI3-like proteins act as transcription factors.
The maize vp1 (56, 91, 109) and A. thaliana abi3 (70, 77, 101, 108, 112) mutants exhibit a larger spectrum of seed phenotypes than the ABA-deficient
mutants in the corresponding species. A possible explanation would be that the
physiological roles of VP1 and ABI3 are not strictly confined to ABA signaling and rather that these proteins integrate ABA and other seed developmental
factors. This model is also consistent with the observation that VP1/ABI3like proteins can substantially trans-activate seed promoters in the absence
of (added) ABA (19, 48, 92, 110), and that, within a given promoter, the ciselements involved in VP1 responsiveness are partially separable from those
involved in ABA responsiveness (65, 155).
In the wheat Em promoter, the ABRE Em1a (Table 2) that is essential for
ABA induction also mediates transactivation by VP1 and synergism between
ABA and VP1 (155). The conserved domain B2 of VP1 is required for Em
transactivation (54), but its exact role in this process remains unclear (54, 131).
Furthermore, no specific binding of VP1 to G-box-like ABREs has been observed thus far (54, 92, 145), suggesting that VP1 is a coactivator protein that
physically interacts with G-box-binding proteins (91, 155). Unlike for Em,
the combined response of the maize C1 promoter to ABA and VP1 is less
than additive , and transactivation of the C1 promoter by VP1 is mediated exclusively by the sequence CGTCCATGCAT located within the Sph promoter
element (Table 2) (65). The conserved basic domain B3 of VP1 is essential
for C1 transactivation, and the isolated B3 domain binds specifically to the
above-mentioned sequence element in vitro (145). VP1 is, however, likely to
interact with other DNA-binding proteins involved in ABA regulation of C1,
because the entire Sph element is required for responsiveness of C1 to both
ABA and VP1 (65). The VP1/ABI3-like proteins thus appear to be multifunctional transcription factors that integrate ABA and other regulatory signals of
seed maturation, most likely by interacting with distinct trans-acting factors
that remain to be identified.
Genetic studies in A. thaliana have identified a few other intermediates in the ABA regulation of gene expression in
seeds. The already mentioned abi4 and abi5 mutants share with abi3 mutants
UPSTREAM SIGNALING ELEMENTS
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
206
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
a decreased ABA sensitivity in germinating seeds, as well as a reduced developmental expression of certain LEA genes. These three loci have thus been
proposed to act in a common regulatory pathway of seed maturation (27). In
addition, the recent analysis of abi3 fus3 and abi3 lec1 double mutants indicates that ABI3 acts synergistically with the FUSCA3 (FUS3) and LEAFY
COTYLEDON1 (LEC1) genes to control multiple elementary processes during seed maturation, including sensitivity to ABA and accumulation of storage
protein mRNAs (111). The ABI4, ABI5, FUS3, and LEC1 gene products are
currently unknown.
Studies on barley aleurone protoplasts indicate that reversible protein phosphorylation is likely to be implicated in the regulation of gene expression by
ABA in seeds. ABA rapidly stimulated the activity of a MAP kinase, and
this stimulation appeared to be correlated with the induction of the Rab16
mRNA (69). Okadaic acid (an inhibitor of the PP1 and PP2A classes of serine/threonine protein phosphatases) inhibited the induction of the HVA1 (73)
and Rab16 (51) mRNAs by ABA, and phenylarsine oxide (an inhibitor of tyrosine protein phosphatases) blocked the induction of Rab16 (51). The protein
kinase and phosphatases revealed by these studies remain to be isolated.
Finally, suggestive evidence indicates that modifications of intracellular cytosolic free Ca2+ levels ([Ca]i) and cytoplasmic pH (pHi) may act as intracellular
second messengers in the ABA regulation of gene expression in seeds. In barley
aleurone protoplasts, ABA triggers an increase in pHi (153) and a decrease in
[Ca]i (35, 158). However, the exact contribution of these alterations in [Ca]i and
pHi to the regulation of gene expression by ABA could not be clearly established
(152, 153).
ABA SIGNAL TRANSDUCTION IN STRESS RESPONSE
During vegetative growth, endogenous ABA levels increase upon conditions
of water stress, and ABA is an essential mediator in triggering the plant responses to these adverse environmental stimuli (166). As is discussed below,
substantial evidence supports that the increased ABA levels limit water loss
through transpiration by reducing stomatal aperture. ABA is also involved
in other aspects of stress adaptation. For instance, ABA-deficient mutants of
A. thaliana are impaired in cold acclimation (87) and in a root morphogenetic
response to drought (drought rhizogenesis) (154). The role of ABA in signaling
stress conditions has also been extensively documented by molecular studies
showing that ABA-deficient mutants are affected in the regulation of numerous genes by drought, salt, or cold (39, 60, 140). It should, however, be noted
that the adaptation to these adverse environmental conditions also involves
ABA-independent pathways (140). Finally, ABA is involved in the induction
of gene expression by mechanical damage (116).
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
207
Regulation of Gene Expression in Response to Stress
PROMOTER STUDIES The regulation of gene expression by ABA in vegetative
tissues appears to involve several signaling pathways. The ABA induction of
distinct genes exhibit differential requirements for protein synthesis (164). In
addition, several types of cis-acting elements are involved in ABA-induced gene
expression in vegetative tissues. Many of the LEA genes that are abundantly
expressed in desiccating seeds are also responsive to drought stress and ABA in
vegetative tissues (60, 121). For several of these genes, the G-box-type ABREs
already described (Table 2) are required for ABA induction both in seeds and
in vegetative tissues (20, 44, 48, 107, 117).
In contrast, ABRE-like motifs are not involved in the ABA regulation of other
stress-inducible genes such as the A. thaliana RD22 (63) and the Craterostigma
plantagineum CDeT27-45 genes (104). The distinct sequence motif shown in
Table 2 is essential for ABA responsiveness of CDeT27-45 (104). In this
case, as for ABREs (see section on ABA Signal Transduction in Seeds), the
corresponding physiological trans-acting factors are presently unknown. Genes
that are induced by ABA and encode other types of potential transcription
factors include the A. thaliana homeobox gene ATHB-7 (142) and several myb
homologues from A. thaliana (151) and Craterostigma (62). The role of these
genes in ABA signaling has, however, not been tested experimentally.
POTENTIAL INTERMEDIATES Studies performed on various model systems
have identified several potential signaling intermediates in the ABA activation
of gene expression in response to stress.
The resurrection plant Craterostigma plantagineum can tolerate extreme dehydration. However, in vitro propagated callus derived from this plant has a
strict requirement for exogenously applied ABA in order to survive a severe
dehydration (31). This property has been exploited for isolation of dominant
mutants by activation tagging, in which high expression of resident genes activated by insertion of a foreign promoter would confer desiccation tolerance to
the transformed cells without prior ABA treatments. One gene was identified
(CDT-1), whose high expression did confer the expected phenotypes in calli
and led to constitutive expression of several ABA- and dehydration-inducible
genes (31). The function of the CDT-1 gene is not immediately obvious, because it encodes a transcript with no large open reading frame. It is possible
that the biologically active product of CDT-1 is a regulatory RNA or a short
polypeptide (31).
The ABA regulation of gene expression in vegetative tissues is likely to
involve reversible protein phosphorylation events. Several stress- and ABAinducible mRNAs that encode protein kinases have been identified (57–59). In
epidermal peels of Pisum sativum, the ABA-induced accumulation of dehydrin
mRNA was reduced by K-252a (an inhibitor of serine/threonine protein kinases)
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
208
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
and also by okadaic acid and cyclosporin A (an inhibitor of the PP2B class of
serine/threonine protein phosphatases) (53).
