Download cis-Regulatory Elements and trans-Acting Factors

764
Original Contributions
cis-Regulatory Elements and trans-Acting Factors
Directing Basal and cAMP-Stimulated Human
Renin Gene Expression in Chorionic Cells
Pascale Borensztein, Stephane Germain, Sebastien Fuchs, Josette Philippe,
Pierre Corvol, Florence Pinet
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
Abstract Much knowledge was accumulated in the regulation of plasma renin activity and renin secretion during recent
years. However, the mechanisms of renin gene transcription,
especially for the human gene, have been poorly studied
because of the lack of cell lines expressing renin. Cells derived
from chorion tissue were used to study renin gene transcription because these cells express renin and regulate renin
secretion in a similar way to JG cells. The present study was
performed to determine the cis-regulatory elements and the
trans-acting factors involved in human renin gene expression
using chorionic cells. Transient DNA transfections were performed with various constructs containing the 5'-flanking
region of the human renin gene. 5'-Deletion analysis of the
human renin promoter (from -2616 to -67 bp) revealed the
presence of two proximal negative cis-regulatory elements
between -374 and -273 bp and between -273 and -137 bp.
These elements were not present in a non-renin-producing
cell line, JEG-3 cells. DNase I footprinting revealed that two
sequences located within these regions bind trans-factors
present in chorionic cellular nuclear extract: AGE3-like sequence (-293/-273) and apolipoprotein Al regulatory pro-
tein-1-like sequence (-259/-245). The first 110 bp of the
renin promoter were sufficient to direct specific expression in
chorionic cells and contained two footprints sharing homology
with ets (-29/-6) and pituitary-specific factor (Pit-1) (-70/-62)
sequences. Furthermore, one footprint (-234/-214) contained
the sequence TAGCGTCA, which shares strong homology to the
cAMP-responsive element (CRE) binding site. Gel shift analysis
showed specific DNA/protein complexes within this region,
which were displaced by the somatostatin consensus CRE. Finally, luciferase analysis of 5'-deletion mutant revealed that -273
to +16 bp of the renin promoter was sufficient to confer
complete forskolin stimulation, whereas deletion to -130 (deletion of the CRE) decreased cAMP responsiveness by 50% and
those to -67 bp (deletion of the CRE and Pit-1-like sequences)
suppressed it. Thus, these latter two sequences probably act
together to confer complete cAMP responsiveness. (Circ Res.
1994;74:764-773.)
Key Words * renin gene * chorionic cells * luciferase cis-acting elements * trans-acting factors * cAMP-responsive
element * pituitary-specific factor * ets
R enin (E.C.3.4.23.15), an aspartyl protease that
cleaves angiotensin I from angiotensinogen in
the rate-limiting step of the renin-angiotensin
system, plays a major role in blood pressure regulation
and fluid and electrolytic homeostasis.
During recent years, much knowledge has accumulated concerning the numerous factors influencing renin
secretion, such as f3-adrenergic agonists, peptidic hormones, and drugs.' Several intracellular mediators influencing renin release, such as cAMP, cGMP, and
intracellular calcium, have also been identified.2 Most of
these studies were performed in isolated perfused kidney, kidney slices, or juxtaglomerular cell cultures because kidney-derived renin represents most of the circulating enzyme. Another important step in the control
of renin secretion is the rate of transcription of the renin
gene. However, studies examining this step are difficult
to perform, in particular because of the lack of established renin-producing cell lines.
The transcriptional regulatory elements of the mouse
renin genes have been largely characterized. One of the
interesting features of this species is the presence of a
duplicated renin gene in some strains, eg, DBA/2J. The
RenJ gene is expressed mainly in the kidney, whereas
the Ren2 gene is expressed in both the kidney and the
submandibular gland. Nakamura et a13 have shown the
presence of a negative regulatory element in the 5'flanking region of both mouse renin genes; this element
is functional in the Renl but not the Ren2 gene, probably because of the interference by an adjacent 150-bp
insertion in this latter gene.4 This difference in functionality may play a role in the differential expression of the
renin genes in the submandibular gland. First, this
negative regulatory element could bind a specific nuclear protein, present in the submandibular gland, resulting in the inhibition of Reni expression in this
tissue.4 Second, the high expression of submandibular
Ren2 could be due to the nonfunctionality of the
negative regulatory element.4 Recently, Tamura et al'
identified, by transient DNA transfection, two positive
cis-acting sequences located within a large insertion in
the mouse gene and not present in the human gene,6
suggesting that transcriptional regulation of the renin
gene could differ between species. In addition, they
showed that renin gene expression depends strongly on
the cell model used and on the presence or absence of
trans-acting factors in these cells.
Very little is known about the mechanisms controlling
human renin gene expression, mainly because of the
lack of established renin-producing cell lines. Human
Received October 8, 1993; accepted January 10, 1994.
From INSERM Unit 36, College de France, Paris.
Correspondence to Dr Florence Pinet, INSERM Unit 36,
College de France, 3 rue d'Ulm. 75005 Paris. France.
Borensztein et al cis-Acting Elements in the Human Renin Gene
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
renin is expressed in many cell types,7 but its expression
is particularly high in juxtaglomerularl and chorionic
cells.8-'0 Juxtaglomerular cells are difficult to isolate and
to culture, and they lose their ability to produce renin
after a single passage.1',12 Attempts to immortalize
these cells by the use of different SV40 mutants resulted
in limited expression of the human renin gene.'3 Although these cells allowed the study of some of the
mechanisms involved in renin secretion, they cannot be
used for renin gene expression studies. Chorion tissue
represents the second major site of production, after
kidney, in human tissues.10 Moreover, chorionic cells in
primary and secondary cultures produce large quantities of renin, predominantly in the prorenin form, and
are easily accessible.14 Renin regulation in this model
was studied and showed a role of cAMP and protein
kinase C.15 This is similar to the regulation demonstrated in primary cultures of JG cells.2 Therefore,
these cells may provide a useful model for studying the
regulation of renin gene expression.
Using transient DNA transfections, Duncan et a116
reported that human chorionic cells are able to use the
first 600 bp of the renin promoter to direct chloramphenicol acetyl transferase (CAT) expression without needing
an enhancer. Other studies have been performed using
the JEG-3 cell line, which is derived from a human
choriocarcinoma.17'18 However, this model has several
limitations: these cells do not express the renin gene,18'19
and analysis of the 5'-flanking region of the gene required
the use of the herpes simplex virus thymidine kinase (tk)
promoter to direct CAT expression.'7'18
There is a single recent study on a trans-acting factor
controlling human renin gene expression showing that
nuclear extracts isolated from a rat lactotrope precursor
cell line (GC) interact with a pituitary-specific factor
(Pit-1) binding site consensus sequence.20 Since Pit-1 is
expressed only in pituitary cells,21 the functionality of
this cis-acting sequence remains to be shown in reninexpressing cells.
