Download Coordinate expression of matrix-degrading proteinases and their

Coordinate expression of matrix-degrading proteinases and their activators
and inhibitors in bovine skeletal muscle
D. Balcerzak, L. Querengesser, W. T. Dixon, and V. E. Baracos2
Department of Agriculture, Food and Nutritional Science, University of Alberta,
Edmonton, Alberta, Canada T6G 2P5
ments. Statistical analysis (n = 35) revealed a strong
positive correlation among the mRNA levels of several
elements of the MMP system, including MMP-2, MMP14, TIMP-1, -2, and -3 (r = 0.614 to 0.930, P < 0.0001).
Our results provide an extensive profile of an extracellular proteolytic cascade involving MMP in skeletal
muscle and suggest that 1) the activation cascades of
muscle MMP may be initiated by both plasmin and
membrane-type MMP; 2) a group of genes involved in
the same “arm” of zymogen activation are coexpressed
in this tissue; and 3) skeletal muscle cells, in addition
to the intramuscular fibroblasts, express an extensive
complement of MMP and related proteins.
ABSTRACT: Matrix metalloproteinases (MMP) responsible for degradation of connective tissue are found
in most tissues. The MMP are regulated at the levels
of transcription, zymogen activation by plasmin or
membrane-type- (MT) MMP, and control of enzyme activity by tissue inhibitors of metalloproteinases (TIMP).
Whole bovine skeletal muscle showed multiple MMP
activities on gelatin zymography and also expressed
mRNA encoding MMP-1, -2, -9, -14, and -16, tissue
inhibitors of metalloproteinase (TIMP)-1, -2, and -3 and
plasminogen activator and its receptor. Purified intramuscular fibroblasts and myogenic cell culture derived
from satellite cells expressed most or all of these ele-
Key Words: Connective Tissue, Fibroblasts, Metalloproteinases, Satellite Cells, Skeletal Muscle
2001 American Society of Animal Science. All rights reserved.
Introduction
J. Anim. Sci. 2001. 79:94–107
sons et al., 1997). The MMP gene expression also is
regulated and is influenced by multiple cytokines and
growth factors (Emonard and Grimaud, 1990; Ries and
Petrides, 1995). The role of gene expression in regulation of the alternative zymogen activation cascades is
less clear, but a few published results suggest coordinate expression within the MT-MMP-dependent cascade (Sakamato et al., 1999). A third level of regulation
involves local production of polypeptide tissue inhibitors of metalloproteinases (TIMP) (Murphy and Willembrock, 1995).
Studies of extracellular matrix catabolism in other
organs provide biochemical tools for determination of
MMP activity and gene expression. We used currently
available approaches to undertake a comprehensive
evaluation of the MMP system of bovine skeletal muscle, including the participating proteinases, activators,
and inhibitors of MMP. Our work is the first systematic
study of this system in muscle to include all of these
potential elements and was done with a long-term view
to determining its role in dynamic physiologic, pathologic, and postmortem changes in the intramuscular
connective tissue as it relates to meat tenderization.
The intracellular proteolytic systems of muscle that
degrade the myofibrillar proteins are now well characterized. These processes have been demonstrated to
participate in muscle growth, atrophy, and tissue remodeling in living animals and in postmortem proteolysis. By contrast, the proteolytic processes responsible
for catabolism of the intramuscular connective tissue
remain undefined. In tissues other than muscle, the
matrix metalloproteinases (MMP) represent a family
of enzymes (Parsons et al., 1997) responsible for connective tissue catabolism. Regulation of MMP activities is
complex. The MMP are secreted in a latent form and
activated sequentially in a cascade initiated by plasmin
or membrane-type MMP (MT-MMP) (Figure 1) (Par-
1
This work was supported by the Canadian Beef Industry Development Fund and grants from the Natural Sciences and Engineering
Research Council of Canada to V. E. Baracos and W. T. Dixon. The
authors would like to thank Renate Meuser, Richard Chai, and Linghuo Jiang for their valuable technical assistance and the staff of
the Edmonton Research Station for animal care.
2
Correspondence: phone: (780) 492-7664; fax: (780) 492-4265;
E-mail: [email protected].
Received March 20, 2000.
Accepted August 23, 2000.
Materials and Methods
We adapted currently available approaches for the
study of MMP to bovine skeletal muscle. Because mus94
Skeletal muscle extracellular proteolysis
95
the larger sheets of perimysium (referred to as the “dissectable connective tissue”). Dissectable connective tissues were immediately frozen in liquid nitrogen for enzyme detection or placed in sterile Eagle’s Minimum
Essential Medium (MEM, Life Technologies, Burlington, ON, Canada) for isolation of fibroblasts. Muscles
were frozen in liquid nitrogen for later use in detection
of MMP activities and RNA isolation or transferred
to MEM for isolation of intramuscular fibroblasts and
myogenic cells.
Intramuscular Fibroblast Isolation and Culture
Figure 1. Proposed cascade for activation of the matrix
metalloproteinases. One “arm” of zymogen activation is
thought to involve plasmin in a cascade of events where
the urokinase-type plasminogen activator (uPa) is activated through binding to its cell surface receptor (uPaR)
(Werb et al., 1977; He et al., 1989). Pro-MMP-1, pro-MMP3, and pro-MMP-9 are activated via this way. Another
“arm” of activation may also stem from membrane-typeMMP (MT-MMP), which are expressed at the cell surface
(Sato et al., 1994; Takino et al., 1995; Knäuper et al., 1996).
Pro-MMP-2 and pro-MMP-13 can be activated by these
MT-MMP involving a multimeric complex between MT1MMP, pro-MMP-2, and TIMP-2 (Yu et al., 1998). Black
arrows represent the activation and light grey arrows
represent active MMP degrading the extracellular matrix.
MMP, matrix metalloproteinase; MT-MMP, membrane
type-matrix metalloproteinase; TIMP, tissue inhibitor of
metalloproteinase. Adapted from Parson et al. (1997).
cle is < 5% connective tissue on a protein basis and
the turnover of these proteins is known to be slow, we
anticipated a challenge in terms of the sensitivity of
available methods. Whole muscle and potentially concentrated sources of MMP, including dissectible connective tissue, cultured intramuscular fibroblasts, and satellite cells, were used.
Samples were obtained from animals from a beef research herd maintained at the University of Alberta.
All animals were the same age and sex and on a similar
plane of nutrition at the time of slaughter. Masseter
and semimembranosus muscles were collected at a commercial abattoir immediately after animals were killed.
Muscles were dissected to remove the epimysium and
Single cell suspensions were obtained by enzymatic
digestion (Yablonka-Reuveni et al., 1988) with some
modifications. Briefly, muscle was finely minced and
incubated in trypsin (Life Technologies) adjusted to
0.1% with MEM at 37°C for 50 min with shaking. Samples were centrifuged at 400 × g for 10 min and the
supernate was discarded. The pellets were washed once
with MEM and resuspended in medium 1 (MEM, 10%
horse serum [Life Technologies] 1% antibiotic/antimycotic [Life Technologies]). Cells were dissociated by vigorously mixing the pellet and trituration. The resulting
cell suspension was centrifuged at 400 × g for 10 min.
Pellets were resuspended in medium 1 and immediately
subjected to Percoll density gradient centrifugation,
with the following modifications. The gradients (Percoll-medium 1) were prepared in 15-mL polypropylene
tubes and centrifuged in a fixed angle rotor (Beckman
J-21A, Mississauga, ON, Canada) at 4°C for 10 min at
10,000 × g. Fibroblasts were recovered from the 20%
Percoll region of the gradient by centrifugation (400 ×
g, 10 min) following dilution with two volumes of medium 1. Cell pellets were resuspended in the same medium and cultured in 75-cm2 culture flasks in a humidified atmosphere at 37°C, under 5% CO2 until they
reached confluence. Subsequently, cells were cultured
in serum-free medium for 24 h or as indicated. Media
were collected and cells washed with sterile phosphatebuffered saline and lysed for RNA extraction or analysis
of MMP activity. Flow densitometry using 90° light
scattering as the parameter for sorting has been used
to estimate the homogeneity of cell suspensions
(Yablonka-Reuveni et al., 1988). The majority of cells
(93%) presented the same size and cytoplasm complexity. When placed in culture under conditions that would
be expected to promote fusion of myogenic cells (Dulbecco’s Modified Eagle Medium (DMEM) [Life Technologies] containing 5% horse serum), these cells never
fused.