The involvement of particular protein phosphatases 2C was revealed by the
cloning of the ABI1 (78, 97) and ABI2 (79) genes of A. thaliana. Their corresponding mutants show decreased sensitivities to the ABA inhibition of seedling
growth, and defects in various morphological and molecular responses to applied ABA in vegetative tissues (28, 41, 72). Despite the highly similar architecture of the ABI1 and ABI2 proteins (79), their functions are unlikely to
be completely redundant for all ABA actions. The abi1-1 and abi2-1 mutations lead to identical amino acid substitutions at equivalent positions in the
ABI1 and ABI2 proteins, respectively (79), but have (at least quantitatively)
different effects on some of the responses to exogenous ABA or water stress
(25, 33, 41, 124, 142, 154).
The identification of stress- and ABA-inducible mRNAs that code for a Ca2+binding membrane protein in rice (30) and for a phosphatidylinositol-specific
phospholipase C in A. thaliana (55), respectively, provides circumstantial evidence for the possible involvement of Ca2+ in ABA signaling in vegetative
tissues. In addition, ABA has been shown to induce increases in [Ca]i and pHi
in cells of corn coleoptiles and of parsley hypocotyls and roots (32).
SINGLE-CELL SYSTEMS Ambitious attempts are being made to reconstruct
minimal stress and ABA signaling pathways by reassembling candidate components in single-cell systems.
In maize leaf protoplasts, the barley HVA1 promoter fused to reporter genes
could be activated by applied ABA or by various stress conditions (136). In the
absence of these stimuli, expression of the reporter gene could be induced by
treating the protoplasts with 1 mM Ca2+ plus Ca2+ ionophores, or by overexpressing constitutively active forms of the normally Ca2+-dependent ATCDPK1
and ATCDPK1a protein kinases from A. thaliana. Overexpressing the catalytic
domain of the wild-type A. thaliana ABI1 PP2C inhibited the activation of
HVA1 by ABA or by ATCDPK1 (136).
Microinjection experiments were conducted in hypocotyl cells of the tomato
aurea mutant to investigate the signaling cascade that mediates ABA activation of the A. thaliana rd29A (165) and kin2/cor6.6 (157) promoters fused to
the GUS reporter gene. This work supports the existence of a minimal linear
cascade in which (a) ABA triggers a transient accumulation of cyclic ADPribose (cADPR) (for information on cADPR, see 3), (b) cADPR induces a
release of Ca2+ from internal stores, and (c) a K-252a-sensitive kinase acting
downstream of Ca2+ is required for activation of rd29A and kin2 (Y Wu &
N-H Chua, personal communication). Microinjection of the mutant abi1-1
protein inhibited ABA-, cADPR-, and Ca2+-induced gene expression, and these
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
209
effects could be reversed by an excess of wild-type ABI1 protein (Y Wu, A
Himmelbach, E Grill & N-H Chua, personal communication).
These two sets of results illustrate that combining genetics with single-cell
analyses represents a promising approach for deciphering possible epistatic
relationships between candidate components in ABA signaling cascades.
Regulation of Stomatal Aperture
The stomatal pore is defined by a pair of surrounding guard cells. The closing
and opening of the pore result from osmotic shrinking and swelling of these
guard cells, respectively. In conditions of water stress, the increase in cellular
ABA (45) or in apoplastic ABA at the surface of guard cells (161) is thought
to provoke a reduction in turgor pressure of the guard cells, which in turn
leads to stomatal closure to limit transpirational water loss. Applied ABA
inhibits the opening and promotes the closure of stomatal pores (8, 16, 159). The
enhanced transpiration of ABA-biosynthetic mutants (71, 77, 88) and transgenic
plants expressing an anti-ABA antibody (7) provides evidence for such a role
of endogenous ABA.
Unlike most other cells in higher-plant tissues, guard cells at maturity lack
plasmodesmata (162). This property has afforded a single-cell system, directly
accessible in planta, to investigate how ABA is perceived and transduced to
trigger integrated physiological responses.
Available evidence suggests that guard cells possess at least
two sites of ABA perception involved in the regulation of stomatal aperture,
one located at the plasma membrane and a second located intracellularly.
Stomatal closure can be triggered by extracellular application of ABA. However, the protonated form of the weak acid ABA (ABAH) readily permeates
the lipid bilayer of the cell membrane (64). Guard cells of Commelina communis appear to have, in addition, a significant carrier-mediated uptake of ABA
(86, 133). The requirement for an extracellular ABA receptor is indicated by
the failure of ABA to inhibit the stomatal opening when microinjected directly
into the cytosol of Commelina guard cells (5). In this species, extracellular
ABA was, however, less effective in regulating stomatal aperture at high than
at low external pH (that favors passive uptake of ABAH), providing indirect
evidence for an intracellular ABA receptor (5, 106, 113, 133). This conclusion
is also supported by the reports that stomatal closure could be triggered in Commelina by ABA released inside guard cells from caged ABA microinjected into
the cytosol (2), and by ABA microinjected into guard cells in the presence of
1 µM extracellular ABA (133).
ABA closes stomatal pores by inducing net efflux of both K+ and Cl− from
the vacuole to the cytoplasm, and from the cytoplasm to the outside of guard
ABA PERCEPTION
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
210
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
cells (85, 86). Tracer flux studies, measuring rate of loss of 86Rb+ from isolated
Commelina guard cells, also indicate multiple actions of ABA, both inside and
outside the cell. It has been proposed that internal receptors regulate tonoplast
ion channels for release of vacuolar ions, whereas external receptors mediate
the stimulation of ion efflux at the plasma membrane (85, 86).
ION CHANNELS REGULATED BY ABA Electrophysiological studies, either by
whole cell impalement or by patch clamping of the plasma membrane of guard
cell protoplasts or of isolated vacuoles, have identified a number of ionic channels present in these guard cell membranes. The nature of the tonoplast ion
channels involved in the regulation of stomatal aperture by ABA is not yet
clearly identified (159). Attention is thus focused here on ion transport mechanisms across the plasma membrane of guard cells.
ABA causes a depolarization of the plasma membrane (149). Two types of
anion channels, which may reflect different states of a single channel protein
(26, 132), have been identified in the plasma membrane of guard cells (50, 129).
One of these types of anion channels (S-type) shows slow and sustained activation properties and is active over a wide range of voltage. Inhibitor studies
(132) and the recent demonstration that ABA activates S-type anion channels
(43, 114) indicate that these channels can account for the membrane depolarization and prolonged anion efflux required for ABA-mediated stomatal closure.
Inactivation of the plasma membrane H+-ATPase by ABA may, however, also
contribute to the membrane depolarization during stomatal closure (40).
The guard cell plasma membrane contains two types of K+ channels. The
inward-rectifying K+ channel is responsible for K+ influx to the guard cell
and is inhibited by ABA (76, 130, 149). The outward-rectifying K+ channel
is active only at membrane potentials positive to the equilibrium potential for
K+, and mediates K+ efflux required for stomatal closure (14, 130, 149). The
ABA-induced membrane depolarization mentioned above will thus activate
outward-rectifying K+ channels, and the magnitude of this outward K+ current
is further enhanced by ABA in a largely voltage-independent manner (14, 76).