The present study was performed to determine the
cis-regulatory elements and the trans-acting factors
involved in human renin gene expression, using reninproducing cells derived from chorionic tissue. The promoter elements involved in the transcription of the
human renin gene in chorionic cells were localized by
different approaches. Luciferase assays in human chorionic cells transiently transfected with constructs made
by sequential deletions of the promoter region allowed
the mapping of basal and cAMP-induced renin gene
expression. Footprinting analysis of the human renin
promoter, reported here for the first time, revealed the
presence of several cis-regulatory elements within the
proximal renin promoter. These consisted of sequences
with varying degrees of homology with, respectively, the
Pit-i-like binding site consensus sequence, the cAMPresponsive element (CRE), the apolipoprotein Ai regulatory protein-1 (ARP-1) binding site, an ets binding
site, and the AGE3 sequence on the angiotensinogen
gene. Finally, gel mobility shift analysis showed that the
CRE sequence specifically binds nuclear extracts from
chorionic cells.
Materials and Methods
Materials
All DNA-modifying enzymes were purchased from New
England Biolabs. Oligonucleotides were synthesized with an
765
Applied Biosystems synthesizer. Reverse transcriptase, Taq
DNA polymerase, ATP, and culture media were obtained
from Boehringer Mannheim. [a-'2P]dCTP and [y-`P]ATP
were purchased from Amersham. Purified luciferase from
Photinus pyralis, synthetic D-luciferin, and forskolin were obtained from Sigma.
Cell Culture and Transfections
Primary and secondary cultures of human chorionic cells
were prepared essentially as previously described.'4 Briefly,
the chorion was separated from other membrane layers and
digested by successive incubation periods in 0.05% collagenase
and 0.05% trypsin. After filtration (45-,um nylon mesh) and
centrifugation, the cell pellets were resuspended in Dulbecco's
modified Eagle's medium (DMEM) supplemented with streptomycin (10 gg/mL), penicillin (10 UI/mL), 4 mmol/L glutamine, and 10% fetal calf serum (FCS) and then plated onto the
25-cm2 flasks containing 4 mL DMEM. When the cells were
confluent, the first subculture was carried out: chorionic cells
were treated with 0.05% collagenase and then with 5 mmol/L
EDTA. The cell suspension was centrifuged, and the resultant
cell pellets were resuspended in DMEM supplemented as
above and then plated at a 1:4 dilution into similar flasks
containing DMEM.
The human choriocarcinoma cell line (JEG-3) was obtained
from the American Type Culture Collection and maintained in
DMEM supplemented as above.
Transient DNA transfections into chorionic and JEG-3 cells
were performed by calcium phosphate precipitation22 using 25 ,ug
DNA per plate consisting of 5 gg RSV-CAT (as an internal
control for plate-to-plate transfection efficiency) and 20 jig renin
luciferase reporter plasmid. After overnight incubation, the cells
were treated for 2 minutes with a 15% glycerol shock. The
medium was then replaced with serum-free defined medium
containing 50% Dulbecco's medium and 50% Ham F12 supplemented with streptomycin (10 gg/mL), penicillin (10 UI/mL),
selenium (3x 10`8 mol/L), palmitic acid (1 gg/mL), oleic acid (5
gg/mL), linoleic acid (5 gg/mL), bovine serum albumin free fatty
acid (1 mg/mL), transferrin (5 ,ug/mL), and glutamine (4 mmol/
L). The cells were incubated for 24 hours with or without
forskolin 10` mol/L, and then the luciferase activity was determined and the CAT immunoassay performed.
Direct renin immunoassay was performed on culture medium by enzyme-linked immunosorbent assay (ELISA) with a
sensitivity limit of 20 pg/mL.23
Reporter Assays
Transfected cells were washed three times with phosphatebuffered saline (PBS), lysed by addition of 0.1 mL 1% Triton, 10
mmol/L MgCl2, 1 mmol/L EDTA, 25 mmol/L Tris-phosphate
(pH 7.8), 15% glycerol, 1 mmol/L dithiothreitol (DTT), and 0.2
mmol/L phenylmethylsulfonyl fluoride, and harvested by scraping. The lysates were transferred to Eppendorf tubes, and after
centrifugation, the supernatant was saved. Luciferase activity was
measured by a liquid scintillation counter (model 1211 Rackbeta,
LKB). Luminescence was integrated for 1 minute after addition
of 150 ,umol/L luciferin and 400 gmol/L ATP.24
Quantitative determination of CAT was performed by a
sandwich enzyme immunoassay (Boehringer Mannheim).
During the first step, CAT contained in cell extracts binds
specifically to modules coated with anti-CAT antibodies.
Then, a digoxigenin-labeled anti-CAT antibody is bound to the
fixed CAT, and during the last step, the digoxigenin-labeled
anti-CAT antibody is detected by a peroxidase-labeled antidigoxigenin antibody.
Plasmid Construction
Human renin gene fragments were isolated from the two
plasmids phrnCAT30 and phrnCAT06, kindly provided by Dr
Fukamizu (University of Tsukuba, Japan) and derived from
the plasmid subclone AHRn88.25 The plasmid pRSVL, desig-
766
Circulation Research Vol 74, No 5 May 1994
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
nated here as pRSV-luciferase and in which luciferase transcription is driven by the Rous sarcoma virus long-terminal
promoter, was provided by Dr Swesh Subramani (version
LpJD201).26 The promoterless plasmid (BS luci) was constructed by subcloning a HindIII/BamHI-digested fragment of
LpJD201 (corresponding to the intronless luciferase construct
with the SV40 small t antigen intron and an SV40 polyadenylation signal) into the polylinker region of the plasmid BlueScript SK (Stratagene). The plasmids p582+ and p582- were
constructed as follows: a 598-bp fragment of the human renin
gene (-582 to + 16) was isolated by Bgl II/HindIll digestion of
phrnCATO6 and subcloned in either orientation into the
HindlIl site of BS luci. The resulting p582+ plasmid contained
nucleotides -582 to + 16 of the renin gene followed by the
luciferase coding sequence. The plasmid containing the antisense insert (+16 to -582) was designated as p582-. The
plasmid p892+ was constructed as follows: a 908-bp fragment
of the human renin gene (-892 to +16) was isolated by
HindIII digestion of phrnCAT30 and inserted into the HindlIl
site of BS luci. The plasmid p2616+ was constructed by
isolating a 2632-bp fragment of the human renin gene (-2616
to +16) by Bgl II/BamHI/Pst I digestion of phrnCAT30 and
inserted into the HindIII site of BS luci.
5-Deletion mutants were generated by linearization of the
p582+ plasmid by Xho I and Apa I, followed by exonuclease
III digestion, S1 nuclease digestion, repair, and self-ligation.