Myogenic Cell Isolation and Culture
This protocol was adapted from Dodson et al. (1987).
Muscle was diced and ground in a sterile meat grinder
in DMEM. The ground tissue was incubated with pronase (1 mg/mL, Sigma Chemical Co., Oakville, ON,
Canada) in DMEM at 37°C for 45 min. The suspension
96
Balcerzak et al.
was centrifuged at 1,500 × g for 10 min. The supernate
was discarded and the pellet was resuspended in prewarmed DMEM. Cells were separated from muscle debris by filtration (70-␮m cell strainer, Falcon, Franklin
Lakes, NJ) and submitted to a preplating (2 h in a
humidified environment and 5% CO2) to eliminate adherent contaminating fibroblasts. A unique feature of
myoblasts and satellite cells is that when they are
placed under specific conditions, proliferation ceases
and cells migrate, align, and fuse (Dodson et al., 1987).
Cells were thus grown in DMEM containing 15% horse
serum during the 1st 4 d, then transferred to a 5%
horse serum-containing medium for d 5 and 6 to initiate
cell migration, alignment, and fusion. This fusion is
never 100%, and a few myogenic cells become quiescent
(i.e., cease proliferation but do not fuse). Under culture
conditions that promote fusion of myogenic cells, the
only proliferating cells in the culture are the fibroblasts,
and these are sensitive to treatment with cytosine arabinoside (Ara C). Cytosine arabinoside (10−5 M, Sigma
Chemical Co.) was used to treat cultures for 24 h on d 6
of culture to further eliminate fibroblast contamination
(Kufe et al., 1980). Cells were grown from d 7 to d 14
in 1% horse serum-containing medium (to limit proliferation of any surviving fibroblasts) and placed into serum-free medium on d 14 for 12 h. Media were collected
and cells washed with sterile PBS and lysed for RNA
extraction or measurement of MMP activity.
As a measure of fibroblast contamination, cells were
grown, after 24 h of Ara C treatment, in DMEM containing 15% horse serum to stimulate fibroblast proliferation. No fibroblast proliferation was observed under
these conditions. On d 14 of culture, fusion was finished
and the myotubes began their spontaneous contractions. The fusion rate was between 55 and 65% at d 14,
and the culture comprised a mixture of myotubes and
latent satellite cells. For this reason, we refer to this
mixed cell population as “myogenic cell culture.”
We also carried out co-cultures of myogenic cells and
fibroblasts. After the preplating, cells were grown in
DMEM containing 15% horse serum for 1 d, followed
by further culturing in DMEM containing 5% horse
serum to initiate both satellite cell fusion and fibroblast proliferation.
HT-1080 Culture
Human fibrosarcoma HT-1080 cells (CCL-121, American Type Culture Collection, Rockville MD), which are
known to synthesize MMP-1, MMP-2, MMP-3, MMP7, and MMP-9, were used as a positive control (Giambernardi et al., 1998). The HT-1080 cells were cultivated
in MEM containing 2 mM L-glutamine, 1.5 g/L sodium
bicarbonate, 1.0 mM sodium pyruvate, heat-inactivated
10% fetal calf serum, and 1% antibiotic/antimycotic.
The cultures were incubated at 37°C in a humidified
5% CO2 atmosphere until confluency. Cells were then
placed in serum-free medium for 24 h or in serum-free
medium containing phorbol myristate acetate (25 ng/
mL; Sigma Chemical Co.), which stimulates the expression of MMP-1 and -3 in this cell line. Media were
collected and cells were washed with sterile PBS and
lysed for RNA extraction or MMP activity characterization.
Dissectable Connective Tissue
The pieces of dissectable connective tissue were used
for the collagen degradation assay in explant culture,
for zymography, and for the isolation of fibroblasts. Connective tissue pieces were incubated intact in explant
culture using [3H]-type I collagen for detection of collagenase (Zucker et al., 1985). For casein and gelatin
zymographies, frozen pieces of dissected connective tissue were homogenized in extraction buffer (0.01 M cacodylic acid, pH 5.2, 0.15 M CaCl2, 0.1 mM ZnCl2, 2 mM
NaCl; 1 mL buffer/100 mg tissue) (Tyagi et al., 1993).
For isolation of cellular material, 10 g of connective
tissue was cut into small pieces and incubated in
DMEM containing 0.25 mg/mL of bacterial collagenase
(type IA) (Sigma Chemical Co.) at 37°C for 45 min to
isolate the cellular component. After filtration (70-␮m
cell strainer; Falcon) to eliminate the undigested debris
and centrifugation (1,500 × g for 10 min) of this filtrate,
we kept the pellet containing connective tissue cells.
This was used to isolate the RNA.
Isolation of RNA, Northern Blot Analysis,
and Reverse Transcription-PCR
RNA Isolation. Total RNA was isolated using the TRIzol extraction kit (Life Technologies). For muscle, 500
mg of frozen tissue was ground in liquid nitrogen and
homogenized in 5 mL of TRIzol. For the connective
tissue, 5 mL of TRIzol was added to the cell pellet. For
fibroblasts and myogenic cell cultures, 2.5 mL of TRIzol
was added to PBS-washed cells attached to a 175-cm2
flask. Following isolation, RNA was dissolved in distilled water and quantified by UV-spectrophotometry.
Total RNA was used directly for Northern blotting or
reverse-transcription polymerase chain reaction (RTPCR). The quality of RNA samples was confirmed by
observation of ribosomal RNA integrity following electrophoresis and ethidium bromide staining (Chomczynski and Sacchi, 1987).
Northern Blot Analysis. Samples were applied to a
1% agarose gel containing 2% formaldehyde and transferred to a nitrocellulose membrane (Nitropure, MSI,
Westborough, MA) by an 18-h capillary transfer in 10×
saline-sodium citrate (SSC) (1.5 M NaCl, 0.15 M trisodium citrate, pH 7.0). The RNA was fixed to the membrane by baking in a vacuum oven for 2 h at 80°C.
Northern blots were conducted essentially as described
by Kherif et al. (1999). Plasmids containing cDNA inserts for porcine MMP-1, MMP-2, MMP-3, and MMP9 that hybridize with bovine transcripts were developed
in our laboratory.
RT-PCR. For reverse transcription, 2 ␮g of RNA was
incubated 15 min at 37°C with 5× first-strand buffer,
Skeletal muscle extracellular proteolysis
dithiothreitol, and RNase inhibitor (Boehringer Mannheim, Laval, QC, Canada). Oligo dT primer, dideoxynucleotide triphosphate (dNTP) (10 mM each) and 250
U of Moloney murine leukemia virus reverse transcriptase (Life Technologies) were added and the mixture was incubated 60 min at 37°C. An aliquot (5 ␮L)
of the reverse transcription reaction solution was amplified by PCR using 1 U Taq DNA Polymerase (Life
Technologies) in a 50-␮L reaction volume that contained 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM
MgCl2, 0.2 mM dNTP, and 0.5 ␮M of the primers for
the template of interest. Reaction mixtures were amplified in a DNA thermal cycler (PCR system 2400, Perkin
Elmer, Mississauga, ON, Canada) under the following
conditions: 1) an initial denaturation step for 3 min at
95°C; 2) variable number of cycles with denaturation
at 95°C for 1 min, annealing for 1 min, and elongation
at 72°C for 2 min; and 3) incubation at 72°C for 8 min.
The number of cycles of amplification required to obtain
a detectable signal is dependent on the abundance of
the mRNA in the sample material; as few as 18 or as
many as 30 cycles were required for the different gene
products. The cycle number was determined empirically and is reported in the figure legends. The annealing temperature depends on the sequence of the primers
and is specific for each gene product and is also reported
in the figure legends. The PCR products were separated
on 2% agarose gels. After migration, gels were stained
with 0.1 mg/mL ethidium bromide in distilled water.
