Download SHORT COMMUNICATION One-step multiplex RT-PCR

Asia
AsPacPacific
J. Mol.
Journal
Biol. Biotechnol.,
of MolecularVol.
Biology
16 (2),
and2008
Biotechnology, 2008
Vol. 16 (2) : 41-44
BCR/ABL gene in chronic myeloid leukaemia
41
SHORT COMMUNICATION
One-step multiplex RT-PCR for detection of BCR/ABL gene in
Malay patients with chronic myeloid leukaemia
Rosline Hassan1*, Majdan Ramli1, Wan Zaidah Abdullah1, Rapiaah Mustaffa1, Selamah Ghazali1,
Ravindran Ankathil3, Zilfalil Alwi3, Abu Dzar Abdullah2, Abdul Aziz Baba2
Department of Haematology, 2Department of Medicine, 3Human Genome Center,
School of Medical Sciences, Health Campus, University Sains Malaysia, Kelantan, Malaysia
1
Received 19 June 2007 / Accepted 22 May 2008
Abstract. BCR/ABL fusion gene is a product derived from translocation of chromosome 22 to chromosome 9. Its presence
confers a diagnostic value for chronic myeloid leukaemia (CML). The aim of this study was to detect the presence of BCR/ABL
fusion gene using a One-Step Multiplex Reverse Transcriptase –Polymerase Chain Reaction (RT-PCR) and identify the types
of breakpoints in Malay patients diagnosed as CML. Their clinical characteristics and cytogenetic findings were also included.
Thirty-six Malay patients diagnosed as CML by the usual haematological investigations were enrolled into the study. RNA was
extracted from the blood and bone marrow samples and was subjected to One-Step Multiplex RT-PCR for BCR/ABL gene.
Thirty-five (97.2%) had BCR/ABL fusion gene. Breakpoints at b3a2 and b2a2 were detected in 68.6% and 31.4% respectively.
Majority of them were in chronic phase of CML at diagnosis and the median age was 45.5 years old. In conclusion, One-Step
Multiplex RT-PCR has been successfully used to detect and subtype BCR/ABL fusion gene. It is a fast and effective technique.
It should be done upfront at diagnosis in patients with CML, as its molecular subtype is crucial in the treatment follow-ups.
Keywords. BCR/ABL gene, One–step multiplex, RT-PCR, CML
INTRODUCTION
The Philadelphia chromosome (Ph) is a shortened of chromosome 22 which is due to a balanced translocation of
chromosome 9 and 22. It is the most frequent cytogenetic
aberration in human leukaemia. It is detected in more than
95% of patients with Chronic Myeloid Leukaemia (CML),
20% to 40% in patients with Acute Lymphoblastic Leukaemia
(ALL) and only 2% to 5% in paediatric ALL (Savage et al.,
1997). From clinical and haematological investigations, CML
can be divided into chronic, accelerated and blastic phases.
In t(9;22)(q34;q11), the BCR gene on chromosome 9
is juxtaposed next to ABL gene located on chromosome
22 giving rise to the BCR/ABL fusion gene. There are two
common regions involved in the breakpoints of BCR gene
in leukaemia patients. The breakpoints in CML are between
exons 12 and 16 (also known as exons b1’-b5) in a region
called as major breakpoint cluster region (M-bcr). Most
breakpoints fall within the major breakpoint cluster region
(M-bcr). Resultant BCR/ABL mRNA molecules with transcript of either b3a2 (55%) or b2a2 (40%) or both b3a2 and
b2a2 (5%) encode a 210-kDa fusion proteins. The second
breakpoint involves a minor cluster region (m-bcr), which
located upstream at e1a2 junction. It is then translated into
a 190kDa fusion protein (Okamoto et al., 1997). However a
210-kd protein is the hallmark for CML. Figure 1 illustrates
the schematic representation of the ABL and the BCR genes
disrupted in the t(9,22)(q34;q11).