The 5-extent of the exonuclease III digestion is given in
nucleotide pairs corresponding to the published sequence.25
The plasmid p110- was constructed as follows: a 127-bp
fragment (-110 to + 16) of the renin gene was isolated by Kpn
I and Hindlll digestion of the plasmid p110+ (previously
obtained by the exonuclease III digestion above) and inserted
into the Hindlll site of BS luci. All constructions were verified
by the dideoxy sequencing method (Sequenase Version 2.0
DNA Sequencing Kit, USB).
Reverse Transcriptase Reaction and Polymerase
Chain Reaction
Total RNA was extracted from chorionic and JEG-3 cells by
the method of Chomczynski and Sacchi.27 Total RNA (500 and
50 ng) was used to prepare cDNA with the M-MLV reverse
transcriptase (200 U/,uL, GIBCO-BRL) in the appropriate
buffer (Boehringer Mannheim) in the presence of 7.5 mmol/L
oligodT, 0.5 U/,L of the RNase inhibitor rRNasin (40 000
U/mL, Promega), 50 mmol/L DTT, 1 ,ug yeast tRNA, and 2.5
mmol/L of each deoxyribonucleotide. After 1 hour of incubation at 37°C, the reaction was stopped by heating the samples
for 2 minutes at 95°C.
The polymerase chain reaction (PCR) was carried out as
described by Caroff et al.28 Briefly, 3 ,uL of the final cDNA
solution was mixed with 1 ,uL (10 pmol) of both primers, 4.5
4L of 25 mmol/L MgCl2 solution, 1 ,L of a 25 mmol/L solution
of each deoxyribonucleotide, 5 ,uCi of [a-32P]dCTP, 14 ,uL
H20, and 2.5 ,L of 10x PCR buffer (supplied with 1.25 U of
Taq polymerase). Thirty cycles of PCR were performed,
consisting of denaturation at 94°C, annealing at 48°C, and
extension at 72°C. After PCR, polyacrylamide gel electrophoresis was performed with the amplification products originating from the renin mRNA, followed by autoradiography. To
avoid amplification of genomic DNA coding for renin, the two
primers 5'(GTGTCTGTGGGGTCATCCACCTTG)3' and
5'(GGATTCCTGAAATACATAGTCCGT)3' were chosen,
the first sequence being present in exon 7 of the renin gene and
the second spanning the exon 8/exon 9 border.
Quantitative reverse transcriptase PCR was also carried out
as described previously28 by use of an internal standard. Serial
dilutions of total RNA (from 500 to 30 ng) from chorionic and
JEG-3 cells were used with a fixed amount of internal standard
(10 pg) to prepare cDNA before PCR. Bands corresponding to
PCR products were excised and counted in a 8-counter.
Primer Extension Analysis
Total RNA was isolated from human chorionic cells, after
transfection as described above with the plasmids BS luci,
pS82+, and p110+, according to the method of Chomczynski
and Sacchi.27 Primer extension reaction was carried out according to the protocol of the AMV reverse transcriptase
primer extension system (Promega). Briefly, RNA was resuspended in 5 ,uL H20 and incubated with 1 uL (100 fmol) of
32P-labeled luciferase primer (corresponding to the sequence
+37 to +63 of the luciferase gene) and 5 pL of AMV primer
extension 2X buffer. Primer and RNA were annealed by
heating at 85°C for 5 minutes, then at 60°C for 2 hours. AMV
reverse transcriptase was added to the same buffer with
sodium pyrophosphate (6 mmol/L) and incubated at 42°C for
1 hour. The reaction was stopped by addition of loading dye,
and the primer extension products were analyzed on denaturing 8% polyacrylamide/7 mol/L urea gel.
Preparation of Nuclear Extracts and DNase I
Footprinting Assays
Human chorionic cell nuclear extracts were prepared as
previously described.29 The -336 to + 16 fragment of the renin
gene promoter was isolated by Avr II/Hindll digestion of the
p582+ plasmid and inserted into the EcoRV site of BlueScript SK. The synthetic DNA fragment corresponding to
-336 to + 16 was obtained by PCR amplification using the
Blue-Script SK and KS universal primers. The SK or KS
primer was labeled with [y-32PJATP and T4 polynucleotide
kinase before PCR amplification. Footprint analysis was performed in a 10 ,L reaction mixture containing 4 mmol/L
MgC12, 4 mmol/L spermidine, 10 mmol/L HEPES (pH 7.9), 50
mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA. 2.5%
glycerol, 0.5 ,ug of double-stranded poly(dI-dC), 30 ,ug of
nuclear extract, and 15 000 cpm of end-labeled fragment.
After 20 minutes of incubation at 4°C, 2 ,L of DNase I
(Boehringer Mannheim, 10 IU/,uL) at various dilutions ranging from 1150 to 1/400 was added, and digestion was allowed to
proceed for 1 minute at 20°C. The reaction was stopped by
addition of 30 pL of a solution containing 50 mmol/L EDTA,
0.1% sodium dodecyl sulfate, 0.2 mg/mL yeast tRNA, and 10
mg/mL of proteinase K. The reaction mixture was incubated
for 45 minutes at 42°C. The DNA was extracted once with
phenol/chloroform, precipitated with 2 volumes of ethanol,
resuspended in 98% formamide dye, and electrophoresed on a
6% acrylamide/7 mol/L urea sequencing gel.
Gel Mobility Shift Assays
The following double-stranded synthetic oligonucleotide, corresponding to the -234 to -200 renin promoter (containing the
CRE-like sequence, underlined), was used for gel shift analysis
(only the + strand is shown): REN, 5'-GAGGGCTGCTAGCGTCACTGGACACAAGATTGCTTT-3'. The following double-stranded oligonucleotide of the rat somatostatin
promoter containing the consensus CRE30 was used as a competitor: SMS, 5'-CTGGGGGCGCCTCCTTGGCTGCTGACGTCAGAGAGAGAG-3'. The REN oligonucleotide was
end-labeled with [y-32PJATP and T4 polynucleotide kinase. Nuclear extract (7 ,mg) was incubated for 15 minutes at 4°C in 18 4L
of a reaction mixture containing 10 mmol/L HEPES (pH 7.8), 1
mmol/L Na2HPO4 (pH 7.2), 0.1 mmol/L EDTA, 50 mmol/L KCI,
4 mmol/L MgC12, 4 mmol/L spermidine, 2.5% glycerol, 2 ,ug of
double-stranded poly(dI-dC), 1 ,ug of salmon sperm DNA, and
20 000 cpm of labeled double-stranded renin oligonucleotide in
the presence or absence of 2- to 50-fold excesses of competitor
oligonucleotides. The protein-DNA complexes were analyzed by
nondenaturing electrophoresis through 6% polyacrylamide gels
run in 0.25 x Tris borate EDTA.
Statistical Analysis
All results are given as mean±+SEM. Levels of significance
were calculated by Student's t test; P<.05 was considered
significant.