The amplification products of bovine MMP mRNA
were cloned with the pGEM-T Easy Vector System I
(Promega, Madison, WI) and sequenced (ABI PRISM
Dye terminator cycle sequencing core kit, Perkin Elmer). These sequences have been submitted to GenBank, where they are listed under the accession numbers presented in Table 1.
A semiquantitative RT-PCR was validated for each
gene product. The quantity of amplified product was
determined as a function of the quantity of RNA used
in the RT step. The linear portion of this relationship
was identified, and an RNA quantity from the middle
of this linear range was selected for comparative analysis of RNA samples from different animals. To control
the homogeneity of the RNA concentrations in the different samples and variations of the RT-PCR reactions,
we used the expression of glyceraldehyde 3-phosphate
dehydrogenase (GAPDH), known as a “house-keeping”
gene (Yelich et al., 1997). The GAPDH product was
amplified using the following primers: antisense:
5′TCCACCACCCTGTTGCTGTA; sense: 5′ACCACAGT
CCATGCCATCAC. Custom primer synthesis was done
for the specified sequences by the DNA Synthesis Laboratory in the Department of Biochemistry at the University of Alberta.
97
buffer (0.01 M cacodylic acid, pH 5.2, 0.15 M CaCl2, 0.1
mM ZnCl2, 2 mM NaCl) (1 mL buffer/100 mg tissue).
Following this incubation, the sample was homogenized
with a Polytron (Brinkman, Mississauga, ON, Canada),
and centrifuged for 10 min at 350 × g at 4°C. The pellet
was then resuspended in extraction buffer (1 mL buffer/
100 mg tissue), re-homogenized, and centrifuged, and
the supernates pooled with the first one. This step was
repeated twice. Cells were scraped from culture dishes
with 1 mL of extraction buffer. The homogenate was
sonicated and centrifuged for 10 min at 350 × g at 4°C.
Soluble proteins contained in the supernate were quantified by the BCA protein assay (Pierce, Rockford, IL)
using BSA as a protein standard.
Electrophoresis and MMP Zymography. Samples prepared from cells or tissues containing 15 ␮g of protein
were mixed with 0.25 volumes of nonreducing sample
buffer consisting of 0.3 M Tris-HCl, pH 6.8, 4% SDS,
20% glycerol, and 0.03% bromophenol blue. Electrophoresis was run on 15% SDS-PAGE gels containing gelatin (Type I, 1 mg/mL [Sigma Chemical Co.]) for the
gelatin zymography (Lantz and Ciborowski (1994) or
α-casein (1 mg/mL [Sigma Chemical Co.]) for casein
zymography (Rawdanowicz et al., 1994). After electrophoresis, the gel was removed and incubated for 30 min
at 25°C in Triton X-100 (2.5% in distilled water). After
two 15-min washes in Tris-HCl (50 mM, pH 7.5), gels
were incubated 20 h at 37°C, with gentle shaking, in
50 mM Tris-HCl, pH 7.5, 10 mM CaCl2, 0.05% Brij35. Gels were stained with 0.1% Naphthol blue black
solution in acetic acid/methanol/distilled water
(1:4.5:4.5 by volume) and destained with distilled
water.
Electrophoresis and Western Blot
Samples prepared from cells or tissues containing 15
␮g of protein were mixed with 0.25 volumes of reducing
sample buffer (0.05 M Tris-HCl, pH 6.80, 10% SDS,
0.01% bromophenol blue, 30% glycerol, 1% dithiothreitol), boiled 5 min, and run on a 15% acrylamide SDSPAGE gel (Laemmli, 1970). Fractionated proteins were
then electrotransferred onto nitrocellulose membranes
(Nitropure, MSI, Westborough, MA). After an overnight
incubation at 4°C in blocking solution (Tris-buffered
saline [TBS] containing 5% BSA), the membranes were
placed in TBS containing 1% BSA and specific antibody
(anti-MMP-2 at a dilution of 1/200, Calbiochem, San
Diego, CA). The identification of the antigen-antibody
complex was carried out (via a second antibody coupled
to horseradish peroxidase) using the ECL Western blotting detection kit (Amersham, Bais d’Urfé, QC, Canada)
according to the manufacturer’s instructions.
Collagen Degradation Assay
Zymography
Sample Preparation. After grinding in liquid N, tissue
samples were incubated (24 h at 4°C) in extraction
Thin pieces (∼1 mm) of dissectable connective tissue
(1 cm2) were placed into a Krebs Ringer bicarbonate
buffer, 119 mM NaCl, 25 mM NaHCO3, 4.82 mM KCl,
98
Balcerzak et al.
Table 1. Characteristics of PCR primers and amplified products of a bovine matrix metalloproteinase systema
Primer sequences
PCR
fragment size,
bp
Sense: GCA GCC CAG ATG TGG GGT GCC CG
Antisense: ACA CTT CTG GGG TTT GGG GGC CG
571
Sense: CTT CCC CCG CCA GCC CAA GTG GG
Antisense: GGT GAA CAG GGC TTC ATG GGG GC
510
Sense: GAC TCC ACT CAC ATT CTC CAG G
Antisense: CCT GAA GGA AGA GAT GGC
586
Sense: CCC AAA GAA TGG CCA AGT TC
Antisense: TGC AGA AGC CCA GAT GTG GA
418
Sense: ACG TGG ACA TCT TCG ACG C
Antisense: CGA ACC TCC AGA AGC TCT GC
359
Sense: TCT GGT CTG CTG GCT CAC GC
Antisense: TAG GCA GCA TCA ATA CGG TTG G
472
Sense: ACC ATG AAG GCT ATG AGG CGC CC
Antisense: GTT GAT GGA TGC AGG CAG GCC CC
831
Sense: CTG GTT CTG GCG AGT CAG GC
Antisense: CCT TGT AGA AGT AGG TGT AGG C
424
Sense: CTG GAA GAA GGT TGG ATT TCG TGC
Antisense: ACA TTC TGC CAC ACA TCA AAG G
461
Sense: GTC TGG TGA ATC GAA CTG TGG C
Antisense: GGC TGC AAA CCA AGG CTG
511
Sense: TCC AGG CTC TTG GGG CCT GC
Antisense: CGG CAG TCA ATG AGG AAA GT
665
Sense: GTA CCT GCG TCC CAC CCC ACC
Antisense: GGC AGG CAG GCC AGG TGG CGG
504
Sense: CCT CCT GCT GCT GGG GAC GCT GC
Antisense: AGT CCT GGT GGC CTG CTT ACG GG
643
Sense: GAC CCC TTG GCT CGG GCT CAT CG
Antisense: GCT GGT CCC ACC TCT CCA CGA AG
377
Target
mRNA
MMP-1
MMP-2
MMP-3
MMP-7
MMP-9
MMP-13
MMP-14
MMP-15
MMP-16
uPa
uPaR
TIMP-1
TIMP-2
TIMP-3
GenBank
accession
no.
Homology with
human
sequence
AF134714
83.58%
AF135231
87.04%
AF135232
80.40%
AF135233
80.68%
AF135234
82.39%
AF135235
92.29%
AF144758
86.75%
AF144759
97.10%
AF144760
89.88%
AF144761
79.83%
AF144762
72.15%
AF144763
86.65%
AF144764
90.64%
AF144765
93.95%
a
The amplified product of the expected size for each couple of primers, obtained by reverse transcription-polymerase chain reaction, was
cloned with pGEM-T easy Vector System I (Promega, Madison, WI). Sequence information from these DNA permitted confirmation of their
identity (by homology with human sequences). Sequences have been submitted to GenBank and are saved under the accession numbers listed.
MMP, matrix metalloproteinase; TIMP, tissue inhibitor of metalloproteinase; uPa, urokinase-type plasminogen activator; uPaR, urokinasetype plasminogen activator receptor.