For many years, RT-PCR has been used routinely to detect
the presence of BCR/ABL transcripts. BCR/ABL mRNAs
allow for the detection of leukaemic clones. However many
routine RT-PCR techniques require multiple steps and many
paired primers for the detection of the different breakpoints.
This is expensive and time-consuming.
To simplify this procedure a One-step multiplex RT-PCR
was established in which the cDNA synthesis and PCR were
performed in a single tube. This method reduced the number
of manipulations and the risk of contamination. It was utilized in Malay patients with CML and enabled the identification of different breakpoints regions/transcripts.
*Author for Correspondence.
Mailing address: Department of Hematology, School of Medical Sciences,
University Sains Malaysia, Kubang Kerian, Kelantan, Malaysia. Fax :+6097652709 ; Email : [email protected]
42
AsPac J. Mol. Biol. Biotechnol., Vol. 16 (2), 2008
BCR/ABL gene in chronic myeloid leukaemia
Table 1. Primer sequences used in one step muliplex RT-PCR
Primer name Sequences
Figure 1. Schematic representation of the ABL and the BCR
genes in the t(9;22). Exons are represented by boxes and introns
by connecting horizontal lines. Breakpoints in ABL, illustrated as
vertical arrows, almost invariably occur either upstream of exon Ib,
between Ib and Ia, or between Ia and a2.The BCR gene contains 25
exons, including two putative alternative first (e1’) and second (e2’)
exons. The breakpoints in BCR usually occur within one of three
breakpoint cluster regions (bcr), the location and probable extents
of which are shown by the three double-headed horizontal arrows.
In exceptional cases, the BCR breakpoints fall between m-bcr and
M-bcr, within the region indicated by the double headed dashed-line
arrow. The lower half of the figure shows the structure of the various BCR-ABL mRNA transcripts which are formed in accordance
with the position of the breakpoint in BCR. Breaks in m-bcr give
origin to BCR/ABL mRNA molecules with an e1a2 junction. The
breaks in M-bcr occur either between exons b2 (e13) and b3 (e14)
or between b3 and b4 (e15), generating fusion transcripts with a
b2a2 or b3a2 junction, respectively. Breakpoints in µ-bcr, the most
3’ cluster region, result in BCR-ABL transcripts with an e19a2 junction. (Adapted from Melo, 1996)
BCR-C
B2B
C5e-
CA3-
5’ ACC GCATGTTCCGGGACA AAAG 3’
5’ ACAGaATTCGCTGACCATCAATAAG 3’
5’ ATAGGATCCTTTGCAACCGGGTCTGAA 3’
5‘ TGTTGACTGGCGTGATGTAGTTGCTTGG3’
RNA was added to the master mix with the total volume of
10µl. The BCR/ABL primer mix consisted of primers for
mRNAs transcripts for b2a2, b3a2 and e1a2. It was made
up of a mixture of four primers. The primer sequences were
as listed in Table 1.
Then RT-PCR was performed using RT-PCR kit (TitanTM
One Tube RT-PCR kit). Each PCR experiment was repeated
at least once and included a negative and three positive controls. DNA derived from K562 cell line was used as one of
the positive controls. Two other positive controls used were
from known ALL and CML patients with breakpoints at e1a2
and b2a2 respectively. PCR parameters were 35 cycles at 96
ºC for 1min, 55 ºC for 50s, and 72 ºC for 1min, followed by
10 min extension at 72 ºC.
Amplified products were electrophoresed on a 1.8% agarose gel in 1X TBE buffer. The gel was stained with ethidium
bromide placed on a transilluminator and photographed.
The two molecular variants yielded products of 310 bp
(b2a2) and 385 bp (b3a2) respectively. The e1a2 product was
481 bp while BCR gene was used as internal control with
PCR product of 808 bp.
MATERIAL AND METHODS
RESULTS
A total of 36 Malay patients diagnosed as CML in Hospital
Universiti Sains Malaysia were enrolled in this study from
2003 to 2006. Written consent was taken from them and
hospital ethical committee had approved the study. Blood
and bone marrow samples were obtained from patients for
cytogenetic and molecular studies.