Borensztein et al cis-Acting Elements in the Human Renin Gene
767
% relative luciferase activity
0
2
4
+16
L
p2616.
=W p2616
-2676
6
*
10
8
*
-2616
+16
were assayed in chorionic (stippled
bars) and JEG-3 cells (solid bars). Luciferase activity was normalized to co-
-892 -*p98~p892+
+16
Wuci
-582 -
p582*
-582
___6______lu
~ci~
16
p 582
Results
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
Human Renin Gene Expression in
Transfected Cells
Human renin gene expression was evaluated by transient DNA transfections into two cell types derived
from human chorionic tissue: chorionic cells in secondary culture, which expressed the renin gene to a high
extent (renin content of the culture medium measured
by ELISA reached 20 ng - mL- 1 24 hours-1), and
JEG-3 cells, which did not express it (no renin detected
in the culture medium). Plasmids containing the 5'flanking region of the human renin gene (up to + 16
relative to the transcription start site) were fused to the
luciferase reporter gene, which was preferred to the
CAT gene because of its higher sensitivity.31 To normalize for plate-to-plate differences in transfection efficiency, a reporter plasmid RSV-CAT was cotransfected
and assayed independently. Luciferase activity was normalized to the cotransfected internal control RSV-CAT
and plotted as a percentage of the RSV luci signal for
each transfection.
Fig 1 shows the basal activity of the renin promoter. In
chorionic cells, there was a moderate but not significant
decrease in luciferase activity with shorter plasmids from
p2616+ to p582+. The basal luciferase activities of
p582+, p892+, and p2616+ were 4.65%, 7.26%, and
8.43% of RSV luci, respectively. This suggests that major
basal cis-regulatory elements are located downstream
-582 bp. Two controls were performed: (1) The antisense
plasmid p582- did not express luciferase activity
(0.1+0.1%, n=2) compared with the sense plasmid p582+
(4.65±2.08%, n=6). (2) In JEG-3 cells, the renin lu-
transfected RSV-CAT activity. Results
are given as mean±SEM of the percentage of RSV luciferase activity to adjust
for differences in transfection efficiency.
Each bar representsin two to five indepenluciS p582- *dent
transfections triplicate flasks.
ciferase fusion reporter gene displayed very low activity
(0.23%, 0.17%, and 0.04% of RSV luci for the same
plasmids, respectively) compared with that in chorionic
cells.
To locate cis-regulatory elements, sequential deletions of the 5'-flanking region of the p582+ plasmid
were performed, and the resulting renin-luciferase constructs were transfected into chorionic cells. Results
were expressed as percentage of the activity of the
p582+ plasmid to normalize the results of different
transfections. Fig 2 shows that progressive 5'-deletions
extending to nucleotide - 374 had no effect on promoter
activity. In contrast, deletions extending to nucleotide
-273 gave a twofold stimulation above that of the renin
5'-flanking region of 582 bp. Further deletion of sequences between -273 and -67 greatly increased promoter activity: the plasmids pl37+, p110+, and p67+
demonstrated threefold to fivefold increases in luciferase activity compared with p582+ plasmid. The
specificity of the renin promoter activity was confirmed
by the very low luciferase activity observed with the
p110- plasmid, where the renin DNA was inserted in
the antisense orientation. The 5'-sequences within
p110+ were sufficient to direct specific expression of
this renin gene construct in the chorionic cells, since
JEG-3 cells transfected with p110+ plasmid did not
exhibit the same high level of expression as identically
transfected chorionic cells (Table). The p67+ plasmid
demonstrated a 1.6-fold increase in luciferase activity,
suggesting that the 67 bp of renin promoter are not
sufficient to direct specific expression of renin gene.
Smith and Morris18 described that JEG-3 cells expressed no detectable renin mRNA by Northern blot
% relative luciferase activity
0
`
-582
16
164
o(.-582
-455
-273
-
*>
>
-110
>
-137
+16
-110
-67
100
200
p582i
p582 p501
>
>
-501
FIG 1. Bar graph showing transient
transfection analysis of renin/luciferase
(luci) constructs in chorionic and JEG-3
cells. Transient cotransfections of renin/
luciferase and RSV-chloramphenicol
acetyl transferase (CAT) reporter gene
-
400
500
600
fected into human chorionic cells. Luciferase activity was normalized to
cotransfected RSV-chloramphenicol
acetyl transferase activity, and the results (mean+SEM) are given as per-
+
p455+
p374+
p273.
pl 37+
p110+
p110
p67+
300
FIG 2. Bar graph showing 5-deletion
analysis of the human renin gene promoter. 5-Deletion of the p582+ plasmid was performed by exonuclease Ill
as described in "Materials and Methods." Plasmid constructs were trans-
_
centage of p582+ lucferase activity.
box represents a minimum of
t~~~~~~~~~~ach
three independent transfections in triplicate flasks, except for plasmids
p582- and p110- (two independent
transfections).
768
Circulation Research Vol 74, No S May 1994
Relative Luciferase Activity of Renin Promoter
Deletions in Chorionic and JEG-3 Cells
Chorionic Cells
JEG-3
n
n
Plasmid
%±SEM
%±SEM
100
7
100
3
p582+
p110+
6
3
346+58
123+4
476+58
3
167 22
3
p67+
activity
was
normalized
to cotransfected RSVLuciferase
chloramphenicol acetyl transferase activity, and the results
(mean+SEM) are given as percentage of p582+ luciferase
activity. n represents the number of independent transfections in
triplicate flasks.
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
analysis, and little renin mRNA detected by PCR
compared with chorionic cells (Fig 3) confirmed these
data. Moreover, by quantitative reverse transcriptase
PCR, we showed that renin mRNA from JEG-3 cells
represented 0.3% of renin mRNA from chorionic cells
(data not shown). Finally, the exact site of transcription
driven by the renin/luciferase fusion gene constructs
was determined by primer extension. The p582+ and
p110+ plasmids were transfected into chorionic cells,
the RNA was extracted, and the transcriptional initiation site was mapped by primer extension experiments.
One major fragment was obtained with both plasmids,
confirming the correct initiation of transcription (data
not shown).