1 mM CaCl2, 1.25 mM MgSO4, 1.24 mM NaH2PO4, 2
mM HEPES, and 5 mM glucose (pH 7.4). Samples were
then transferred to fresh medium containing 0.3 mCi/
mL of N-[propionate-2-3-3H] propionylate collagen (rat
type I, specific activity: 0.2 mCi/mg; Dupont NEN, Boston, MA). Explants were incubated at 30°C, 5% CO2,
in a humidified atmosphere. Samples were dried on a
SpeedVac (Savant Inc., Holbrook, NY) and run on a
12.5% SDS-PAGE gel under reducing conditions (Laemmli, 1970). Gels were processed for fluorography prior
to drying and exposure to x-ray film (Kodak X-OMAT,
Rochester, NY) (Laskey and Mills, 1975). These films
were scanned and analyzed using the Molecular Analyst software (BioRad, Mississauga, ON, Canada).
Statistical Analysis
To observe possible correlation of expression between
the different elements of the extracellular proteolytic
system in bovine semimembranosus muscle (n = 35),
simple regression analyses were performed using the
General Linear Models procedures of SAS (SAS Inst.
Inc., Cary, NC).
Results
Characterization of an Extracellular Proteolytic
System in Skeletal Muscle
Degradation of [3H]-Type I Collagen. Dissectable con-
nective tissue was incubated with [3H]-type I collagen
for up to 4 h. We observed two characteristic fragments
of degradation that corresponded to the 3/4-length fragments of the α1 and α2 chains of the collagen (data
not shown). The presence of these 3/4-length fragments
demonstrated the presence of a collagenase activity
able to degrade type I collagen in the extracellular matrix of skeletal muscle. The MMP-1, MMP-8, and MMP13 are known to exhibit this proteolytic specificity and
were suspected to be responsible for the observed degradation. No detectable activity was seen in incubated
explants of skeletal muscle using this assay. There may
Skeletal muscle extracellular proteolysis
be no net collagenase activity in muscle (i.e., due to the
presence of TIMP); an alternative possibility is that the
assay was not sensitive enough to detect the activity
present.
Zymography. Two major gelatinase activities were
observed (Figure 2) in the homogenate of masseter muscle (lane 6), in connective tissue derived from this muscle (lane 7), and in the positive control cell line HT1080 (lane 5) using zymography. These activities had
apparent molecular weights of 100 kDa and 66 kDa
(the major signal) characteristic of pro-MMP-9 and proMMP-2, respectively, which are known to be expressed
by HT-1080 cells (Huhtala et al., 1991). Activities with
apparent molecular weights of 80 kDa and 62 kDa corresponded to the activated forms of MMP-9 and MMP2, respectively. It seems that the majority of MMP2 exists in its zymogen form in muscle (lane 6) and
connective tissue (lane 7) homogenates. For MMP-9, no
active form was detected in the same samples. A strong
pro-MMP-2 activity was detected in the conditioned
medium obtained from cultured fibroblasts (lane 3),
whereas this activity was less intense in the satellite
cell-conditioned culture medium (lane 1). In the conditioned medium obtained from co-cultures of satellite
cells and fibroblasts, we observed an intermediate level
of pro-MMP-2 activity (lane 2) as compared to individual cultures, showing the influence of fibroblasts in the
satellite cell culture on the quantity of this pro-enzyme
in the conditioned culture medium. Surprisingly, satellite cell culture and co-culture conditioned media exhibited the active form of MMP-2, whereas this was not
seen in the fibroblast-derived medium. This activated
form was observed, however, in the fibroblast homogenate (lane 4). In this sample, an unidentified activity
99
was also observed that had an apparent molecular
weight of about 50 kDa. This could be the zymogen
form of MMP-1 or MMP-3. These results suggest that
fibroblasts may not be the exclusive source of gelatinases within the muscle tissue, because myogenic
cells and whole muscle also expressed these activities.
Western Blot. Western blot analysis was limited by
the lack of commercially available antibodies known to
cross-react with bovine MMP. Additionally, the sensitivity of this technique was problematic. Using HT1080 culture medium as a positive control, we were able
to detect a signal with an anti-MMP-2 antibody, but
only when this conditioned medium was concentrated
30-fold (data not shown). We were also able to detect
MMP-2 with this antibody in conditioned culture media
from intramuscular fibroblasts, also concentrated 30fold (data not shown). No signal was detectable in skeletal muscle homogenates or cultured fibroblast homogenates. Moreover, unconcentrated culture media gave
no signal. It seems that this approach was at least 30fold less sensitive than zymography, which could reveal
activity in unconcentrated culture media and tissue extracts.
Northern Blot. Northern hybridization analysis was
attempted using MMP-1, MMP-3, and MMP-9 probes
on RNA extracted from cultured intramuscular fibroblasts and whole skeletal muscle, but no signal was
detected. Using this technique, we were able to detect
a signal corresponding to MMP-2 mRNA in cultured
intramuscular fibroblasts, but not from whole skeletal
muscle total RNA (data not shown). Because we had
observed proMMP-2 in both samples as well as
proMMP-9 by zymography, it seemed likely that the
sensitivity of the Northern technique was limiting, and
Figure 2. Detection of gelatinase activities by zymography. Proteins (15 ␮g) were separated on a 15% SDS-PAGE
gel containing gelatin (1 mg/mL). After migration the gel was washed in a triton X-100 solution (2.5% in distilled
water), incubated 20 h at 37°C in enzyme buffer, and stained with Naphthol blue black solution. Lanes from left to
right contained the following samples: M, Molecular Weight Markers; 1) bovine myogenic cell culture medium; 2)
coculture bovine myogenic cell-fibroblast culture medium; 3) bovine fibroblast culture medium; 4) bovine fibroblast
culture homogenate; 5) human fibrosarcoma HT-1080 culture medium; 6) bovine skeletal muscle homogenate; and 7)
bovine connective tissue homogenate.
100
Balcerzak et al.
Table 2. Summary of gene expression in bovine whole muscle, connective tissue,
isolated fibroblasts, myogenic cells, and human fibrosarcoma HT-1080 cells
Cultured cells
Controls
Whole
muscle
Connective
tissue
Isolated
fibroblasts
Myogenic
cells
HT-1080
Collagenases
MMP-1
MMP-13
+
−
−
+
+
−
+
−
+
−
3a
3b
Gelatinases
MMP-2
MMP-9
+
+
+
+
+
−
+
−
+
+
3c
3d
Stromelysins
MMP-3
MMP-7
−
−
−
−
+
−
+
−
+
+
MT-MMP
MMP-14
MMP-15
MMP-16
−
−
+
−
+
+
+
−
+
−
−
+
+
+
+
4a
4b
4c
TIMP
TIMP-1
TIMP-2
TIMP-3
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
4d
4e
4f
uPa cascade
uPa
uPaR
+
+
+
+
+
+
+
+
+
+
4g
4h
Enzyme
Bovine tissue
+ Duodenum
Figurea
3e
3f
a
Representative PCR results are shown in the figures indicated. “+” denotes the expression and “−” the
absence of expression. MMP, matrix metalloproteinase; TIMP, tissue inhibitor of metalloproteinase; uPa,
urokinase-type plasminogen activator; uPaR, urokinase-type plasminogen activator receptor.
we thus proceeded to the highly sensitive RT-PCR approach.
RT-PCR. The technique is based on amplification of
cDNA corresponding to RNA of interest and requires
knowledge of the individual cDNA sequences in order
to design primers for the amplification. For the bovine,
only sequences for MMP-1 (Tamura et al., 1994), MMP9 (Baylis et al., 1995), TIMP-1 (Satoh et al., 1994),
TIMP-2 (Boone et al., 1990), and urokinase-type plasminogen activator (uPa) (Kratzschmar et al., 1993)
have been published, and primers were designed to
amplify bovine MMP-9 and uPa (Menino et al., 1997).
Primers to amplify MMP-7 and uPaR were kindly provided by Linghuo Jiang (University of Alberta). For all
the other MMP, TIMP, MT-MMP, and factors involved
in regulation of MMP activity, it was necessary to design our own primer sets and validate the amplified
products. We designed consensus primers, validated
the amplified products, and submitted to the GenBank
database partial sequences for bovine MMP-1, -2, -3, 7, -13, -14 (MT1-MMP), -15 (MT2-MMP), -16 (MT3MMP), TIMP-1, -2, -3, uPa, and urokinase-type plasminogen activator receptor (uPaR). A summary of the
RT-PCR analysis of the expression of these elements is
shown in Table 2.