One of the earliest responses of guard cells to ABA is
an increase in the concentration of cytosolic free Ca2+ ([Ca]i) (2, 34, 61, 88a, 89,
128). The origin of the Ca2+ required to elevate [Ca]i in response to ABA is
unclear (90), but evidence favoring influx across the plasma membrane (128) or
release from internal stores mediated by inositol 1,4,5-trisphosphate (17, 37, 75)
and/or cyclic ADP-ribose (3, 90) has been presented. Experimental elevation
of [Ca]i is sufficient to induce stomatal closure (37) and mimics several of the
above-mentioned effects of ABA on ion channels in the plasma membrane of
guard cells. Increased [Ca]i activates the S-type anion channel and inhibits
SECOND MESSENGERS
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
211
the inward-rectifying K+ channel (50, 127). These results thus provide strong
evidence for the involvement of Ca2+-coupled signal transduction cascade(s)
in the regulation of guard cell turgor by ABA.
Several observations, however, indicate that Ca2+-independent signaling
pathways are also involved. The extent of ABA-induced increase in [Ca]i
is variable, and stomata could even close in response to ABA without any
detectable change in [Ca]i (2, 34, 89). It remains, however, unclear whether
ABA always produces a local increase in [Ca]i that does not systematically
translate into global cytoplasmic change (89), or whether ABA can produce
stomatal closure using only Ca2+-independent signaling pathways (2). In any
case, the fact that the outward-rectifying K+ channel is insensitive to increases
in [Ca]i (76, 127) indicates that other second messengers must be involved in
the regulation of plasma membrane ion channels by ABA.
In particular, ABA increases the cytoplasmic pH (pHi) of guard cells (15, 61).
Studies in which guard cells were loaded with pH buffers or pHi was experimentally modified support that the ABA-induced cytoplasmic alkalinization can
account for ABA activation of the outward-rectifying K+ channel and also contribute to ABA inactivation of the inward-rectifying K+ channel (15, 42, 76, 98).
The ABA regulation of ion channels in guard cells thus appears to involve, at
least, both Ca2+-dependent and pHi-dependent signaling pathways.
How the ABA-induced Ca2+ and pHi
signals are then decoded and relayed by other cellular components in the transduction chain is not clear. The recent report that pHi regulates the outwardrectifying K+ channel in isolated membrane patches from Vicia faba guard cells
suggests that the signaling elements acting downstream of the pHi signal are
membrane associated (98). The Ca2+ signal is possibly relayed by particular
protein kinases and phosphatases. Both Ca2+-dependent protein kinases (115)
and phosphatases (4, 23, 84) have been inferred to be potential candidates in
modulating the activity of various ion channels in guard cells, but their precise
roles in ABA signaling have not been clearly established at present.
There is nonetheless incontrovertible evidence that protein phosphorylation
is a critical component in the ABA signal transduction controlling stomatal
closure. In Vicia faba and Commelina, stomatal closure induced by ABA
was abolished by kinase inhibitors while enhanced by inhibitors of the protein
phosphatases PP1 and/or PP2A (125). These protein phosphatases, whose
actions are Ca2+-independent, have been implicated in the regulation of the
inward-rectifying K+ channel (82, 148), outward-rectifying K+ channel (148),
and S-type anion channel (114, 125) in Vicia faba and Commelina guard cells.
Recent reports described two protein kinases whose activities are rapidly
stimulated by ABA in protoplasts from guard cells but not mesophyll cells in
DOWNSTREAM SIGNALING ELEMENTS
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
212
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
Vicia faba (81, 99). Although they have a similar apparent molecular weight,
the two protein kinases are probably distinct because they differ in their ability
to autophosphorylate and in their substrate specificity in vitro (81, 99). The
cellular targets of these kinases are not yet known, but because their activities
are detectable minutes after induction by physiological concentrations of ABA,
these kinases may be involved in the modulation of ion channel activities that
are essential for rapid stomatal responses.
Genetic dissection of ABA signaling in guard cells has been rather limited
despite an initial and promising report of the barley mutant cool, which displayed excessive transpiration and ABA-insensitive guard cells (118). Mutants
with specific impairment in ABA-induced stomatal closure have not yet been
identified in A. thaliana.
However, among the gca1-gca8 (Growth Control by ABA) mutants that were
isolated based on their reduced sensitivities to the inhibition of seedling growth
by exogenous ABA, the gca1 and gca2 mutants display a disturbed stomatal
regulation (10). The abi1-1 and abi2-1 mutants mentioned earlier also have
ABA-insensitive guard cells as part of their pleiotropic phenotypes (114, 122).
What are the roles of the Ca2+-independent (12) ABI1 and ABI2 protein
phosphatases 2C (PP2Cs) in stomatal regulation by ABA? Taking advantage of
the fact that the abi1-1 mutation is dominant (72, 78), the mutant A. thaliana
gene was introduced into the diploid tobacco Nicotiana benthamiana to facilitate electrophysiological measurements (6). Voltage clamp studies found that
the mutant abi1-1 transgene had no detectable effect on anion channels, but decreased ABA sensitivity of both the inward- and outward-rectifying K+ channels
in the guard cell plasma membrane (6, 43). ABA sensitivity of these K+ channels and ABA-induced stomatal closure could be partially reestablished in the
abi1-1 transgenic plants by adding protein kinase inhibitors (6). Recent and important advances made in single-cell techniques have permitted measurements
of ion channel activities in A. thaliana guard cells, which had previously posed
technical difficulties because of their small sizes (114, 123). In patch-clamp
studies of A. thaliana guard cell protoplasts, the ABA response of S-type anion
channels was impaired in the abi1-1 mutant. However, consistent with the reversibility of the effects of the abi1-1 transgene in tobacco (6), treatment with
the protein kinase inhibitor K-252a could partially restore ABA regulation of
the anion channel and ABA-induced stomatal closure in the A. thaliana abi1-1
mutant (114). The abi2-1 mutation also suppressed the ABA activation of Stype anion channels, but curiously, this inhibition could not be counterbalanced
by K-252a treatments (114). In addition, the abi2-1 mutation also diminished
the background activity of inward-rectifying K+ channels (114), an effect observed neither in the abi1-1 A. thaliana mutant (114) nor in the abi1-1 transgenic
tobacco plants (6). The differential effects of the abi1 and abi2 mutations on
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
213
the background activity of inward-rectifying K+ channels, and the differential
sensitivity of these mutants to K-252a, thus indicate that, although the ABI1
and ABI2 proteins are homologous PP2Cs, the functions of these proteins in
stomatal regulation, as in other physiological responses, are nonredundant.
The apparent discrepancies between the above-mentioned results on abi1-1
transgenic tobacco and abi1-1 mutant A. thaliana plants may be indicative of
the functional flexibility of ABI1 in maintaining an integrated ABA regulation
of both K+ and anion channels, depending on the imposed (environmental or
experimental) conditions. This would be analogous to the relative importance
of the ABA-induced increase in [Ca]i, which is subjected to both experimental
(89) and environmental (2) influences. A more serious problem in terms of
formulating a unified model of stomatal regulation, however, is how many
species-dependent differences exist in ABA signaling. For instance, various
pharmacological studies indicate that PP1/PP2A protein phosphatases (distinct
from the ABI1 and ABI2 PP2Cs) act as positive regulators of anion currents in A.
thaliana guard cells (114), but as negative regulators in Vicia, Commelina, and
N. benthamiana (43, 125). Therefore, it seems that detailed comparative studies
with different species would be necessary before a fuller understanding of the
signaling cascades that mediate stomatal regulation by ABA would emerge.
ABA SIGNALING TO GUARD CELL NUCLEUS As described above, stomatal
guard cells have been used extensively as a cellular system to explore the transduction pathways that target the ABA signal to ion channels during stomatal
closing. These responses are rapid and are thus thought to be operationally
distinct from long-term ABA responses that require RNA and protein synthesis
(166). However, hormone induction of gene expression at the transcriptional
level can also take place within minutes, as has been observed in the case of
auxin (93). The relevance of ABA in gene activation in guard cells has only
been explored recently. Several promoters or mRNAs have been shown to be
induced in guard cells by exogenous ABA treatment (53, 110, 137, 147, 157).