Footprint Analysis of the Human Renin Promoter
Changes in the expression of the serial deleted renin/
luciferase genes (p582+ to p67+) suggest that factors
within chorionic cells interact with renin cis-acting
sequences. To demonstrate that these regulatory regions involved in the expression of the renin gene are
sites for contact with DNA binding proteins from chorionic cells, the promoter sequence spanning -336 to
+ 16 was subjected to DNase I footprint analyses in the
presence and absence of nuclear extracts from human
chorionic cells. This study showed the presence of six
footprints, designated A through F (Fig 4). Footprint A
comprised sequences from -29 to -6 and contained a
centrally located, purine-rich sequence (GGAA) shown
to be a conserved recognition site for ets-domain proteins.32 Footprint B, which extended from -79 to -62,
was homologous with the Pit-I binding site consensus
sequence A(A/T)TTANCAT.33 Footprint C (from
-107 to -83) did not show any sequence homology with
previously described regulatory elements. Footprint D,
from -234 to -214, showed strong homology with the
CRE, TGACGTCA.3(1 Footprint E extended from -259
1 2
3 4
-._^
243bp
FIG 3. Northern blot analysis of renin mRNA by reverse transcriptase polymerase chain reaction (PCR) in chorionic cells
(lanes 1 and 3) and JEG-3 cells (lanes 2 and 4). Total RNA 50 ng
(lanes 1 and 2) and 500 ng (lanes 3 and 4) were subiected to
reverse transcription and PCR amplification, electrophoresed on
8% acrylamide gel, and autoradiographed for 3 hours.
to -245, and its sequence was similar to the binding site
for the ARP-1.34 Footprint F, from 293 to 272,
showed strong homology with the sequence AGE3
described recently by Tamura et aP35 on the human
angiotensinogen gene.
Functionality of the CRE Element
The functionality of the CRE in the renin promoter in
chorionic cells was further assessed by two methods: (1)
transient DNA transfections performed in the presence of
forskolin and (2) gel mobility shift analysis using the renin
CRE-like sequence and chorionic cell extracts. Transient
DNA transfections were performed with the different
constructs described above, and the cells were treated or
not treated with 10` mol/L forskolin for 24 hours. All
transfections were performed in the absence of FCS to
avoid nonspecific interference in renin gene expression.
Fig 5 shows a clear twofold to threefold increase of
promoter activity within the region -2616 to -273. With
the p137+ and p110+ plasmids, which lack element D
(-234 to -214), there was only modest stimulation of
promoter activity (1.81±0.2 P<.05, and 1.62±0.28,
P=NS, respectively). No significant stimulation was observed with the p67+ plasmid. The promoterless plasmid,
BS luci, was not stimulated by forskolin (0.96 of unstimulated luciferase activity), demonstrating that the induction
of luciferase activity in cells transfected with the renin/
luciferase constructs was mediated only via the renin
promoter sequence.
Finally, the specific interaction of chorionic cell nuclear factors with element D (containing the CRE-like
sequence) was investigated using gel mobility shift
analysis. Double-stranded oligonucleotide containing
element D was used as a labeled probe. Two protein/
DNA complexes (Fig 6, arrows) were observed that
were specifically competed by an excess of either homologous unlabeled DNA (REN) or somatostatin
(SMS) oligonucleotide containing the consensus CRE.
Both REN and SMS probe were able to completely
compete the chorionic cell nuclear binding protein. This
suggested that a CRE binding protein (CREB)-like
substance interacted with element D of renin promoter.
Discussion
Since the structure of the human renin gene was first
determined,625 several studies have been carried out to
identify the cis-regulatory elements that control its
transcriptional activity. Because human renin gene expression very likely depends on transcriptional regulatory factors present only in renin-expressing cells, it is
important to perform such studies in cell lines that
express renin. Cells derived from chorionic tissue are a
major extrarenal site of renin production after kidney
tissue.8"^" Human chorionic cell cultures have been
characterized by Pinet et al,14 who used electron microscopy to show that these cultures contained a single type
of elongated cell. Immunofluorescence studies using
specific renin antibodies have shown that all cells in
culture were stained and therefore contained both renin
and prorenin. Chorionic cells in culture produce predominantly prorenin, and they seem to have only the
constitutive pathway. Nevertheless, even though the
chorionic cell in culture does not process prorenin, this
model could be used to study renin gene transcription.
Borensztein et al cis-Acting Elements in the Human Renin Gene
76
769
U
G
T
1
23
0.
[c]
ate
Zr:
Pt?
-#
[B]
t
a S
. -.
U
AZ
,.a
V
.I* .
.. .4
GT
AW-
1
5
FIG 4. DNase footprinting of the 5-proximal region of the human renin gene C 336
to + 16). Footprint analysis was performed
with human chorionic cell nuclear extracts.
Binding reactions and DNase treatment
were carried out as described in "Materials
and Methods." G and T represent the sequencing ladder. In panels through Ill, lane
1 shows the reaction performed without
nuclear extract; lanes 2 and 3, the reactions
performed with 30 gig of nuclear extract and
decreasing amounts of DNase 1. Panel 1,
DNase footprinting analysis of the noncoding strand of the -336 to +16 fragment.
Panels II and Ill, DNase footprinting analysis of the coding strand of the -336 to ± 16
fragment. Panel IV, sequences (A through F,
in boxes) of the DNase I-protected regions
of the human renin promoter in the presence of human chorionic cell nuclear
extract.
C
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
'4
*4'
K1
4- .A
fl.p.)
n
f
1*
*t
f
la
Iv
-364 GGGGTTGGGTCTGGGGIAGGGAGCTGGAAACGIAGGITTTTACGCGTTGTCCGAGITTITGAT
F
E
-3Q4 GTTAGCCCTG GCAGIGGIGITIGITCATGAGG TCTGCGIGCTC AGGGGTGAGAGGG~CD
AGGGCTGCIAGCGIGACIGG[AACAAGAITGGITIGGGCACAGGTGTGGI
-184 ICCIGGAGGGCCTCTGCTGGGCAIGGGGAAACGTGGGTACGGIIGACCCACCTAGTCI'GG
-244 AAGCCAGAIA
B
c
-124 TCGCGC AGIGAGTTTTATIGGITGAC TGC CCITGCGCATCITAC CC
AG~GIAAIAAATGAG GG
643GCAGAATTGCAATGACCCCATGCATGGAGT IATAAAAGGGGAAGGGGCTAAGGG
G
-4 CCACAGAACCICAGIGGAIC
+1
Human chorionic cells are a suitable model to study the
transcriptional regulatory elements involved in renin gene
expression: (1) These cells synthesized large amounts of
prorenin. Their renin mRNA was identical in size (1.6 kb)
to that of kidney renin mRNA14,16 and was easily detectable by Northern blot analysis. In contrast, in non-reninproducing cells, JEG-3 cells, renin mRNA could be detected only slightly by PCR. (2) A highest luciferase
activity (between 20- and 200-fold) of renin promoter!
luciferase constructs was obtained with chorionic cells
compared with JEG-3 cells by transient DNA transfection.
This finding in JEG-3 cells is in agreement with the results
of Smith and Morris,'8 who showed that, in JEG-3 cells,
the human renin promoter was not able to direct CAT
transcription in the absence of the herpes simplex virus tk
promoter. The CAT activity detected when the renin
promoter region was fused to the tk promoter17'18might
have been driven by the tk promoter, which is more potent
than the renin promoter. In contrast, Duncan et al'6
reported that human chorionic cells are capable of using
the first 600 bp of the renin promoter to direct CAT
expression. (3) A correct initiation of transcription was
found with renin/luciferase fusion genes transfected
within chorionic cells.