The identity of all amplified products was confirmed
by DNA sequencing and through the use of positive
controls, including a human cell line known to express
multiple MMP (Giambernardi et al., 1998) and bovine
duodenum (a source of MMP-7, unpublished data).
Whole Muscle Tissue. Bovine masseter muscle expressed mRNA encoding MMP-1, -2, -9, -16, TIMP-1, 2, and -3, uPa, and its receptor, uPaR (Figures 3 and 4,
lane 2). This indicates the expression of all the elements
potentially involved in the degradation of the protein
components of the extracellular matrix: one collagenase, two gelatinases, and one MT-MMP. The MMP-16
(MT3-MMP) is thought to be responsible for activation
of pro-MMP-2, and plasmin, which is activated by uPa,
is thought to activate pro-MMP-1 and pro-MMP-9. Of
the MMP studied, MMP-2 and MMP-16 gave the strongest signals in the PCR reaction at 30 cycles of amplification; these results concur with results of zymography
and Western blotting, suggesting high levels of MMP2. Skeletal muscle also expressed all three TIMP tested.
Several tissues are known to express more than one
TIMP (Tanney et al., 1998), although the role of these
in regulation of the specific MMP is not known. When
a tissue expresses more than one MMP or TIMP with
overlapping specificity, it may be that these are present
at different sites within the tissue.
Freshly Isolated Connective Tissue Cells. The expression of elements of the MMP system was also studied in
RNA extracted from skeletal muscle connective tissue
cells. The overall pattern of expression was similar to
that of whole muscle in that it included MMP-2, -9,
and -16, TIMP-1, -2, and -3, and uPa and uPaR (Figures
3 and 4, lane 3). At the same time, two MMP not seen
in whole muscle were expressed, a collagenase (MMP13) and MMP-15 (MT2-MMP). Assuming that these
Skeletal muscle extracellular proteolysis
latter two enzymes are expressed only by fibroblasts,
their expression would be more apparent in this relatively enriched source of fibroblast mRNA, compared
with whole muscle in which the vast majority of RNA
is derived from muscle cells.
Cultured Fibroblasts. The pattern of expression of the
intramuscular fibroblast population was not identical
to that in the connective tissue cell fraction, possibly
because the cells had been cultured for several passages
prior to harvest of the RNA. However, the overall pattern of expression was similar to that of whole muscle
in that it included MMP-1, -2, and -16, TIMP-1, -2, and 3, uPa, and uPaR (Figures 3 and 4, lane 4). There were
again some unique aspects of expression in this cell
population: lack of MMP-9 and expression of MMP-3
and MMP-14 (MT1-MMP).
Myogenic Cells. To test the hypothesis that myogenic
cells could synthesize elements of the MMP system,
muscle cells free of contaminating fibroblasts was prepared. This myogenic cell fraction from bovine muscle,
however, represents a relatively undifferentiated cell
type compared to mature muscle cells. This cell popula-
101
tion showed an expression pattern highly similar to
that of whole muscle: MMP-1, -2, and -16, TIMP-1, -2,
and -3, uPa, and uPaR (Figures 3 and 4, lane 5). No
expression of MMP-9 or MMP-3 was observed in these
cells. This pattern was also similar to that seen in isolated fibroblast expression, except for the absence of
MMP-14 (highly expressed in cultured fibroblasts) and
MMP-15 (highly expressed in freshly isolated connective tissue cells) (Figure 4). The absence of expression
of these connective tissue-specific elements further suggests the absence of major fibroblast contamination in
the satellite cell culture.
Coordinate Expression of Elements of the Extracellular
Proteolytic System in Muscle Tissue
Skeletal muscle expressed MMP-1, -2, -9, and -16
(MT3-MMP), TIMP-1, -2, and -3, uPa, and uPaR. In an
attempt to understand how expression of this system
is regulated, we studied semimembranosus muscle
from 35 individual animals. We observed a few differences in the pattern of MMP expression in this muscle
Figure 3. Determination of matrix metalloproteinase expression by reverse transcription-polymerase chain reaction.
Reverse transcription was done with total RNA isolated from cultured human fibrosarcoma HT-1080 cells (lane 1)
and bovine skeletal muscle (lane 2), dissectable connective tissue (lane 3), cultured fibroblasts (lane 4), cultured
myogenic cells (lane 5), and duodenum (lane 6). The 100-bp DNA ladder is presented in the lane denoted M in each
panel. The PCR reactions were conducted with the primers for a) MMP-1 (30 cycles; annealing at 65°C), b) MMP-13
(30 cycles, annealing at 57°C), c) MMP-2 (25 cycles, annealing at 65°C), d) MMP-9 (30 cycles, annealing at 55°C), e)
MMP-3 (30 cycles, annealing at 65°C), and f) MMP-7 (30 cycles, annealing at 60°C). MMP, matrix metalloproteinase.
102
Balcerzak et al.
Figure 4. Expression of modulators of matrix metalloproteinase activity determined by reverse transcription-polymerase chain reaction. Reverse transcription was done with total RNA isolated from cultured human fibrosarcoma
HT-1080 cells (lane 1) and bovine skeletal muscle (lane 2), dissectable connective tissue (lane 3), cultured fibroblasts
(lane 4), and cultured myogenic cells (lane 5). The 100-bp DNA ladder is presented in the lane denoted M in each
panel. The PCR reactions were conducted with the primers for a) MMP-14 (30 cycles, annealing at 65°C), b) MMP15 (30 cycles, annealing at 57°C), c) MMP-16 (25 cycles, annealing at 65°C), d) TIMP-1 (30 cycles, annealing at 65°C),
e) TIMP-2 (30 cycles, annealing at 65°C), f) TIMP-3 (30 cycles, annealing at 65°C), g) uPa (30 cycles, annealing at 65°C),
and h) uPaR (30 cycles, annealing at 60°C). MMP, matrix metalloproteinase; TIMP, tissue inhibitor of metalloproteinase;
uPa, urokinase-type plasminogen activator; uPaR, urokinase-type plasminogen activator receptor.
compared to masseter, with the absence of MMP-1 and
MMP-9 and the presence of MT1-MMP. There may be
fiber type specificities in the MMP system of different
muscles, but these remain to be determined.
To study variations in gene expression within the
MMP system of skeletal muscle, a semiquantitative RTPCR approach was developed. The number of PCR cycles and the quantity of total RNA necessary in the RT
step were optimized to observe the quantity of amplified
product obtained in the linear part of the process of
cDNA amplification. First, using 2 ␮g of total RNA in
the RT step, the quantity of amplified product formed
as a function of cycle number was determined. Second,
the quantity of amplified product formed as a function
of the level of total RNA in the RT step was determined.
For example, for MMP-2 at 24 cycles, the linear range
of amplification was 0.7 to 2.2 ␮g of total RNA in the
assay (Figure 5). Thus, in all assays in which levels of
103
Skeletal muscle extracellular proteolysis
MMP-2 expression were compared among animals, 1.5
␮g of total RNA was used. The quantification of amplified product was similarly validated with other elements of the MMP system, as well as GAPDH (Figure
5). Because the optimal RNA quantity was different
depending on the primer set used, we prepared different
RNA solutions (0.25, 0.5, 1, and 1.5 ␮g/␮L) from a 2␮g/␮L stock by serial dilutions.
We tested the expression of GAPDH in the 35 samples
and observed a very similar quantity of amplified product showing the uniformity in the level of expression
in these samples (Figure 6C). This also suggests the
homogeneity of the RNA concentration in the samples
and the absence of major variations in the RT-PCR reactions.
Using this semiquantitative RT-PCR technique, the
levels of MMP-2, -14 (MT1-MMP), and -16 (MT3-MMP),
TIMP-1, -2, and -3, uPa, and uPaR expression were
determined. A regression analysis was done for all these
genes to test for coordinated expression (the r-values
[coefficient of correlation] and the corresponding P-values are summarized in Figure 6A). For example, the
relationship between TIMP-1 and TIMP-2 expression
is illustrated in Figure 6B. We observed a significant
correlation (r > 0.614, P < 0.0003) of expression among
TIMP-1, -2, and -3, MMP-2, and MMP-14 (MT1-MMP).