These studies demonstrate that guard cells are competent to relay ABA signals
to the nucleus. Initial attempts are being made to analyze whether identical or
distinct signaling pathways mediate the ABA regulations of ion channels and
gene expression in guard cells (53). It also remains to be established whether
there are gene products directly implicated in controlling stomatal movements
that are regulated by ABA transcriptionally.
CONCLUSION AND PERSPECTIVES
In recent years, the research into the molecular and physiological action of
ABA has benefited tremendously from cross-fertilization of different expertise
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
214
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
and ideas. Studies with optically pure ABA analogues revealed that the stereochemical requirements of ABA are not identical in all ABA responses (21, 156),
indicating that higher plants may contain several types of ABA receptors. Evidence for ABA perception sites located both at the cell surface and intracellularly has come from analyses on the regulation of ion fluxes in guard cells.
Whether this model is applicable to other cell types, and to more long-term
responses involving changes in gene expression, are important questions to be
explored (for instance, see 36). In addition, even though locations of these
reception sites can be detected physiologically, we have no firm idea whether
they are functionally distinct, and if so, what physiological relevance they may
harbor. Cloning genes of ABA receptors and creating corresponding mutants
would thus constitute a major step toward dissecting these initial events of ABA
action.
Besides reception sites, we also need to improve further our understanding of the more downstream events in the transduction cascades triggered by
ABA signals. Recent advances point to the central role of reversible protein
phosphorylation in mediating several of the physiological responses to ABA.
Much work, however, is clearly needed to identify the pertinent kinases and
phosphatases, and cellular targets of their action.
The ectopic expression of the seed-specific ABI3 gene in leaves resulted in
activation of several otherwise seed-specific genes. This observation and the
pleiotropic phenotypes of some ABA response mutants raise the question of
the degree of similarity between signaling cascades in the different tissues (or
cell types in the same tissue). It might be possible that many core components
of the ABA signaling network exist in different tissues. A simple model would
be that these central cascades are then regulated by cell-specific factors such
as the VP1/ABI3-like proteins. In this light, ABA-stimulated protein kinases
with apparent specificity to guard cells may play similar deterministic roles in
activating a branch of the ABA pathway in this cell type.
Isolation of additional mutants by judicious genetic screens (taking into account the potential for redundancy in signaling components) will no doubt
enrich our knowledge about regulatory points in ABA action, which might
include modulation in the activity of synthetic enzymes and transport of the
hormone (150). These two latter points have not been the subject of intense
investigations. Furthermore, mutations that simultaneously alter the responsiveness to ABA and other hormones or developmental clues, will permit a
fuller appreciation of cross-talk between ABA and other cellular signals. Several mutants of this type have already been isolated in A. thaliana (Table 1).
The eventual cloning of the genes identified by mutational analyses will reveal
their molecular identity and, in some cases, suggest possible functions based on
homologies with known proteins. Genes with unexpected structural features
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
215
(such as CDT-1 in C. plantagineum) will divulge novel signal transduction
mechanisms, to the delight of researchers with iconoclastic tendencies.
The isolation of genes responsive to ABA, coupled with promoter analyses,
are vital to our understanding of how combinatorial and synergistic actions of
cis-acting elements and trans-acting factors are involved in the versatile control
of the output response. Other approaches, such as biochemical purification and
those based on interaction cloning, will undoubtedly complement the more
established technologies in unraveling additional signaling elements or even
signaling complexes.
Investigators with a pioneering spirit have already attempted to reconstruct
particular signaling cascades by reassembling individual components suspected
to play the relevant roles. These are much welcome advances, since these
cellular systems will complement the more established guard cell model. It is
certain that continuation of such a multidisciplinary approach will yield ever
deeper insight not only into ABA signal transduction itself but also into how
ABA and other signaling molecules jointly coordinate physiological responses.
ACKNOWLEDGMENTS
Work in the authors’ laboratory is supported by the Centre National de la
Recherche Scientifique and grants from the International Human Frontier
Science Program (RG-303/95), the European Community BIOTECH program
(BIO4-CT96-0062), and the Groupement de Recherches et d’Etudes sur les
Génomes (Décision 9-95).
Visit the Annual Reviews home page at
http://www.AnnualReviews.org.
Literature Cited
1. Addicott FT, Carns HR. 1983. History and
introduction. In Abscisic Acid, ed. FT Addicott, pp. 1–21. New York: Praeger Sci.
2. Allan AC, Fricker MD, Ward JL, Beale
MH, Trewavas AJ. 1994. Two transduction pathways mediate rapid effects of
abscisic acid in Commelina guard cells.
Plant Cell 6:1319–28
3. Allen GJ, Muir SR, Sanders D. 1995.
Release of Ca2+ from individual plant
vacuoles by both InsP3 and cyclic ADPribose. Science 268:735–37
4. Allen GJ, Sanders D. 1995. Calcineurin,
a type 2B protein phosphatase, modulates the Ca2+-permeable slow vacuolar
ion channel of stomatal guard cells. Plant
Cell 7:1473–83
5. Anderson BE, Ward JM, Schroeder JI.
1994. Evidence for an extracellular reception site for abscisic acid in Commelina
guard cells. Plant Physiol. 104:1177–83
6. Armstrong F, Leung J, Grabov A, Brearley J, Giraudat J, Blatt MR. 1995. Sensitivity to abscisic acid of guard cell K+
channels is suppressed by abi1-1, a mutant Arabidopsis gene encoding a putative
protein phosphatase. Proc. Natl. Acad.
Sci. USA 92:9520–24
7. Artsaenko O, Peisker M, zur Nieden U,
Fiedler U, Weiler EW, et al. 1995. Expression of a single chain Fv antibody against
abscisic acid creates a wilty phenotype in
transgenic tobacco. Plant J. 8:745–50
8. Assmann SM. 1993. Signal transduction
in guard cells. Annu. Rev. Cell Biol.
9:345–75
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
216
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
9. Deleted in proof
10. Benning G, Ehrler T, Meyer K, Leube M,
Rodriguez P, Grill E. 1996. Genetic analysis of ABA-mediated control of plant
growth. Proc. Workshop Abscisic Acid
Signal Transduction Plants, Madrid, pp.
34. Madrid: Juan March Found.
11. Berger S, Bell E, Mullet JE. 1996. Two
methyl jasmonate-insensitive mutants
show altered expression of AtVsp in response to methyl jasmonate and wounding. Plant Physiol. 111:525–31
12. Bertauche N, Leung J, Giraudat J. 1996.
Protein phosphatase activity of abscisic
acid insensitive 1 (ABI1) protein from
Arabidopsis thaliana. Eur. J. Biochem.
241:193–200
13. Bitoun R, Rousselin P, Caboche M. 1990.
A pleiotropic mutation results in crossresistance to auxin, abscisic acid and paclobutrazol. Mol. Gen. Genet. 220:234–
39
14. Blatt MR. 1990. Potassium channel currents in intact stomatal guard cells: rapid
enhancement by abscisic acid. Planta
180:445–55
15. Blatt MR, Armstrong F. 1993. K+ channels of stomatal guard cells: abscisic
acid–evoked control of the outward rectifier mediated by cytoplasmic pH. Planta
191:330–41
16. Blatt MR, Thiel G. 1993. Hormonal control of ion channel gating. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 44:543–
67
17. Blatt MR, Thiel G, Trentham DR. 1990.
Reversible inactivation of K+ channels
of Vicia stomatal guard cells following
the photolysis of caged inositol 1,4,5trisphosphate. Nature 346:766–69
18. Bobb AJ, Chern M-S, Bustos MM. 1997.
Conserved RY-repeats mediate transactivation of seed-specific promoters by the
developmental regulator PvALF. Nucleic
Acids Res. 25:641–47
19. Bobb AJ, Eiben HG, Bustos MM. 1995.
PvAlf, an embryo-specific acidic transcriptional activator enhances gene expression from phaseolin and phytohemagglutinin promoters. Plant J. 8:331–43
20. Busk PK, Jensen AB, Pagès M. 1997.
Regulatory elements in vivo in the promoter of the abscisic acid responsive gene
rab17 from maize. Plant J. 11:1285–
95
21. Chandler JW, Abrams SR, Bartels D.
1997. The effect of ABA analogs on
callus viability and gene expression in
Craterostigma plantagineum. Physiol.
