Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Cell growth wikipedia , lookup
Extracellular matrix wikipedia , lookup
Tissue engineering wikipedia , lookup
Cell encapsulation wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
Cell culture wikipedia , lookup
Programmed cell death wikipedia , lookup
Cellular differentiation wikipedia , lookup
Lokeshwar et al: Supplemental Information Antibodies and constructs used in this study: Antibodies were obtained from the following companies: Cell signaling (Boston, MA): Akt, phospho (ser473)-Akt, phospho-Bad (ser-136), Bcl-XL, bid, capse-9, caveolin-1, c-erbB2(p-Tyr1221/1222), cleaved caspase 3, cleaved caspase 8, cleaved PARP, DR5; Santa Cruz Biotechnology (Santa Cruz, CA): CD44, DR4, Fas, FAS-L, HAS2; Sigma-Aldrich (St Luis MO): FADD; Novocastra (Newcastle upon Tyne, UK): CD168 (RHAMM); Lab-Vision/Thermo Fisher (Fremont, CA): c-erbB-2; Epitomics (Burligame, CA): MMP-2, MMP-9, IKB-D, EGFR, p-EGFR (tyrosine 1143). BD Pharmingen (San Jose, CA): bax (6A7), bad, bcl-2. pNF--luc (p-NF-KB-Luc cis reporter plasmid) was purchased from Stratagene, La Jolla, CA. Coumerin and 4-hydroxy coumerin were obtained from Indofine Chemical Co (Hillsborough, MJ). A detailed description of motility and invasion assays: Matrigel invasion assay was carried out as described previously (16,18,19) except that 4-MU was added in both chambers of the Transwell; for details, please see supplemental information. The cells in the top chamber were resuspended in RPMI 1640 + ITS (insulin, transfeffrin and selenium, Sigma Aldrich, St Luis, MO) medium and the bottom chamber contained growth medium as the chemoattractant. For motility assay, 8-Pm pore Transwell with similar experimental set up was used and the migration of the cells was assayed after 18 h incubation. In both assays, HA (50 Pg/ml) was added to the top and the bottom chambers of some wells. The cells in the top and bottom chambers were determined using MTT assay (16,18,19); the cells adhered to the lower surface of the filter were included in the bottom chamber fraction. To neutralize the effect of 4-MU on cell growth, percent invasion or motility were calculated as (O.D. bottom chamber ÷ O.D. (top + bottom chambers)) x100. 1 Transient transfection assays with myr-Akt plasmid: PC3-ML cells were transiently transfected with pcDNA3-Myr-HA-Akt1 plasmid (myr-Akt; Addgene, Inc, Cambridge, MA) using Lipofectamin 2000 (Invitrogen, Carlsbad, CA). 24-h following transfection, cells were treated with 4-MU (0.4 mM). Cell growth, apoptosis, and gene expression (Q-PCR) were evaluated after 48 h. Alternatively, PC3-ML cells were transiently co-transfected with myr-Akt and pNF--luc and pGL4.74[hRluc/TK] plasmids and, 24 hours later, treated with 4-MU,. The firefly luciferase and Renilla luciferase activities were assayed 24 hours following 4-MU treatment. Determination of MVD and the TUNEL assay: Staining of microvessels was performed as described previously (18,19). Microvessel density (MVD) was determined by 2 readers independently counting microvessels in 10 fields and expressed as mean ± sd using a Nikon H550L microscope with a video screen camera (18,19). Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay was performed to determine the extent of apoptosis in tumor tissues, using the In situ Cell Death detection kit (Roche Diagnostics; Indianapolis, IN). The apoptosis index was calculated by counting the number of TUNEL positive cells in three high power fields for each specimen in the vehicle and in the 4-MU-treated groups and expressed as mean ± sd. Tumor extracts and immunoblotting: Tumor tissues (~ 30 mg) were solubilized in 50 mM Tris.HCl, pH 7.4, 150 mM NaCl, 1% NP40, 0.1% SDS, 50 mM sodium fluoride, 0.1 mM sodium vanadate, protease inhibitor cocktail (10 Pg/ml; Sigma-Aldrich, St. Louis, MO). The extracts were clarified by centrifugation at 15,000 rpm for 15 min and analyzed (~ 20 Pg protein) using specific antibodies. 