We observed also a strong relationship among uPa,
MMP-2 and MMP-14 expression (r > 0.621, P < 0.0004).
Concerning MMP-16 (MT3-MMP), we observed a strong
correlation of its expression with TIMP-3 and MMP-2
expression (r > 0.615, P < 0.0005).
Discussion
Figure 5. Determination of the optimal quantity of bovine RNA for reverse transcription. (A) Graph and picture
representing the evolution of MMP-2 amplified product
as a function of the quantity of total RNA in the reverse
transcription. The PCR reaction was running at 24 cycles.
(B) Graph and picture representing the evolution of
GAPDH amplified product as a function of the quantity
of total RNA in the reverse transcription. The PCR reaction was running at 17 cycles. (C) Summary of the PCR
conditions used for each couple of primers, concentration
range for which the increase of amplified product quantity was linear, and quantity of total RNA chosen for the
reverse transcription step. MMP, matrix metalloproteinase; GAPDH, glyceraldehyde phosphate dehydrogenase.
Little is known of the MMP system of skeletal muscle.
Expression of MMP-1, but not MMP-2, -3, or -10 was
reported in mouse muscle (Gack et al., 1994). Another
study revealed the expression of MMP-2 and TIMP-1
in unfused human satellite cells; MMP-1 and MMP9 were also expressed after stimulation with phorbol
myristate acetate (Guerin and Holland, 1995). These
findings suggest that myogenic precursors synthesize
and secrete selected members of the MMP family. However, the relationship of these observations to differentiated skeletal muscle is unclear. The activity, expression, and localization of the gelatinases MMP-2 and
MMP-9 have been recently reported in muscle after
injury and denervation (Kherif et al., 1998, 1999). However, in addition to gelatinases, the full spectrum of
MMP participating in matrix catabolism must clearly
also include collagenases, stromelysins, activators, and
inhibitors of MMP. Our work is the first systematic
study of the MMP system of skeletal muscle to include
all of these potential elements.
The predominant cell type in skeletal muscle tissue
is the myofiber, but this tissue also contains fibroblasts,
vascular endothelial and smooth muscle cells, nerves,
adipocytes, and mast cells. Whereas fibroblasts are considered to be the classic source of connective tissue
104
Balcerzak et al.
Figure 6. Regression analysis of the expression of elements of a bovine matrix metalloproteinase system. (A)
Regression analysis between the expression of different genes of the extracellular proteolytic system in bovine semimembranosus muscle (n = 35). The r-value (coefficient of correlation) is on the top and the corresponding P-value in
parentheses on the bottom. (B) Illustration of the regression analysis between TIMP-1 and TIMP-2 expression. The rvalue (coefficient of correlation) and the corresponding P-value are presented with the graph. (C) GAPDH expression
in the 35 samples tested. The mean and its standard deviation are presented with the graph. TIMP, tissue inhibitor
of metalloproteinase; GAPDH, glyceraldehyde phosphate dehydrogenase.
components, including MMP, it seems that the muscle
fibers themselves also express elements of the MMP
cascade, including MMP-1, -2, -9, and -16, uPa, uPaR,
and TIMP-1, -2, and -3. The MMP-13 and MMP-15 are
examples of enzymes expressed specifically in connective tissue cells, and at 30 cycles of amplification in
PCR, there was no detectable signal in RNA from whole
skeletal muscle for either. This is in contrast with
MMP-2, -9, and -16, uPa, uPaR, and TIMP-1, -2, and -3,
which all showed a similar signal, using an equivalent
number of cycles of amplification, in both whole muscle
tissue and connective tissue cells. If connective tissue
cells were the sole source of these mRNA in muscle,
given the abundance of these cells (< 1% of total nuclei),
one would expect a much lower signal in the RT-PCR
for whole muscle than for connective tissue, as seen for
MMP-13 and MMP-15.
Although the myogenic cell cultures used here are
not differentiated adult myofibers, results from study
of these cells support the idea that cells of a myogenic
Skeletal muscle extracellular proteolysis
lineage express MMP-1, -2, -3, and -16, uPa, uPaR, and
TIMP-1, -2, and -3. These results concur with observations by Guerin and Holland (1995), who showed expression of MMP-2 and TIMP-1 in human satellite cells.
The expression of multiple elements of an MMP cascade
in muscle cells would point to a high degree of interrelationship between muscle cells and the dynamic modulation of the connective tissue. Muscle cell-derived MMP
and fibroblast MMP may act coordinately and(or) independently to control connective tissue catabolism. The
skeletal muscle cells and structurally related connective tissue function cooperatively in their mutual task
of force transduction, so the myofibers could participate
in some manner in the dynamic remodeling of connective tissue as the muscle hypertrophies, atrophies,
stretches, or changes aspects of its force generation.
Further work will reveal the relative roles of muscle
cells and connective tissue cells in the expression and
regulation of the intramuscular MMP system. Based on
what we have observed here and the related literature,
both cell-cell and cell-matrix interactions would be anticipated to have a major influence.
When the promoter sequences of some of the elements
of the MMP system are examined, consensus sequences
such as E-box, CCAC box, SRE 3, MAPF1/2, M1, and
other muscle-specific motifs are observed. For example,
the promoter of human MMP-2 (Bian and Sun, 1997)
(GenBank accession no. U96098) contains at least six
E-boxes, two MAPF1/2, and one M1, all of which are
potential targets for muscle-specific transcription factors. This is also true of the promoters for human MMP1 (Rutter et al., 1997) (GenBank accession no.
AF023338), human MMP-3 (Kirstein et al., 1996) (GenBank accession no. U43511), and rat TIMP-1 (Bugno
et al., 1995) (GenBank accession no. X90486). The presence of these motifs suggests the possibility that these
genes could be expressed specifically under certain
physiological conditions in the muscle, independently
of the other tissues.
The extracellular matrix of skeletal muscle is structurally and functionally complex. This matrix, which
contains collagen (Types I, III, IV, and V), glycoproteins
(laminin and fibronectin), and proteoglycans (Kuhn,
1987; Bailey and Light, 1989; Pearson and Young,
1989), contributes to the mechanical characteristics of
muscle (Partridge and Benton, 1981; Moore, 1983) and
the transmission of force from muscle to tendon. We
attempted to address the complexity of the MMP system of skeletal muscle. The expression of as many as
two collagenases (MMP-1 and MMP-13), one gelatinase
(MMP-2 or MMP-9), elements of proMMP activation
(uPa and uPaR, MT1-MMP, MT2-MMP, and MT3MMP), and metalloproteinase inhibitors (TIMP-1, -2,
and -3) were demonstrated in the different samples.
The individual cellular components (whole muscle, dissectible connective tissue, muscular fibroblasts in culture, and myogenic cells in culture) correspond to various potential sources of elements of the extracellular
matrix proteolytic system in muscle. With respect to
105
the identity and potential substrates of these enzymes,
this proteolytic system in its entirety would be able to
degrade all of the components of muscle extracellular
matrix. The collagenases (MMP-1 or MMP-13) denature
the fibrillar collagen (Miller et al., 1976a,b; Velgus et
al., 1981). This denatured collagen can be degraded to
small peptides by gelatinase activity (MMP-2 or MMP9) (Seltzer et al., 1981, 1990). These gelatinases are
also known to degrade the fibrillar type V and the nonfibrillar type IV collagen.
In parallel with these enzymes, all of the elements
for their activation are also expressed. Urokinase-type
plasminogen activator and uPaR are expressed by the
whole muscle and fibroblasts in the muscular connective tissue, allowing for plasminogen activation. This
plasminogen, synthesized by the liver and secreted into
the blood circulation, diffuses from blood vessels to the
connective tissue and will encounter all of the elements
for its activation on muscle and fibroblast cell surfaces.
The resulting plasmin will be able to activate the zymogens of MMP-1 and MMP-9. The MT-MMP, the second
major route for proMMP activation, are also expressed
by muscle cells and fibroblasts in the connective tissue.
In masseter muscle, MMP-16 (MT3-MMP) is expressed
by both cell types. This enzyme can participate in the
activation of pro-MMP-2 and also, perhaps, pro-MMP13. The presence of MT-MMP and(or) plasmin activity
could also complete the proteolytic process by acting
on glycoproteins (fibronectin, vitronectin, and laminin)
and on proteoglycans.