Chromosomal studies were done on bone marrow cells
using direct technique or after 24 hour culture in-vitro
without stimulation. The chromosomes were identified using
a GTG-banding technique and 15-20 metaphases per slide
were analysed.
RNA was extracted from peripheral blood or bone marrow specimen using standard method as in the manufacturer’s
protocol (QIAamp®RNA Blood Mini Kits). The presence
of RNA was confirmed by agarose gel electrophoresis.
A reaction mix was prepared comprising the following
components: 5 x RT buffer, 2 mM dNTP, BCR/ABL primer
mix (10um each primers), 25 mM MgCl2, 100 mM DTT, 40
U/ul RNASIN, Rnase-free H2O and Enzyme mix. 100ng of
Thirty-six Malay patients diagnosed as CML were identified
during the four year study. Thirty patients were in chronic
phase, four in accelerated phase while two in blastic phase
of CML stages. The median age of the study group was
45.5 years old and comprised of 13 and 23 males and females
respectively. Cytogenetic studies were performed on 30 bone
marrow samples of which 27 exhibited the Philadelphia
chromosome. Three samples had additional chromosome
abnormalities such as deletions of chromosome 1, 5 and 13
and all of them were in chronic phase of CML. Cytogenetic
results for patients in accelerated and blastic phase were not
available in the other 6 CML patients.
Our results showed thirty-five (97.2%) were positive for
BCR/ABL fusion gene. Of these positive ones, 24 (68.6%)
had a breakpoint at b3a2 junction and 11 (31.4%) at b2a2
junction (Figure 2). None of them had fusion transcripts
at both junctions. The only one patient who was negative
for BCR/ABL has also a normal female karyotype though
clinically and morphologically she was diagnosed as CML.
AsPac J. Mol. Biol. Biotechnol., Vol. 16 (2), 2008
1 2 3
4 5 6
7
8 9 10
Figure 2. One-step multiplex RT-PCR results for BCR/ABL
fusion transcript.
Lane 1, 10 : 100bp DNA marker
Lane 2,3,4 : 385bp PCR product of b3a2 BCR/ABL
transcript
Lane 5
: 481bp PCR product of e1a2 BCR/ABL
transcript
Lane 6 : Negative control
Lane 7,8,9 : Positive control for b2a2, b3a2, e1a2
BCR/ABL transcript respectively
This patient was persistently in chronic phase for the past
5 years. There was a good correlation between cytogenetic
and One-step RT-PCR.
DISCUSSION
In the year 2002, there were 1447 cases of leukaemias reported to the National Cancer Registry, Malaysia comprising
5.7% of total number of cancers. Male to female ratio was
1.4:1 and leukaemias were the fourth commonest cancer in
males and fifth in females. CML constituted 14.6% of total
cases of leukaemia (Lim et al., 2002).
In this study, 36 Malay patients were diagnosed as CML
over a period of four years. These patients were treated either with hydroxyurea or imatinib. The median age was 45.5
years and it tends to occur in younger patients with female
to male ratio, 1.7:1. These findings are in contrast to the
Scandinavian data, whereby their median age was 67 years and
predominantly male with the ratio of 1.4:1 (Chronic Myeloid
Leukemia Trialists’ Collaborative Group, 1997).
Cytogenetic abnormalities were detected in bone marrow
samples of 27 out of 30 patients. Two samples did not yield
good metaphase spreads. Philadelphia chromosomes were detected in twenty-five patients and three displayed apparently
normal karyotypes. Repeat cytogenetic studies revealed the
presence of the Philadelphia chromosome in 2 of those with
normal karyotype. The cytogenetic studies were used as the
gold standard with which to evaluate the one-step multiplex
RT-PCR technique (Harrison et al., 2000).
In our study, One-step multiplex RT-PCR technique was
performed in all patients diagnosed as CML and BCR/ABL
fusion gene was found in all patients except one. One patient
BCR/ABL gene in chronic myeloid leukaemia
43
was negative for BCR/ABL fusion gene. One study reported
that more than 95% of patients with the diagnosis of CML
were positive for BCR/ABL fusion gene (Shepherd et al.,
1995).