Plant. 99:465–69
22. Clouse SD, Langford M, McMorris TC.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
1996. A brassinosteroid-insensitive mutant in Arabidopsis thaliana exhibits multiple defects in growth and development.
Plant Physiol. 111:671–78
Cousson A, Cotelle V, Vavasseur A. 1995.
Induction of stomatal closure by vanadate
or a light/dark transition involves Ca2+calmodulin-dependent protein phosphorylations. Plant Physiol. 109:491–97
Cutler S, Ghassemian M, Bonetta D,
Cooney S, McCourt P. 1996. A protein
farnesyl transferase involved in abscisic
acid signal transduction in Arabidopsis.
Science 273:1239–41
de Bruxelles GL, Peacock WJ, Dennis ES,
Dolferus R. 1996. Abscisic acid induces
the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol. 111:381–91
Dietrich P, Hedrich R. 1994. Interconversion of fast and slow gating modes
of GCAC1, a guard cell anion channel.
Planta 195:301–4
Finkelstein RR. 1994. Mutations at two
new Arabidopsis ABA response loci are
similar to the abi3 mutations. Plant J.
5:765–71
Finkelstein RR, Somerville CR. 1990.
Three classes of abscisic acid (ABA)–
insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses. Plant Physiol.
94:1172–79
Deleted in proof
Frandsen G, Müller-Uri F, Nielsen M,
Mundy J, Skriver K. 1996. Novel plant
Ca2+-binding protein expressed in response to abscisic acid and osmotic stress.
J. Biol. Chem. 271:343–48
Furini A, Koncz C, Salamini F, Bartels
D. 1997. High level transcription of a
member of a repeated gene family confers dehydration tolerance to callus tissue
of Craterostigma plantagineum. EMBO J.
16:3599–608
Gehring CA, Irving HR, Parish RW. 1990.
Effects of auxin and abscisic acid on cytosolic calcium and pH in plant cells.
Proc. Natl. Acad. Sci. USA 87:9645–49
Gilmour SJ, Thomashow MF. 1991. Cold
acclimation and cold-regulated gene expression in ABA mutants of Arabidopsis
thaliana. Plant Mol. Biol. 17:1233–40
Gilroy S, Fricker MD, Read ND, Trewavas AJ. 1991. Role of calcium in signal
transduction of Commelina guard cells.
Plant Cell 3:333–44
Gilroy S, Jones RL. 1992. Gibberellic
acid and abscisic acid coordinately regulate cytoplasmic calcium and secretory
activity in barley aleurone protoplasts.
Proc. Natl. Acad. Sci. USA 89:3591–95
P1: ARS/ary/rck
March 23, 1998
P2: ARS/plb
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
36. Gilroy S, Jones RL. 1994. Perception of
gibberellin and abscisic acid at the external face of the plasma membrane of barley (Hordeum vulgare L.) aleurone protoplasts. Plant Physiol. 104:1185–92
37. Gilroy S, Read ND, Trewavas AJ. 1990.
Elevation of cytoplasmic calcium by
caged calcium or caged inositol trisphosphate initiates stomatal closure. Nature
343:769–71
38. Giraudat J, Hauge BM, Valon C, Smalle J,
Parcy F, Goodman HM. 1992. Isolation of
the Arabidopsis ABI3 gene by positional
cloning. Plant Cell 4:1251–61
39. Giraudat J, Parcy F, Bertauche N, Gosti F,
Leung J, et al. 1994. Current advances in
abscisic acid action and signaling. Plant
Mol. Biol. 26:1557–77
40. Goh C-H, Kinoshita T, Oku T, Shimazaki K-I. 1996. Inhibition of blue
light–dependent H+ pumping by abscisic
acid in Vicia guard-cell protoplasts. Plant
Physiol. 111:433–40
41. Gosti F, Bertauche N, Vartanian N, Giraudat J. 1995. Abscisic acid–dependent and
–independent regulation of gene expression by progressive drought in Arabidopsis thaliana. Mol. Gen. Genet. 246:10–
18
42. Grabov A, Blatt MR. 1997. Parallel control of the inward-rectifier K+ channel by
cytosolic free Ca2+ and pH in Vicia guard
cells. Planta 201:84–95
43. Grabov A, Leung J, Giraudat J, Blatt MR.
1997. Alteration of anion channel kinetics
in wild-type and abi1-1 transgenic Nicotiana benthamiana guard cells by abscisic
acid. Plant J. 12:203–13
44. Guiltinan MJ, Marcotte WR, Quatrano
RS. 1990. A plant leucine zipper protein
that recognizes an abscisic acid response
element. Science 250:267–71
45. Harris MJ, Outlaw WH Jr. 1991. Rapid
adjustment of guard-cell abscisic acid
levels to current leaf-water status. Plant
Physiol. 95:171–73
46. Deleted in proof
47. Hattori T, Terada T, Hamasuna S. 1994.
Sequence and functional analyses of the
rice gene homologous to the maize Vp1.
Plant Mol. Biol. 24:805–10
48. Hattori T, Terada T, Hamasuna S. 1995.
Regulation of the Osem gene by abscisic
acid and the transcriptional activator VP1:
analysis of cis-acting promoter elements
required for regulation by abscisic acid
and VP1. Plant J. 7:913–25
49. Deleted in proof
50. Hedrich R, Busch H, Raschke K. 1990.
Ca2+ and nucleotide dependent regulation of voltage dependent anion channels
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
217
in the plasma membrane of guard cells.
EMBO J. 9:3889–92
Heimovaara-Dijkstra S, Nieland TJF, van
der Meulen RM, Wang M. 1996. Abscisic acid–induced gene-expression requires the activity of protein(s) sensitive
to the protein-tyrosine phosphatase inhibitor phenylarsine oxide. Plant Growth
Regul. 18:115–23
Deleted in proof
Hey SJ, Bacon A, Burnett E, Neill SJ.
1997. Abscisic acid signal transduction
in epidermal cells of Pisum sativum L.
Argenteum: Both dehydrin mRNA accumulation and stomatal responses require
protein phosphorylation and dephosphorylation. Planta 202:85–92
Hill A, Nantel A, Rock CD, Quatrano
RS. 1996. A conserved domain of the
Viviparous-1 gene product enhances the
DNA binding activity of the bZIP protein
EmBP-1 and other transcription factors.
J. Biol. Chem. 271:3366–74
Hirayama T, Ohto C, Mizoguchi T, Shinozaki K. 1995. A gene encoding a
phosphatidylinositol-specific phospholipase C is induced by dehydration and salt
stress in Arabidopsis thaliana. Proc. Natl.
Acad. Sci. USA 92:3903–7
Hoecker U, Vasil IK, McCarty DR. 1995.
Integrated control of seed maturation and
germination programs by activator and
repressor functions of Viviparous-1 of
maize. Genes Dev. 9:2459–69
Holappa LD, Walker-Simmons MK.