770
Circulation Research Vol 74, No 5 May 1994
Forskolin stimulation (fold increase)
0
t
BS Luci
TagCGTCA
--> +16 p2616+
--~
>6p2+
/
-2616
mi----
-892
-582
.
2
1
._
I
3
4
__j
EEEH
p892+
p582+
-273 t--
p273+
-137
p137+
-110
p110+
-67 *
p67+
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
FIG 5. Bar graph showing effects of 10-5 mol/L forskolin on the expression of the human renin promoter. The different renin/luciferase
constructs were transfected into chorionic cells and assayed for luciferase activity after 24 hours of 10-5 mol/L forskolin stimulation.
Luciferase activity was normalized to cotransfected RSV-chloramphenicol acetyl transferase activity. Results (mean -+-SEM) are given as
forskolin-induced fold increases in basal unstimulated luciferase activity. The luciferase activity of the control plasmid, BS luci, was not
stimulated by forskolin (0.96 of unstimulated luciferase activity). Each box represents two to five independent transfection experiments
in triplicate flasks. The presence of the putative cAMP-responsive element (-226/-219) is indicated by the black marker on the various
constructs.
In the present study, no major basal regulatory elements were detected upstream of -582 up to -2616. In
contrast, deletion analysis of the 5'-flanking region of
the p582+ plasmid revealed that the first 110 bp of the
renin promoter were sufficient for a specific and high
expression in human chorionic cells (more than threecompetitor
t:
b
-l
I
SMS
REN
a)
0
nc
a
0
tin
0
N"
c'
oh
01%
-
0
Ce
in
04
W #,
wsst.qmmu.mm
FIG 6. Gel mobility shift analysis of chorionic cell nuclear factor
interactions with the human renin promoter (-234/-200). A
double-stranded synthetic oligonucleotide including the footprint D was used as the probe. Competitions were performed
with homologous DNA (REN) or with the somatostatin (SMS)
oligonucleotide.30 Arrows indicate the specific DNA/protein complexes. The fold molar excess of competitor is indicated for each
competitor sequence.
fold higher than p582+) and could therefore correspond to the "basal promoter." Indeed, this highest
activity is not due to plasmid "read-through" artifact,
since the activity of the shortest 5'-flanking DNA fragment (p110+ and p67+) was not increased when transfected into a non-renin-producing cell line, the JEG-3
cells. A negative regulatory element was found between
the -374 and -273 bp by deletion analysis of the 582 bp
of renin promoter. DNase I footprinting showed that
this region of DNA binds trans-activating factors present in chorionic cellular nuclear extract. This footprint
has strong homology with a sequence of the mouse
angiotensinogen gene that binds the constitutive factor
named AGF3 by the authors.35 They suggested that
AGF3 could play important roles in the differentiationdependent promoter activation of the mouse angiotensinogen gene in adipocytes. In the case of the human
renin promoter, the present results suggested that an
"AGF3-like" protein from chorionic cells could repress
human renin expression. Further deletions of the 5'region until -137 bp revealed the presence of another
negative regulatory element. Interestingly, the DNase I
protection assay revealed that this region contains a
sequence, footprint E (-259 to -245), that binds
nuclear extract from chorionic cells. This putative ciselement has strong homology with a sequence of the
human apolipoprotein AI gene that binds the ubiquitous ARP-1,34 a member of the orphan steroid receptor
superfamily that decreases apoAl gene expression.
These results suggest that an ARP-1-like protein might
decrease renin gene expression in chorionic cells. Both
negative elements found in chorionic cells are not
operative in JEG-3 cells, since the p10O+ plasmid did
not exhibit a highest activity, suggesting that these
trans-acting factors, AGF3 and ARP-1, may not be
present in these latter cells.
No difference in luciferase activity was found with the
plasmids pl37+ and p110+ in relation to the fact that
no footprint was found between -137 and -110 bp of
the human renin promoter. Further deletions until -67
bp showed an increase in luciferase activity. This DNA
Borensztein et al cis-Acting Elements in the Human Renin Gene
A.
4)
40
A..
-107/-83
-791-62
-291-6
c'
Ii
=
-2931-272
-2591-245
-23d41-214
F
E
D
A
ARen
Ets Cons.
Ren
C
Pit-1 Cons.
ATGNATAAWT
D
CRE Cons.
Ren
GAGGGCTGCTAGCGTCACTGG
TGACGTCA
Ren
AGGGGTCACAGGGCC
E
ARP-1 Cons.
F
Ren
GGAW
FIG 7. Schematic representation of the hurenin promoter. The stippled boxes are
the protein-binding sites identified by DNase
footprinting analysis. For each footprint
(A--F), renin sequence was aligned to possible factor binding site consensus sequence.
Boldface letters in renin sequence represent
homology with the consensus sequence.
W=A+T, N=G+A+T+C. LUCI indicates luciferase; ARP-1, apolipoprotein Al regulatory
protein-i; CRE, cAMP-responsive element;
and Pit-1, pituitary-specific factor.
man
AGGGGTCA-AGGGNTCA
GCAGTGCT-GTTTCTCATCAGCC
AGCTGTGCTTGT
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
region binds two factors: one named element C, which did
any homology with previously described regulatory elements; the other, element B, is an adenine/
thymine rich region very similar to the Pit-1 binding site
consensus sequence.33 Recently, Sun et a120 showed that
this region of the human renin promoter binds nuclear
extracts isolated from GC cells, a pituitary lactotrope
precursor cell line. Furthermore, they showed that the
activity of the renin promoter/luciferase constructs
transfected into HeLa cells was greatly increased by
cotransfection with a Pit-1 expression vector. Pit-1, a
specific pituitary factor, is a member of the POU family
of transcription factors, which plays a critical role in the
proliferation of specific cells and in their expression of
specific genes.36 In contrast to the results of Sun et a120
in GC cells, deletion of this Pit-i-like binding site did
not affect luciferase gene expression in chorionic cells.
This suggests cell-specific use of this regulatory element. Such an observation, concerning the differential
expression of a promoter in different cell lines, has been
made by Paulweber et a137 for the apolipoprotein B
promoter in HepG2 (hepatic) and CaCo-2 (intestinal)
cell lines. They showed that this difference was due to
the relative amounts of nuclear factors that bind to
specific sequences located within the promoter. Another explanation for this discrepancy could be the
presence, in chorionic cells, of a nuclear factor binding
the downstream element A (-29 to -6 bp), which
contains the consensus GGAA ets motif.32 Many of the
ets-domain proteins have been shown to be transcription
activators in various tissues.32 Thus, the high luciferase
activity of plasmid p67+ might result from the presence,
in chorionic cells, of an ets-domain protein involved in
the expression of the human renin gene. This domain
might be not operative in GC cells.