Production of TIMP is one of the mechanisms by
which MMP activity is controlled. In all of the samples
tested, we detected expression of TIMP-1, TIMP-2, and
TIMP-3. The presence of these three proteinase inhibitors shows the important negative regulatory arm of
this proteolytic system, which is necessary to protect
muscle connective tissue from uncontrolled metalloproteinase activities.
Variations in the expression of elements of this proteolytic system were analyzed in semimembranosus
muscle from 35 animals. A strong correlation among
expression of TIMP-1, TIMP-2, TIMP-3, MMP-2, and
MMP-14 (MT1-MMP) was observed. Another correlation was observed among MMP-16 (MT3-MMP), MMP2, and TIMP-3. All these genes are involved in the activation of pro-MMP-2 (Figure 1). Tissue inhibitor of metalloproteinase-2 and MMP-14 are known to be involved
in the multimeric complex during the process of proMMP-2 activation, which could explain their coordinate
expression. Sakamoto et al. (1999) observed a similar
relationship among these three genes in human cartilagenous tumors. Our results indicate also a strong
correlation among the expression of these three genes
and expression of TIMP-1 and TIMP-3. Tissue inhibitor
of metalloproteinase -3, which inhibits both MMP-2 and
MMP-14 activity, is a likely regulator of this activation
system, whereas TIMP-1, which inhibits MMP-2 activity (and not MMP-14), could be expressed to control
the active MMP-2. The MMP-16 is also known to be
106
Balcerzak et al.
a physiological activator of pro-MMP-2, which could
explain the strong correlation of expression observed
between them. This type of pro-MMP-2 activation may
be the major pathway in the masseter muscle, which
expressed only MMP-16, in comparison with semimembranosus muscle, which expressed both MMP-14 and
MMP-16.
Interestingly, uPa expression was also found to be
strongly correlated with MMP-2 and MMP-14 expression. The most likely role of uPa in this system is the
activation of plasminogen to plasmin, which then activates pro-MMP-1, pro-MMP-3, and pro-MMP-9 (Figure
1), rather than its involvement in pro-MMP-2 activation. Recently, Kazes et al. (1998) mentioned the presence in vitro of a soluble form of MT1-MMP (which
could be the extracellular domain of MT1-MMP cleaved
from its transmembrane domain) and its activation by
uPa in human mesangial cells. In light of these observations, uPa may be in some way involved in both activation pathways (MT-MMP and plasmin).
Conventional approaches to studying MMP seem to
have some limitations in skeletal muscle tissue. It
seems that gelatin zymography and RT-PCR were sensitive enough to detect gelatinase activities and MMP
expression, respectively. Other techniques ([3H]-type I
collagen degradation, α-casein zymography, Western,
and Northern blot analysis) lacked sensitivity to detect
low quantities of RNA and enzymes. Similar problems
were observed in previous studies of MMP in muscle.
Guerin and Holland (1995) did not observe the expression of MMP-1 in satellite cells using the Northern blot
technique unless these cells had been activated with
phorbol ester. Our results show the possibility of detecting these mRNA with the RT-PCR technique in unstimulated satellite cells. Kherif et al. (1999) attempted
in situ hybridization using an MMP-2 riboprobe, but
this did not allow for the identification of the cellular
source of MMP-2 mRNA, which they attributed to a
low number of MMP-2 transcripts per cell. Low levels
of enzyme and gene expression may pose significant
problems for localization of MMP in situ in the different
cell types and structural divisions of the connective
tissue.
Implications
To date, a number of results implicate intracellular
proteolytic systems in the physiologic modulation of
muscle protein deposition and in the meat tenderization
processes through continued activity postmortem.
There has been a lack of information concerning the
proteolytic system degrading the components of connective tissue in muscle. This work reveals a highly complex system for extracellular proteolysis in muscle and
opens new possibilities to study the proteolytic processes touching upon muscle growth and remodeling in
vivo and connective tissue postmortem.
Literature Cited
Bailey, A. J., and N. D. Light. 1989. Structure and localisation of
connective tissue components in muscle. In: Connective Tissue
in Meat and Meat Products. p 120. Elsevier Science Publishing
Co., New York.
Baylis H. A., A. Megson, and R. Hall. 1995. Infection with theileria
annulata induces expression of matrix metalloproteinase 9 and
transcription factor AP-1 in bovine leucocytes. Mol. Biochem.
Parasitol. 69:211–222.
Bian, J., and Y. Sun. 1997. Transcriptional activation by p53 of the
human type IV collagenase (gelatinase A or matrix metalloproteinase 2) promoter. Mol. Cel. Biol. 17:6330–6338.
Boone, T. C., M. J. Johnson, Y. A. DeClerck, and K. E. Langley. 1990.
cDNA cloning and expression of a metalloproteinase inhibitor
related to tissue inhibitor of metalloproteinases. Proc. Natl.
Acad. Sci. USA 87:2800–2804.
Bugno, M., L. Graeve, P. Gatsios, A. Koj, P. C. Heinrich, J. Travis,
and T. Kordula. 1995. Identification of the interleukin-6/oncostatin M response element in the rat tissue inhibitor of metalloproteinases-1 (TIMP-1) promotor. Nucleic Acids Res. 23:5041–
5047.
Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159.
Dodson, M. V., E. L. Martin, M. A. Brannon, B. A. Mathison, and D.
C. McFarland. 1987. Optimization of bovine satellite cell-derived
myotube formation in vitro. Tissue Cell 19:159–166.
Emonard, H., and J. A. Grimaud. 1990. Matrix metalloproteinases.
A review. Cell. Mol. Biol. 36:131–153.
Gack, S., R. Vallon, J. Schaper, U. Ruther, and P. Angel. 1994. Phenotypic alteration in Fos transgenic mice correlates with changes in
Fos/Jun-dependent collagenase type I expression. J. Biol. Chem.
269:10363–10369.
Giambernardi, T. A., G. M. Grant, G. P. Taylor, R. J. Hay, V. M.
Maher, J. J. McCormick, and R. J. Klebe. 1998. Overview of
matrix metalloproteinase expression in cultured human cells.
Matrix Biol. 16:483–496.
Guerin, C. W., and P. C. Holland. 1995. Synthesis and secretion of
matrix-degrading metalloproteinases by human skeletal muscle
satellite cells. Dev. Dyn. 202:91–99.
He, C., S. M. Wilhelm, A. P. Pentland, B. L. Marner, G. A. Grant,
A. Z. Eisen, and G. I. Goldberg. 1989. Tissue cooperation in a
proteolytic cascade activating human interstitial collagenase.
Proc. Natl. Acad. Sci. USA 86:2632–2636.
Huhtala, P., A. Tuuttila, L. T. Chow, J. Lohi, J. Keski-Oja, and K.
Tryggvason. 1991. Complete structure of the human gene for
92-kDa type IV collagenase. Divergent regulation of expression
for the 92- and 72-kilodalton enzyme genes in HT-1080 cells. J.
Biol. Chem. 266:16485–16490.
Kazes, I., F. Delarue, J. Hagege, L. Bouzhir-Sima, E. Rondeau, J. D.
Sraer, and G. Nguyen. 1998. Soluble latent membrane-type 1
matrix metalloproteinase secreted by human mesangial cells is
activated by urokinase. Kidney Int. 54:1976–1984.
Kherif, S., M. Dehaupas, C. Lafuma, M. Fardeau, and H. S. Alameddine. 1998. Matrix metalloproteinases MMP-2 and MMP-9 in
denervated muscle and injured nerve. Neuropathol. Appl. Neurobiol. 24:309–319.
Kherif, S., C. Lafuma, M. Dehaupas, S. Lachkar, J. G. Fournier, M.
Verdière-Sahuqué, M. Fardeau, and H. S. Alameddine. 1999.
Expression of matrix metalloproteinases 2 and 9 in regenerating
skeletal muscle: A study in experimentally injured and mdx
muscles. Dev. Biol. 205:158–170.