1995. The wheat abscisic acid-responsive
protein kinase mRNA, PKABA1, is upregulated by dehydration, cold temperature, and osmotic stress. Plant Physiol.
108:1203–10
Hong SW, Jon JH, Kwak JM, Nam HG.
1997. Identification of a receptor-like protein kinase gene rapidly induced by abscisic acid, dehydration, high salt, and
cold treatments in Arabidopsis thaliana.
Plant Physiol. 113:1203–12
Hwang IW, Goodman HM. 1995. An Arabidopsis thaliana root-specific kinase homolog is induced by dehydration, ABA,
and NaCl. Plant J. 8:37–43
Ingram J, Bartels D. 1996. The molecular
basis of dehydration tolerance in plants.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
47:377–403
Irving HR, Gehring CA, Parish RW. 1992.
Changes in cytosolic pH and calcium of
guard cells precede stomatal movements.
Proc. Natl. Acad. Sci. USA 89:1790–
94
Iturriaga G, Leyns L, Villegas A,
Gharaibeh R, Salamini F, Bartels D. 1996.
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
218
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
A family of novel myb-related genes
from the resurrection plant Craterostigma
plantagineum are specifically expressed
in callus and roots in response to ABA or
desiccation. Plant Mol. Biol. 32:707–16
Iwasaki T, Yamaguchi-Shinozaki K, Shinozaki K. 1995. Identification of a cisregulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis. Mol. Gen. Genet.
247:391–98
Kaiser WM, Hartung W. 1981. Uptake
and release of abscisic acid by isolated photoautotrophic mesophyll cell,
depending on pH gradients. Plant Physiol. 68:202–6
Kao C-Y, Cocciolone SM, Vasil IK, McCarty DR. 1996. Localization and interaction of the cis-acting elements for abscisic acid, VIVIPAROUS1, and light activation of the C1 gene of maize. Plant
Cell 8:1171–79
Deleted in proof
Deleted in proof
Kim SY, Chung H-J, Thomas TL. 1997.
Isolation of a novel class of bZIP transcription factors that interact with ABAresponsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system. Plant J.
11:1237–51
Knetsch MLW, Wang M, Snaar-Jagalska
BE, Heimovaara-Dijkstra S. 1996. Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone
protoplasts. Plant Cell 8:1061–67
Koornneef M, Hanhart CJ, Hilhorst
HWM, Karssen CM. 1989. In vivo inhibition of seed development and reserve
protein accumulation in recombinants of
abscisic acid biosynthesis and responsiveness mutants in Arabidopsis thaliana.
Plant Physiol. 90:463–69
Koornneef M, Jorna ML, Brinkhorst-van
der Swan DLC, Karssen CM. 1982. The
isolation of abscisic acid (ABA) deficient
mutants by selection of induced revertants in nongerminating gibberellin sensitive lines of Arabidopsis thaliana (L.)
Heynh. Theor. Appl. Genet. 61:385–93
Koornneef M, Reuling G, Karssen CM.
1984. The isolation and characterization of abscisic acid-insensitive mutants
of Arabidopsis thaliana. Physiol. Plant.
61:377–83
Kuo A, Cappelluti S, Cervantes-Cervantes M, Rodriguez M, Bush DS. 1996.
Okadaic acid, a protein phosphatase inhibitor, blocks calcium changes, gene expression, and cell death induced by gib-
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
berellin in wheat aleurone cells. Plant
Cell 8:259–69
Kusano T, Berberich T, Harada M, Suzuki
N, Sugawara K. 1995. A maize DNAbinding factor with a bZIP motif is induced by low temperature. Mol. Gen.
Genet. 248:507–17
Lee YS, Choi YB, Suh S, Lee J, Assmann
SM, et al. 1996. Abscisic acid–induced
phosphoinositide turnover in guard cell
protoplasts of Vicia faba. Plant Physiol.
110:987–96
Lemtiri-Chlieh F, MacRobbie EAC.
1994. Role of calcium in the modulation
of Vicia guard cell potassium channels
by abscisic acid: a patch clamp study. J.
Membr. Biol. 137:99–107
Léon-Kloosterziel KM, Gil MA, Ruijs
GJ, Jacobsen SE, Olszewski NE, et al.
1996. Isolation and characterization of abscisic acid-deficient Arabidopsis mutants
at two new loci. Plant J. 10:655–61
Leung J, Bouvier-Durand M, Morris P-C,
Guerrier D, Chefdor F, Giraudat J. 1994.
Arabidopsis ABA-response gene ABI1:
features of a calcium-modulated protein
phosphatase. Science 264:1448–52
Leung J, Merlot S, Giraudat J. 1997.
The Arabidopsis ABSCISIC ACIDINSENSITIVE 2 (ABI2) and ABI1 genes
encode redundant protein phosphatases
2C involved in abscisic acid signal
transduction. Plant Cell 9:759–71
Leydecker M-T, Moureaux T, Kraepiel
Y, Schnorr K, Caboche M. 1995. Molybdenum cofactor mutants, specifically impaired in xanthine dehydrogenase activity
and abscisic acid biosynthesis, simultaneously overexpress nitrate reductase. Plant
Physiol. 107:1427–31
Li JX, Assmann SM. 1996. An abscisic
acid-activated and calcium-independent
protein kinase from guard cells of Fava
bean. Plant Cell 8:2359–68
Li WW, Luan S, Schreiber SL, Assmann
SM. 1994. Evidence for protein phosphatase 1 and 2A regulation of K+ channels of two types of leaf cells. Plant Physiol. 106:963–70
Lu GH, Paul A-L, McCarty DR, Ferl RJ.
1996. Transcription factor veracity: Is
GBF3 responsible for ABA-regulated expression of Arabidopsis Adh? Plant Cell
8:847–57
Luan S, Li WW, Rusnak F, Assmann SM,
Schreiber SL. 1993. Immunosuppressants
implicate protein phosphatase regulation
of K+ channels in guard cells. Proc. Natl.
Acad. Sci. USA 90:2202–6
MacRobbie EAC. 1995. Effects of ABA
on 86Rb+ fluxes at plasmalemma and
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
86.
87.
88.
88a.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
tonoplast of stomatal guard cells. Plant
J. 7:835–43
MacRobbie EAC. 1995. ABA-induced
ion efflux in stomatal guard cells: multiple actions of ABA inside and outside
the cell. Plant J. 7:565–76
Mäntylä E, Lang V, Palva ET. 1995. Role
of abscisic acid in drought-induced freezing tolerance, cold acclimation, and accumulation of LTI78 and RAB18 proteins
in Arabidopsis thaliana. Plant Physiol.
107:141–48
Marin E, Nussaume L, Quesada A,
Gonneau M, Sotta B, et al. 1996. Molecular identification of zeaxanthin epoxidase
of Nicotiana plumbaginifolia, a gene involved in abscisic acid biosynthesis and
corresponding to ABA locus of Arabidopsis thaliana. EMBO J. 15:2331–42
McAinsh MR, Brownlee AM, Hetherington AM. 1990. Abscisic acid-induced elevation of guard cell cytosolic Ca2+ precedes stomatal closure. Nature 343:186–
88
McAinsh MR, Brownlee C, Hetherington AM. 1992. Visualizing changes in
cytosolic-free Ca2+ during the response
of stomatal guard cells to abscisic acid.
Plant Cell 4:1113–22
McAinsh MR, Brownlee C, Hetherington
AM. 1997. Calcium ions as second messengers in guard cell signal transduction.
Physiol. Plant. 100:16–29
McCarty DR. 1995. Genetic control and
integration of maturation and germination pathways in seed development. Annu.
Rev. Plant Physiol. Plant Mol. Biol.