The patient who was negative for BCR/ABL had clinical features and peripheral blood film suggestive of chronic
myeloproliferative disease. Her condition was complicated
by carcinoma of the breast that developed later.
The use of conventional cytogenetic analysis has
complemented PCR at initial diagnosis and at follow-up as
additional cytogenetic abnormalities, numerical aberrations
and abnormalities other than balanced translocations cannot
be detected by the later technique.
One-step multiplex RT-PCR has its own advantages
because it can identify both p190BCR/ABL and p210BCR/ABL
in one single procedure. In addition the technique can also
discriminate the different breakpoints which can be used as
a marker to guide imatinib mesylate treatment. Determination of the type of fusion transcript is crucial for quantitatively monitoring the course of the disease during treatment.
Nested RT-PCR is another method routinely performed for
the detection of BCR/ABL gene (Gleissner et al., 2001).
The benefit of the multiplex approach is to simplify and
shorten the procedure of RT-PCR for the detection of p210
and p190 in a single reaction. Secondly the amount of RNA
used is minimised. Multiplex PCR assay is clinically useful,
efficient and a fast procedure for the detection of fusion gene
products, saving time and cost. This technique is useful for
initial diagnosis to guide CML in clinical management.
ACKNOWLEDGEMENT
We would like to thank Mr David Mc Donald from Molecular
Diagnostic Lab, Institute of Clinical Pathology and Medical
Research, Westmead Hospital, Australia for providing us with
the K562 cDNA. The work is supported by the USM short
term-grant ((304/PPSP/6131215). This study was approved
by ethical committee, School of Medical Sciences, University
Sains Malaysia, Malaysia.
REFERENCES
Chronic Myeloid Leukemia Trialists' Collaborative
Group.1997. Interferon alfa versus chemotherapy for
chronic myeloid leukemia: a meta-analysis of seven
randomized trials. Journal of the National Cancer Institute,
89, 1616–1620.
Gleissner, B., Rieder, H., Thiel, E., Fonatsch, C., Janssen,
L.A., Heinze, B., Janssen, J.W., Schoch, C., Goekbuget,
N., Maurer, J., Hoelzer, D. and Bartram, C.R. 2001.
44
AsPac J. Mol. Biol. Biotechnol., Vol. 16 (2), 2008
Prospective BCR-ABL analysis by polymerase chain reaction (RT-PCR) in adult acute B-lineage lymphoblastic
leukemia: reliability of RT-nested-PCR and comparison
to cytogenetic data. Leukemia 15:1834-40.
Harrison, C.J. 2000. The management of patients with leukaemia: The role of cytogenetics in this molecular era.
British Journal of Haematology 108(1):19-30.
Lim, G.C., Halimah, Y. and Lim, T.O. 2002. In Cancer incidence in Malaysia, The First Report of The National
Cancer Registry: Ministry of Health.
Melo, J.V. 1996. The diversity of BCR-ABL fusion proteins
and their relationship to leukaemia phenotype. Blood 88:
2375-2384 (editorial).
Okamoto, K., Krawasa, M., Sakai, H., Ogura, H., Morita, K.
aand Naruse, T., 1997. ��������������������������������
A novel acute lymphoid leukemia
type BCR/ABL transcript in chronic myelogenous leukemia. British Journal of Haematology 96: 611-613.
Savage, D.G., Szydlo, RM. and Goldman, J.M. 1996. Clinical
features at diagnosis in 430 patients with chronic myeloid
leukaemia seen at a referral centre over a 16-year period.
British Journal of Haematology 96:111-116.
Shepherd, P., Suffolk, R., Halsey, J. and Allan, N. 1995. Analysis of molecular breakpoint and m-RNA transcripts in
a prospective randomized trial of interferon in chronic
myeloid leukaemia: no correlation with clinical features,
cytogenetic response, duration of chronic phase or survival. British Journal of Haematology 89: 546-554.
BCR/ABL gene in chronic myeloid leukaemia