Kirstein, M., L. Sanz, S. Quinones, J. Moscat, M. T. Diaz-Meco, and
J. Saus. 1996. Cross-talk between different enhancer elements
during mitogenic induction of the human stromelysin-1 gene. J.
Biol. Chem. 271:18231–18236.
Knäuper, V., C. Lopez-Otin, B. Smith, G. Knight, and G. Murphy.
1996. Biochemical characterization of human collagenase 3. J.
Biol. Chem. 271:1544–1550.
Skeletal muscle extracellular proteolysis
Kratzschmar, J., B. Haendler, S. Kojima, D. B. Rifkin, and W. D.
Schleuning. 1993. Bovine urokinase-type plasminogen activator
and its receptor: cloning and induction by retinoic acid. Gene
(Amsterdam) 125:177–183.
Kufe, D. W., P. P. Major, E. M. Egan, and G. P. Beardsley. 1980.
Correlation of cytotoxicity with incorporation of ara-C into DNA.
J. Biol. Chem. 255:8997–9000.
Kuhn, K. 1987. The classical collagens: Types I, II and III. In: R.
Mayne and R. E. Burgeon (ed.) Biology of Extracellular Matrix:
A Series, Structure and Function of Collagen Types. pp 1–42.
Academic Press, Orlando, FL.
Laemmli, U. K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature (Lond.)
227:680–685.
Lantz, M. S., and P. Ciborowski. 1994. Zymographic techniques for
detection and characterization of microbial proteinases. Methods
Enzymol. 235:563–594.
Laskey, R. A., and A. D. Mills. 1975. Quantitative film detection
of 3H and 14C in polyacrylamide gels by fluorography. Eur. J.
Biochem. 56:335–341.
Menino, A. R. Jr., A. Hogan, G. A. Schultz, S. Novak, W. T. Dixon, and
G. H. Foxcroft. 1997. Expression of proteinases and proteinases
inhibitors during embryo-uterine contact in the pig. Dev. Genet.
21:68–74.
Miller, E. J., J. E. Finch, E. Chung, W. T. Butler, and P. B. Robertson.
1976a. Specific cleavage of the native type III collagen molecule
with trypsin. Similarity of the cleavage products to collagenaseproduced fragments and primary structure at the cleavage site.
Arch. Biochem. Biophys. 173:631–637.
Miller, E. J., E. D. Harris, E. Chung, J. E. Finch, J. E. McCroskery,
and W. T. Butler. 1976b. Cleavage of type I and II collagens
with the mammalian collagenase: Site of cleavage and primary
structure at the NH2 terminal portion of the smaller fragment
released from both collagens. Biochemistry 15:787–792.
Moore, M. J. 1983. The dual connective tissue system of rat soleus
muscle. Muscle Nerve 6:416–422.
Murphy, G., and F. Willembrock. 1995. Tissue inhibitors of matrix
metalloproteinases. Methods Enzymol. 248:496–510.
Parsons, S. L., S. A. Watson, P. D. Brown, H. M. Collins, and R. J.
C. Steele. 1997. Matrix metalloproteinases. Br. J. Surg.
84:160–166.
Partridge, L. D., and L. A. Benton. 1981. Muscle: The motor. In: V.
B. Brooks (ed.) Handbook of Physiology. American Physiology
Society, Bethesda, MD.
Pearson, A. M., and R. B. Young. 1989. The connective tissues: Collagen, elastin, and ground substance. In: Muscle and Meat Biochemistry. p 338. Academic Press, San Diego, CA.
Rawdanowicz, T. J., A. L. Hampton, H. Nagase, D. E. Woolley, and
L. A. Salamonsen. 1994. Matrix metalloproteinase production
by cultured human endometrial stromal cells: identification of
interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha
and tumor necrosis factor-alpha. J. Clin. Endocrinol. Metab.
79:530–536.
Ries, C., and P. E. Petrides. 1995. Cytokine regulation of matrix
metalloproteinase activity and its regulatory dysfunction in disease. Biol. Chem. 376:345–355.
Rutter, J. L., U. Benbow, C. I. Coon, and C. E. Brinckerhoff. 1997.
Cell-type specific regulation of human interstitial collagenase-
107
gene expression by interleukin-1 beta (IL-1 beta) in human fibroblasts and BC-8701 breast cancer cells. J. Cell. Biochem.
66:322–336.
Sakamoto, A., Y. Oda, Y. Iwamoto, and M. Tsuneyoshi. 1999. Expression of membrane type 1 matrix metalloproteinase, matrix metalloproteinase 2 and tissue inhibitor of metalloproteinase 2 in
human cartilaginous tumors with special emphasis on mesenchymal and dedifferentiated chondrosarcoma. J. Cancer Res.
Clin. Oncol. 125:541–548.
Sato, H., T. Takino, Y. Okada, J. Cao, A. Shinagawa, E. Yama-moto,
and M. Seiki. 1994. A matrix metalloproteinase expressed on
the surface of invasive tumour cells. Nature (Lond.) 370:61–65.
Satoh, T., K. Kobayashi, S. Yamashita, M. Kibuchi, Y. Sendai, and
H. Hoshi. 1994. Tissue inhibitor of metalloproteinases (TIMP1) produced by granulosa and oviduct cells enhances in vitro
development of bovine embryo. Biol. Reprod. 50:835–844.
Seltzer, J. L., S. A. Adams, G. A. Grant, and A. Z. Eisen. 1981.
Purification and properties of a gelatin specificity neutral proteinase from human skin. J. Biol. Chem. 256:4662–4668.
Seltzer, J. L., K. T. Akers, H. Weingarten, G. A. Grant, D. W. Mc
Court, and A. Z. Eisen. 1990. Cleavage specificity of human skin
type IV collagenase (gelatinase). J. Biol. Chem. 265:20409–
20413.
Takino, T., H. Sato, A. Shinagawa, and M. Seiki. 1995. Identification
of the second membrane-type matrix metalloproteinase (MTMMP-2) gene from a human placenta cDNA library. MT-MMPs
form a unique membrane-type subclass in the MMP family. J.
Biol. Chem. 270:23013–23020.
Tamura, M., H. Shimokawa, and S. Sasaki. 1994. Primary structure
of bovine interstitial collagenase deduced from cDNA sequence.
DNA Seq. 5:63–66.
Tanney, D. C., L. Feng, A. S. Pollock, and D. H. Lovett. 1998. Regulated expression of matrix metalloproteinases and TIMP in
nephrogenesis. Dev. Dyn. 213:121–129.
Tyagi, S. C., L. Matsubara, and K. T. Weber. 1993. Direct extraction
and estimation of collagenase(s) activity by zymography in microquantities of rat myocardium and uterus. Clin. Biochem.
26:191–198.
Velgus, H. G., J. J. Jeffrey, and A. Z. Eisen. 1981. The collagen
substrate specificity of human skin fibroblast collagenase. J.
Biol. Chem. 256:9511–9515.
Werb, Z., C. L. Mainardi, C. A. Vater, and E. D. Jr Harris. 1977.
Endogenous activation of latent collagenase by rheumatoid synovial cells. Evidence for a role of plasminogen activator. N. Engl.
J. Med. 296:1017–1023.
Yablonka-Reuveni, Z., S. K. Anderson, D. F. Bowen-Pope, and M.
Nameroff. 1988. Biochemical and morphological differences between fibroblasts and myoblasts from embryonic chicken skeletal muscle. Cell Tissue Res. 252:339–348.
Yelich, J. V., D. Pomp, and R. D. Geisert. 1997. Ontogeny of elongation
and gene expression in the early developing porcine conceptus.
Biol. Reprod. 57:1256–1265.
Yu, A. E., A. N. Murphy and W. G. Stetler-Stevenson. 1998. 72-kDa
gelatinase (gelatinase A): structure, activation, regulation and
substrate specificity. In: Matrix Metalloproteinases. p 85. Academic Press, San Diego, CA.
Zucker, S., R. M. Lysik, J. Wieman, D. P. Wilkie, and B. Lane. 1985.
Diversity of human pancreatic cancer cell proteinases: role of cell
membrane metalloproteinases in collagenolysis and cytolysis.
Cancer Res. 45:6168–6178.