46:71–93
McCarty DR, Hattori T, Carson CB,
Vasil V, Lazar M, Vasil IK. 1991.
The viviparous-1 developmental gene of
maize encodes a novel transcriptional activator. Cell 66:895–905
McClure BA, Hagen G, Brown CS, Gee
MA, Guilfoyle TJ. 1989. Transcription,
organization, and sequence of an auxinregulated gene cluster in soybean. Plant
Cell 1:229–39
Deleted in proof
Deleted in proof
Meurs C, Basra AS, Karssen CM, van
Loon LC. 1992. Role of abscisic acid in
the induction of desiccation tolerance in
developing seeds of Arabidopsis thaliana.
Plant Physiol. 98:1484–93
Meyer K, Leube MP, Grill E. 1994. A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana.
Science 264:1452–55
Miedema H, Assmann SM. 1996. A
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
219
membrane-delimited effect of internal pH
on the K+ outward rectifier of Vicia faba
guard cells. J. Membr. Biol. 154:227–37
Mori IC, Muto S. 1997. Abscisic acid
activates a 48-kilodalton protein kinase
in guard cell protoplasts. Plant Physiol.
113:833–39
Nakagawa H, Ohmiya K, Hattori T. 1996.
A rice bZIP protein, designated OSBZ8,
is rapidly induced by abscisic acid. Plant
J. 9:217–27
Nambara E, Keith K, McCourt P, Naito
S. 1995. A regulatory role for the ABI3
gene in the establishment of embryo maturation in Arabidopsis thaliana. Development 121:629–36
Nambara E, Naito S, McCourt P. 1992. A
mutant of Arabidopsis which is defective
in seed development and storage protein
accumulation is a new abi3 allele. Plant
J. 2:435–41
Nantel A, Quatrano RS. 1996. Characterization of three rice basic/leucine zipper factors, including two inhibitors of
EmBP-1 DNA binding activity. J. Biol.
Chem. 271:31296–305
Nelson D, Salamini F, Bartels D.
1994. Abscisic acid promotes novel
DNA-binding activity to a desiccationrelated promoter of Craterostigma plantagineum. Plant J. 5:451–58
Oeda K, Salinas J, Chua N-H. 1991. A tobacco bZip transcription activator (TAF1) binds to a G-box-like motif conserved
in plant genes. EMBO J. 10:1793–802
Ogunkami AB, Tucker DJ, Mansfield TA.
1973. An improved bioassay for abscisic
acid and other antitranspirants. New Phytol. 72:277–78
Ono A, Izawa T, Chua N-H, Shimamoto K. 1996. The rab16B promoter
of rice contains two distinct abscisic
acid-responsive elements. Plant Physiol.
112:483–91
Ooms JJJ, Léon-Kloosterziel KM, Bartels D, Koornneef M, Karssen CM.
1993. Acquisition of desiccation tolerance and longevity in seeds of Arabidopsis thaliana. A comparative study using
abscisic acid–insensitive abi3 mutants.
Plant Physiol. 102:1185–91
Paiva R, Kriz AL. 1994. Effect of abscisic
acid on embryo-specific gene expression
during normal and precocious germination in normal and viviparous maize (Zea
mays) embryos. Planta 192:332–39
Parcy F, Giraudat J. 1997. Interactions between the ABI1 and the ectopically expressed ABI3 genes in controlling abscisic
acid responses in Arabidopsis vegetative
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
220
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
tissues. Plant J. 11:693–702
111. Parcy F, Valon C, Kohara A, Miséra
S, Giraudat J. 1997. The ABSCISIC
ACID-INSENSITIVE 3 (ABI3), FUSCA
3 (FUS3) and LEAFY COTYLEDON 1
(LEC1) loci act in concert to control
multiple aspects of Arabidopsis seed development. Plant Cell. 9:1265–77
112. Parcy F, Valon C, Raynal M, GaubierComella P, Delseny M, Giraudat J. 1994.
Regulation of gene expression programs
during Arabidopsis seed development:
roles of the ABI3 locus and of endogenous abscisic acid. Plant Cell 6:1567–
82
113. Paterson NW, Weyers JDB, Brook RA.
1988. The effect of pH on stomatal sensitivity to abscisic acid. Plant Cell Environ.
11:83–89
114. Pei Z-M, Kuchitsu K, Ward JM, Schwarz
M, Schroeder JI. 1997. Differential abscisic acid regulation of guard cell slow
anion channels in Arabidopsis wild-type
and abi1 and abi2 mutants. Plant Cell
9:409–23
115. Pei Z-M, Ward JM, Harper JF, Schroeder
JI. 1996. A novel chloride channel in Vicia
faba guard cell vacuoles activated by the
serine/threonine kinase, CDKP. EMBO J.
15:6564–74
116. Pena-Cortes H, Fisahn J, Willmitzer L.
1995. Signals involved in wound-induced
proteinase inhibitor II gene expression
in tomato and potato plants. Proc. Natl.
Acad. Sci. USA 92:4106–13
117. Pla M, Vilardell J, Guiltinan MJ, Marcotte
WR, Niogret M-F, et al. 1993. The cisregulatory element CCACGTGG is involved in ABA and water-stress responses
of the maize gene rab28. Plant Mol. Biol.
21:259–66
118. Raskin I, Ladyman JAR. 1988. Isolation and characterization of a barley mutant with abscisic acid-insensitive stomata. Planta 173:73–78
119. Robertson DS. 1955. The genetics of
vivipary in maize. Genetics 40:745–60
120. Robichaud C, Sussex IM. 1986. The response of viviparous-1 and wild-type embryos of Zea mays to culture in the presence of abscisic acid. J. Plant Physiol.
126:235–42
121. Rock CD, Quatrano RS. 1995. The role
of hormones during seed development. In
Plant Hormones, ed. PJ Davies, pp. 671–
97. Dordrecht: Kluwer
122. Roelfsema MRG, Prins HBA. 1995. Effect of abscisic acid on stomatal opening
in isolated epidermal strips of abi mutants
of Arabidopsis thaliana. Physiol. Plant.
95:373–78
123. Roelfsema MRG, Prins HBA. 1997. Ion
channels in guard cells of Arabidopsis
thaliana. Planta 202:18–27
124. Savouré A, Hua X-J, Bertauche N, Van
Montagu M, Verbruggen N. 1997. Abscisic acid-independent and abscisic aciddependent regulation of proline biosynthesis following cold and osmotic stresses
in Arabidopsis thaliana. Mol. Gen. Genet.
254:104–9
125. Schmidt C, Schelle I, Liao Y-J, Schroeder
JI. 1995. Strong regulation of slow anion channels and abscisic acid signaling
in guard cells by phosphorylation and dephosphorylation events. Proc. Natl. Acad.
Sci. USA 92:9535–39
126. Deleted in proof
127. Schroeder JI, Hagiwara S. 1989. Cytosolic calcium regulates ion channels in the
plasma membrane of Vicia faba guard
cells. Nature 338:427–30
128. Schroeder JI, Hagiwara S. 1990. Repetitive increases in cytosolic Ca2+ of guard
cells by abscisic acid activation of nonselective Ca2+-permeable channels. Proc.
Natl. Acad. Sci. USA 87:9305–9
129. Schroeder JI, Keller BU. 1992. Two types
of anion channel currents in guard cells
with distinct voltage regulation. Proc.
Natl. Acad. Sci. USA 89:5025–29
130. Schroeder JI, Raschke K, Neher E. 1987.
Voltage dependence of K+ channels in
guard cells protoplasts. Proc. Natl. Acad.