The functionality of the renin promoter was further
assessed by forskolin stimulation. Previous studies by
Duncan et a138 had shown that, in chorionic cells,
plasmid constructs containing either the first 600 or 100
bp of the human renin promoter fused to CAT were
markedly stimulated by 8 hours of incubation with 10-6
mol/L forskolin. In contrast, plasmids containing the
'-flanking region of the renin gene (from - 584 to -146
and from -146 to + 11) fused to the tk promoter were
not share
A
GGTAATAAATCAGGGCAG
B
AGE3 Cons.
B
+1 +16
TATAAAAGGGGAAGGGC TAAGGGA
GGAW
771
not induced by forskolin.38 However, these experiments
performed in the presence of FCS, which is
capable of stimulating the transcription of several genes
via different serum response elements.39 cAMP might
also activate serum response elements,40 and therefore,
interactions between serum- and cAMP-induced stimulation could not be excluded. In JEG-3 cells, Burt et al17
had also used plasmids containing the 5'-flanking region
of the renin gene fused to the tk promoter and reported
a modest 60% cAMP-induced stimulation. It was for
these reasons that further studies on the effects of
cAMP on renin gene expression were required.
In the present study, all stimulations were performed in
the absence of FCS to avoid nonspecific interference. The
results show that element D (-234 to -214) was required
for forskolin to stimulate transcription twofold to threefold. This element contains a motif, TAGCGTCA, that
shares a six-nucleotide homology with the consensus CRE
octamer TGACGTCA.30 It contains the short motif
CGTCA, which has been shown to be a binding site for
CREB.41 The present results show that nuclear extracts
isolated from chorionic cells bound to this sequence. Two
specific DNA/protein complexes were found and could
result from the formation of monomeric and dimeric
DNA/protein complexes as previously described.42 In addition, this DNA/protein binding was displaced by the
SMS oligonucleotide containing the consensus binding site
for CREB.30 Taken together, these results are in favor of
element D being a functional CRE site. However, the
modest forskolin-stimulated increase in luciferase activity
observed with constructs p137+ and pl10+ (50%) cannot
be explained by this CRE-like sequence. Interestingly,
Peers et a143 have shown that Pit-1 is involved in the cAMP
stimulation of the human prolactin gene and that several
Pit-1 binding sites fused to the tk promoter confer cAMP
responsiveness to GC cells. It is therefore possible that the
Pit-i-like binding site present on the renin gene is also
involved in regulation by cAMP and that stimulation by
cAMP is the result of multiple responses acting in combination to yield a measurable degree of stimulation. Further studies will be necessary to determine whether the
Pit-i-like sequence is necessary to confer cAMP responsiveness on the renin gene.
were
772
Circulation Research Vol 74, No 5 May 1994
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
Overall, these results clearly identify several functional cis-regulatory regions in the renin gene and
potential trans-activating factors governing renin gene
expression in human chorionic cells as represented
schematically in Fig 7. No studies have yet been reported in human JG cell regulation of renin transcription because of the lack of suitable cell lines or cell
culture models. However, like chorionic cells, JG cells
respond to forskolin by an increase in renin mRNA and
renin release,44 and factors similar or identical to the
CREB identified in the present study could be involved.
Moreover, chorionic cells in culture respond to angiotensin II by an elevation of intracellular calcium and a
decrease in renin production (unpublished data) like JG
cells.2
However, characterization of transcription factors
that bind human renin promoter from kidney cortex or
juxtaglomerular cells would permit determination of
renin-producing cell-specific factors. We can speculate
that some of the transcription factors characterized
could be implied in the renin tissue-specific expression
and in renin regulation in vivo.
Acknowledgments
We wish to thank Dr A. Fukamizu and Dr S. Subramani
for having kindly provided the renin and RSV luciferase
plasmids, respectively. The authors are grateful to Dr M.
Day for editorial help and to Nicole Braure for secretarial
assistance. We wish to thank G. Masquelier and A. BoisquilIon for artwork.
References
1. Hackenthal E, Paul DG, Taugner R. Morphology, physiology, and
molecular biology of renin secretion. Physiol Rev. 1990;70:
1067-1116.
2. Kurtz A. Cellular control of renin secretion. Rev Physiol Biochem
Pharmacol. 1989;113:1-40.
3. Nakamura N, Burt DW, Paul M, Dzau VJ. Negative control
elements and cAMP responsive sequences in the tissue-specific
expression of mouse renin genes. Proc Natl Acad Sci US A. 1989;
86:56-59.
4. Barret G, Horiuchi M, Paul M, Pratt RE, Nakamura N, Dzau VJ.
Identification of a negative regulatory element involved in tissuespecific expression of mouse renin genes. Proc NatlAcad Sci U SA.
1992;89:885-889.
5. Tamura K, Tanimoto K, Murakami K, Fukamizu A. A combination of upstream and proximal elements is required for efficient
expression of the mouse renin promoter in cultured cells. Nucleic
Acids Res. 1992;14:3617-3623.
6. Soubrier F, Panthier JJ, Houot AM, Rougeon F, Corvol P. Segmental homology between the promoter region of the human renin
gene and the mouse Renl and Ren2 promoter regions. Gene.
1986;41:85-92.
7. Deboben A, Inagami T, Ganten D. Tissue renin. In: Hypertension:
Physiopathology and Treatment. New York, NY: McGraw-Hill;
1983:194-209.
8. Acker GM, Galen FX, Devaux C, Foote S, Papernik E, Pesty A,
Menard J, Corvol P. Human chorionic cells in primary culture: a
model for renin biosynthesis. J Clin Endocrinol Metab. 1982;55:
902-909.
9. Poisner AM, Wood GM, Poisner R, Inagami T. Localization of
renin in trophoblasts in human chorion leave at term pregnancy.
Endocrinology. 1981;109:1150-1155.
10. Skinner SL, Lumbers ER, Symonds EM. Renin concentration in
human fetal and maternal tissues. Am J Obstet Gynecol. 1968;101:
529-533.
11. Conn JW, Cohen EL, Lucas CP, McDonald WJ, Mayor GH,
Blough WM, Eveland WC, Bookstein JJ, Lapides J. Primary
reninism. Arch Intern Med. 1972;130:682- 696.
12. Galen FX, Corvol MT, Devaux C, Gubler MC, Mounier F, Camilleri JP, Houot AM, Menard J, Corvol P. Renin biosynthesis by
human tumoral juxtaglomerular cells: evidences for a renin precursor. J Clin Invest. 1984;73:1144-1155.
13. Pinet F, Corvol MT, Dench F, Bourguignon J, Feunteun J, Menard
J, Corvol P. Isolation of renin-producing human cells by transfection with three simian virus 40 mutants. Proc Natl Acad Sci
USA. 1985;82:8503-8507.
14. Pinet F, Corvol MT, Bourguignon J, Corvol P. Isolation and characterization of renin-producing human chorionic cells in culture.
J Clin Endocrinol Metab. 1988;67:1211-1220.