2 Table 1: Primers for Q-PCR: Sequences for the forward and reverse complementary PCR primers used in the Q-PCR analyses of the specific genes are indicated along with the GenBank accession number for the gene. Gene CD44s CD44v Accession # NM_001001391.1 NM_001001390.1 MMP-2 MMP-9 E-actin NM_004530 NM004994 NM_001101 RHAMM Caveolin1 IL-8 NM_012484.1 NM_000584.2 CXCR1 NM_000634.2 CXCR2 NR_002712.1 CXCR4 NM_003467.2 SDF1-v1 SDF1-v2 HAS1 NM_199168.2 NM_000609.4 NM_001523 HAS2 HAS3 U54804 NM_005329 Forward Primer 5’CTGTACACCCCATCCCAGAC3’ 5’CAGGTGGAAGAAGAGACCCAA 3’ 5’CCTGATGTCCAGCGAGTG3’ 5’CTGCCAGGACCGCTTCTACT3’ 5’CAACTGGGACGACATGGA3’ 5’CAGCTGGAAGATGAAGAAGGA 3’ 5’ACCCACTCTTTGAAGCTGTTG3’ Reverse Primer 5’TGTGTCTTGGTCTCTGGTAGC3’ 5’ATGACTTCCAAGCTGGCCGTG GCT3’ 5’-AGCCAGATCACCTTCCACA CACAA-3’ 5’-AGCAGGAAGATGAGGACA ACAGCA-3’ 5’TCATCAAGCAAGGGTGTGAG3’ 5’TCTCAGCCCTCTTCAAAAACTTCT 3’ 5’GCAAGGAGTTCTTGGCACG TCATT3’ 5’ACAATACAGCAAACTGGCGGATG C3’ 5’GCTGAGGTCACTGGGATGAA3’ 5’GGGAAGCCAGGATCCATTTT3’ 5’CTCAGGGCACTGCAGGATGT3’ 5’GTTGGCCTTGGGGTTCAG3’ 5’GCATGTAGTTGTAGCTGAAAAGG 3’ 5’GAACTTGAAATTGGCACCAGG3’ 5-ggctccaaggaaagcataga-3 5’CACAGAAGGTCCTGGTGG TA3’ 5’CATTGAAAAGCTGCAATCACA3’ 5’GGTGGGGACGTGCGGAT C3’ 5’TGAACAAAACAGTTGCCCTTT3’ 5’CTCTACTCCCTCCTCTATATGT C3’ 5’ATGCAGGATACACAGTGGAA GTAG3’ 5’TTCCCATCTATGACCATGACAA3’ 5’AACTGCCACCCAGATGG A3’ 3 Table 2 (Supplement): Summary of the effect of 4-MU on gene expression in the absence or presence of HA. The data in columns 1 (4-MU % untreated) and column 2 (4-MU + HA: % untreated) were calculated from the normalized mRNA expression levels presented in Figure 4, for 4-MU (0.4 mM) and 4-MU + HA (50-Pg/ml) treated samples. The results are expressed at percent fold change in 4-MU or 4-MU + HA samples when compared to untreated control (= 100%) or HA-treated control (= 100%), respectively. *: CD44s is the dominant isoforms expressed in PC3-ML cells, and therefore, data in the table are presented for CD44s. Gene 4-MU (% untreated) Caveolin -1 HAS2 RHAMM CD44s* IL-8 MMP-2 MMP-9 CXCR1 CXCR2 CXCR4 CXCR7 12.9 ± 2 33.8 ± 4.1 36.8 ± 5.7 34.1 ± 6.3 10.4 ± 1.2 33.3 ± 3.7 29.6 ± 8.6 52.9 ± 5.9 69.6 ± 10.3 31.3 ± 7.3 51.2 ± 10 4 4-MU+HA (% HA-treated control) 23.8 ± 3.5 64.9 r 5.4 100.5 ± 3.7 78.4 ± 7.4 48.1 ± 2.4 71.4 ± 3.7 79.6 ± 8.3 105 ± 5.9 98.4 ± 6.3 102.7 ± 5.9 216 ± 20.2 Table 3: Analysis of serum chemistry in vehicle and 4-MU treated animals: Blood from vehicle and 4-MU treated (450 mg/kg) was analyzed for clotting time, blood urea nitrogen, creatinine, serum glutamic pyruvic transaminase (SGPT) and alkaline phosphatase. Data are mean r sd. Parameter Vehicle 4-MU treated clotting time (sec) 173.2 ± 9.3 171.8 ± 7.3 Blood urea nitrogen (mg/dl) 27.8 ± 2.7 28.8 ± 2.8 Creatinine (mg/dl) 0.28 0.3 SGPT (U/L) 59.2 ± 4.9 56.5 ± 9.4 Alk Phosphatase (U/L) 79.0 ± 15.1 74.7 ± 19.6 5 Figure S1: Effect of HA receptor siRNA treatment on PC3-ML cell growth and apoptosis: PC3-ML cells were transfected with CD44, RHAMM or CD44 and RHAMM siRNAs. Cell proliferation (A) and apoptosis (B) were examined after 72 h, by cell counting and Cell Death ELISA kit, respectively. Figure S2: Effect of myr-Akt expression on 4-MU induced effects in PC3-ML cells. PC3-ML cells were transfected with either vector or myr-Akt plasmid. Twenty-four hour following transfection, cells were treated with myr-Akt. A: total Akt and phospho-Akt expression in PC3ML transfectants after 24 h of 4-MU treatment (0.4 mM). B: Cell proliferation: PC3-ML transfectants were treated with 4-MU (0.4 mM) for 48 h and the cells were counted. C: Apoptosis: PC3-ML transfectants were treated with 4-MU (0.4 mM) for 48 h and apoptosis was determined using the Cell Death ELISA kit. D: NFkB promoter activity: PC3-ML cells were cotransfected with vector/myr-Akt and NFkB plasmids. Twenty-four hours following transfection, the cells were exposed to 4-MU and the firefly luciferase and Renilla luciferase activities were assayed after 24 h. E: PC3-ML transfectants were treated with 4-MU (0.4 mM) for 48 h and the expression of HAS2, IL-8, CD44, RHAMM and MMP-9 mRNAs was examined by Q-PCR. Figure S3: Effect of 4-MU treated on body weight and the weights of specific organs. A: Animals in the vehicle and 4-MU treated (450 mg/kg) groups from the experiment described in Figure 6 A were weighed twice weekly until the end of the study. Data: Mean r sd. B: At necropsy (day 35) prostate, testes and seminal vesicles were weighed from animals in the vehicle and 4-MU treated (450 mg/kg) groups from the experiment described in Figure 6 A. Figure S4: Effect of TXTR and 4-MU combination on PC3-ML cell growth. PC3-Ml cells (12,000 cells/well) were exposed to various concentrations of TXTR(0- 5000 pM (0-5 nM)) in the presence or absence of 4-MU (0-0.6 mM) for 48 hours. Following incubation, MTT (3-(4,56 Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was added to each well at 250-Pg/ml concentration. Following a two hour incubation, the insoluble purple formazan product was dissolved in dimethylsulfoxide and the optical density was measured at 515 nm. The data are an average of duplicate wells. 7