Sci. USA 84:4108–12
131. Schultz TF, Spiker S, Quatrano RS. 1996.
Histone H1 enhances the DNA binding
activity of the transcription factor EmBP1. J. Biol. Chem. 271:25742–45
132. Schwartz A, Ilan N, Schwarz M, Scheaffer J, Assmann SM, Schroeder JI. 1995.
Anion-channel blockers inhibit S-type anion channels and abscisic responses in
guard cells. Plant Physiol. 109:651–58
133. Schwartz A, Wu W-H, Tucker EB, Assmann SM. 1994. Inhibition of inward
K+ channels and stomatal response by
abscisic acid: an intracellular locus of
phytohormone action. Proc. Natl. Acad.
Sci. USA 91:4019–23
134. Schwartz SH, Léon-Kloosterziel KM,
Koornneef M, Zeevaart JAD. 1997. Biochemical characterization of the aba2 and
aba3 mutants in Arabidopsis thaliana.
Plant Physiol. 114:161–66
135. Schwartz SH, Tan BC, Gage DA, Zeevaart
JAD, McCarty DR. 1997. Specific oxidative cleavage of carotenoids by VP14 of
maize. Science 276:1872–74
136. Sheen J. 1996. Ca2+-dependent protein
kinases and stress signal transduction in
plants. Science 274:1900–2
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
ABA SIGNALING
137. Shen LM, Outlaw WH, Epstein LM.
1995. Expression of an mRNA with sequence similarity to pea dehydrin (Psdhn1) in guard cells of Vicia faba in response to exogenous abscisic acid. Physiol. Plant. 95:99–105
138. Shen QX, Ho T-HD. 1995. Functional
dissection of an abscisic acid (ABA)inducible gene reveals two independent
ABA-responsive complexes each containing a G-box and a novel cis-acting element. Plant Cell 7:295–307
139. Shen QX, Zhang PH, Ho T-HD. 1996.
Modular nature of abscisic acid (ABA)
response complexes: composite promoter
units that are necessary and sufficient for
ABA induction of gene expression in barley. Plant Cell 8:1107–19
140. Shinozaki K, Yamaguchi-Shinozaki K.
1996. Molecular responses to drought
and cold stress. Curr. Opin. Biotechnol.
7:161–67
141. Skriver K, Olsen FL, Rogers JC, Mundy
J. 1991. Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc. Natl. Acad. Sci. USA
88:7266–70
142. Söderman E, Mattson J, Engström P.
1996. The Arabidopsis homeobox gene
ATHB-7 is induced by water deficit and
by abscisic acid. Plant J. 10:375–81
143. Staswick PE, Su WP, Howell SH. 1992.
Methyl jasmonate inhibition of root
growth and induction of a leaf protein are
decreased in an Arabidopsis thaliana mutant. Proc. Natl. Acad. Sci. USA 89:6837–
40
144. Sturaro M, Vernieri P, Castiglioni P,
Binelli G, Gavazzi G. 1996. The rea (red
embryonic axis) phenotype describes a
new mutation affecting the response of
maize embryos to abscisic acid and osmotic stress. J. Exp. Bot. 47:755–62
145. Suzuki M, Kao CY, McCarty DR.
1997. The conserved B3 domain of
VIVIPAROUS1 has a cooperative DNA
binding activity. Plant Cell 9:799–807
146. Taylor IB. 1991. Genetics of ABA synthesis. In Abscisic Acid Physiology and
Biochemistry, ed. WJ Davies, HG Jones,
pp. 23–37. Oxford: Bios Sci.
147. Taylor JE, Renwick KF, Webb AAR,
McAinsh MR, Furini A, et al. 1995. ABAregulated promoter activity in stomatal
guard cells. Plant J. 7:129–34
148. Thiel G, Blatt MR. 1994. Phosphatase antagonist okadaic acid inhibits steady state
K+ currents in guard cells of Vicia faba.
Plant J. 5:727–33
149. Thiel G, MacRobbie EAC, Blatt MR.
1992. Membrane transport in stomatal
150.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
161.
221
guard cells: the importance of voltage
control. J. Membr. Biol. 126:1–18
Trejo CL, Clephan AL, Davies WJ. 1995.
How do stomata read abscisic acid signals? Plant Physiol. 109:803–11
Urao T, Yamaguchi-Shinozaki K, Urao S,
Shinozaki K. 1993. An Arabidopsis myb
homolog is induced by dehydration stress
and its gene product binds to the conserved MYB recognition sequence. Plant
Cell 5:1529–39
Van der Meulen RM, Visser K, Wang
M. 1996. Effects of modulation of calcium levels and calcium fluxes on ABAinduced gene expression in barley aleurone. Plant Sci. 117:75–82
van der Veen R, Heimovaara-Dijkstra S,
Wang M. 1992. Cytosolic alkalinization
mediated by abscisic acid is necessary, but
not sufficient, for abscisic acid–induced
gene expression in barley aleurone protoplasts. Plant Physiol. 100:699–705
Vartanian N, Marcotte L, Giraudat J.
1994. Drought rhizogenesis in Arabidopsis thaliana. Differential responses of hormonal mutants. Plant Physiol. 104:761–
67
Vasil V, Marcotte WR Jr, Rosenkrans L,
Cocciolone SM, Vasil IK, et al. 1995.
Overlap of Viviparous1 (VP1) and abscisic acid response elements in the Em
promoter: G-box elements are sufficient
but not necessary for VP1 transactivation.
Plant Cell 7:1511–18
Walker-Simmons MK, Anderberg RJ,
Rose PA, Abrams SR. 1992. Optically
pure abscisic acid analogs—tools for relating germination inhibition and gene expression in wheat embryos. Plant Physiol.
99:501–7
Wang H, Cutler AJ. 1995. Promoters from kin1 and cor6.6, two Arabidopsis thaliana low-temperature- and
ABA-inducible genes, direct strong βglucuronidase expression in guard cells,
pollen and young developing seeds. Plant
Mol. Biol. 28:619–34
Wang M, Van Duijn B, Schram AW. 1991.
Abscisic acid induces a cytosolic calcium
decrease in barley aleurone protoplasts.
FEBS Lett. 278:69–74
Ward JM, Pei Z-M, Schroeder JI. 1995.
Roles of ion channels in initiation of signal transduction in higher plants. Plant
Cell 7:833–44
Deleted in proof
Wilkinson S, Davies WJ. 1997. Xylem
sap pH increase: a drought signal received
at the apoplastic face of the guard cell that
involves the suppression of saturable abscisic acid uptake by the epidermal sym-
P1: ARS/ary/rck
P2: ARS/plb
March 23, 1998
222
12:33
QC: ARS/uks
T1: ARK
Annual Reviews
AR060-09
LEUNG & GIRAUDAT
plast. Plant Physiol. 113:559–73
162. Wille AC, Lucas WJ. 1984. Ultrastructural and histochemical studies on guard
cells. Planta 160:129–42
163. Wilson AK, Pickett FB, Turner JC, Estelle
M. 1990. A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid. Mol. Gen. Genet.
222:377–83
164. Yamaguchi-Shinozaki K, Shinozaki K.
1993. The plant hormone abscisic acid
mediates the drought-induced expression
but not the seed-specific expression of
rd22, a gene responsive to dehydration
stress in Arabidopsis thaliana. Mol. Gen.
Genet. 238:17–25
165. Yamaguchi-Shinozaki K, Shinozaki K.
1993. Characterization of the expression
of a desiccation-responsive rd29 gene of
Arabidopsis thaliana and analysis of its
promoter in transgenic plants. Mol. Gen.
Genet. 236:331–40
166. Zeevaart JAD, Creelman RA. 1988.
Metabolism and physiology of abscisic
acid. Annu. Rev. Plant Physiol. Plant Mol.
Biol. 39:439–73