15. Poisner AM, Agrawal P, Poisner R. Renin release from human
chorionic trophoblasts in vitro. Trophoblast Res. 1987;2:45-60.
16. Duncan KG, Haidar MA, Baxter JD, Reudelhuber TL. Control
elements in the human renin gene. Trans Am Assoc Phys. 1987;
100:1-9.
17. Burt DW, Nakamura N, Kelley P, Dzau VJ. Identification of
negative and positive regulatory elements in the human renin gene.
J Biol Chem. 1989;264:7357-7362.
18. Smith DL, Morris BJ. Transient expression analyses of DNA
extending 2.4 kb upstream of the human renin gene. Mol Cell
Endocrinol. 1991;80:139-146.
19. Ekker M, Sola C, Rougeon F. The activity of the mouse renin
promoter in cells that do not normally produce renin is dependent
upon the presence of a functional enhancer. FEBS Lett. 1989;255:
241-247.
20. Sun J, Oddoux C, Lazarus A, Gilbert MT, Catanzaro DF.
Promoter activity of human renin 5'-flanking DNA sequences is
activated by the pituitary-specific transcription factor Pit-1. J Biol
Chem. 1993;268:1505-1508.
21. Ingraham HA, Chen R, Mangalam HJ, Elsholtz HP, Flynn SE, Lin
CR, Simmons DM, Swanson L, Rosenfeld MG. A tissue-specific
transcription factor containing a homeodomain specifies a
pituitary phenotype. Cell. 1988;55:519-529.
22. Graham FL, Van Der Eb AJ. A new technique for the assay
of infectivity of human adenovirus 5 DNA. Virology. 1975;52:
456-476.
23. Menard J, Bews J, Heusser C. A multirange ELISA for the measurement of plasma renin in humans and primates. J Hypertens.
1984;2(suppl 3):275-279.
24. N'Guyen VT, Morange M, Bensaude 0. Firefly luminescence
assays using scintillation counters for quantitation in transfected
mammalian cells. Anal Biochem. 1988;171:404-408.
25. Fukamizu A, Nishi K, Nishimatsu S, Miyazaki H, Hirose S,
Murakami K. Human renin gene of renin-secreting tumor. Gene.
1986;49:139-145.
26. De Wet JR, Wood KV, Deluca M, Helinski DR, Subramani S.
Firefly luciferase gene: structure and expression in mammalian
cells. Mol Cell Biol. 1987;7:725-737.
27. Chomczynski P, Sacchi N. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal
Biochem. 1987;162:156-159.
28. Caroff N, Della Bruna R, Philippe J, Corvol P, Pinet F. Regulation
of human renin secretion and renin transcription by quantitative
PCR in cultured chorionic cells: synergistic effect of cyclic AMP
and protein kinase C. Biochem Biophys Res Commun. 1993;193:
1332-1338.
29. Shapiro DJ, Sharp PA, Wahli WW, Keller M. A high efficiency
Hela cell nuclear transcription extract. DNA. 1988;7:47-55.
30. Montminy MR, Sevarino KA, Wagner JA, Mandel G, Goodman
RH. Identification of a cyclic-AMP-responsive element within
the somatostatin gene. Proc Natl Acad Sci U SA. 1986;83:
6682-6686.
31. Alam J, Cook JL. Reporter genes: application to the study of
mammalian gene transcription. Anal Biochem. 1990;188:245-254.
32. Wasylyk B, Hahn SL, Giovane A. The Ets family of transcription
factors. EurJBiochem. 1993;211:7-18.
33. Nelson C, Albert VR, Elsholtz HP, Lu LIW, Rosenfeld MG.
Activation of cell-specific expression of rat growth hormone and
prolactin genes by a common transcription factor. Science. 1988;
239:1400-1405.
34. Ladias JAA, Karathaniasis SK. Regulation of the apolipoprotein
AI gene by ARP-1, a novel member of the steroid receptor superfamily. Science. 1991;251:561-565.
35. Tamura K, Tanimoto K, Ishii M, Murakami K, Fukamizu A.
Proximal and core DNA elements are required for efficient angiotensinogen promoter activation during adipogenic differentiation.
J Biol Chem. 1993;268:15024-15032.
36. He X, Treacy MN, Simmons DM, Ingraham HA, Swanson BW,
Rosenfeld MG. Expression of a large family of POU-domain regulatory genes in mammalian brain development. Nature. 1989;340:
35-42.
37. Paulweber B, Onasch MA, Nagy BP, Levy-Wilson B. Similarities
and differences in the function of regulatory elements at the 5' end
Borensztein et al cis-Acting Elements in the Human Renin Gene
38.
39.
40.
41.
of the human apolipoprotein B gene in cultured hepatoma
(HepG2) and colon carcinoma (CaCo-2) cells. J Biol Chem. 1991;
266:24149-24160.
Duncan KG, Haidar MA, Baxter JB, Reudelhuber TL. Regulation
of human renin expression in chorion cell primary cultures. Proc
Natl Acad Sci USA. 1990;87:7588-7592.
Faisst S, Meyer S. Compilation of vertebrate-encoded transcription
factors. Nucleic Acids Res. 1992;20:3-26.
Fukumoto Y, Kaibuchi K, Oku N, Hori Y, Takai Y. Activation of
the c-fos serum-response element by the activated c-Ha-ras protein
in a manner independent of protein kinase C and cAMPdependent protein kinase. J Biol Chem. 1990;265:774-780.
Nichols M, Weih F, Schmid W, De Vack C, Kowenz-Leutz E,
Luckow B, Boshart M, Schuitz G. Phosphorylation of CREB affects
773
its binding to high and low affinity sites: implications for cAMP
induced gene transcription. EMBO J. 1992;11:3337-3346.
42. Yamamoto KK, Gonzales GA, Biggs WH, Montminy MR.
Phosphorylation-induced binding and transcriptional efficacy of
nuclear factor CREB. Nature. 1988;334:494-498.
43. Peers B, Monget P, Nalda MA, Voz ML, Berwaer M, Belayew A,
Martial JA. Transcriptional induction of the human prolactin
gene by cAMP requires two cis-acting elements and at least
the pituitary-specific factor Pit-i. J Biol Chem. 1991;266:
18127-18134.
44. Della Bruna R, Kurtz A, Corvol P, Pinet F. Renin mRNA quantification using polymerase chain reaction in cultured juxtaglomerular cells. Circ Res. 1993;73:639-648.
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
cis-regulatory elements and trans-acting factors directing basal and cAMP-stimulated
human renin gene expression in chorionic cells.
P Borensztein, S Germain, S Fuchs, J Philippe, P Corvol and F Pinet
Downloaded from http://circres.ahajournals.org/ by guest on August 3, 2017
Circ Res. 1994;74:764-773
doi: 10.1161/01.RES.74.5.764
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 1994 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/74/5/764
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/