Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
From www.bloodjournal.org by guest on August 3, 2017. For personal use only. Chimeric CLL-1 Antibody Fusion Proteins Containing GranulocyteMacrophage Colony-Stimulating Factor or Interleukin-2 With Specificity for B-Cell Malignancies Exhibit Enhanced Effector Functions While Retaining Tumor Targeting Properties By Jason L. Hornick, Leslie A. Khawli, Peisheng Hu, Maureen Lynch, Peter M. Anderson, and Alan L. Epstein Although monoclonal antibody (MoAb) therapy of the human malignant lymphomas has shown success in clinical trials, its full potential for the treatment of hematologic malignancies has yet to be realized. To expand the clinical potential of a promising human-mouse chimeric antihuman Bcell MoAb (chCLL-1) constructed using the variable domains cloned from the murine Lym-2 (muLym-2) hybridoma, fusion proteins containing granulocyte-macrophage colony-stimulating factor (GM-CSF) (chCLL-1/GM–CSF) or interleukin (IL)2 (chCLL-1/IL–2) were generated and evaluated for in vitro cytotoxicity and in vivo tumor targeting. The glutamine synthetase gene amplification system was employed for high level expression of the recombinant fusion proteins. Antigenic specificity was confirmed by a competition radioim- munoassay against ARH-77 human myeloma cells. The activity of chCLL-1/GM–CSF was established by a colony formation assay, and the bioactivity of chCLL-1/IL–2 was confirmed by supporting the growth of an IL-2–dependent T-cell line. Antibody-dependent cellular cytotoxicity against ARH-77 target cells demonstrated that both fusion proteins mediate enhanced tumor cell lysis by human mononuclear cells. Finally, biodistribution and imaging studies in nude mice bearing ARH-77 xenografts indicated that the fusion proteins specifically target the tumors. These in vitro and in vivo data suggest that chCLL-1/GM–CSF and chCLL-1/IL–2 have potential as immunotherapeutic reagents for the treatment of B-cell malignancies. q 1997 by The American Society of Hematology. W cell lines in vitro and to improve the survival of human lymphoma-bearing severe combined immunodeficiency (SCID) mice by the induction of apoptosis (Funakoshi et al, manuscript in preparation). In antibody-dependent cellular cytotoxicity (ADCC) assays, however, murine Lym-2 mediates low tumor lysis with human mononuclear effector cells. A human-mouse chimeric derivative designated chCLL-1 has therefore been constructed to increase its effector functions. To further enhance the immunotherapeutic potential of this chimeric antibody for the treatment of B-cell malignancies, antibody fusion proteins containing human GMCSF and IL-2 have been generated. In this study, we describe the effector functions mediated by these recombinant molecules and demonstrate their tumor targeting abilities in a nude mouse xenograft model. ITH THE EXCEPTION of a chimeric anti-CD20 monoclonal antibody (MoAb), which has produced tumor regressions in patients with relapsed B-cell non-Hodgkin’s lymphoma (NHL),1 unconjugated MoAbs have demonstrated limited therapeutic responses.2 Radioimmunotherapy, on the other hand, has shown considerable promise in clinical studies, particularly in the treatment of B-cell NHL.3 The efficacy of radioimmunotherapy is restricted, however, either by dose-limiting thrombocytopenia or more severely by the presence of bone marrow disease. In these settings, effective therapy with unconjugated MoAbs would be desirable for the induction of tumor remission. For this purpose, the combination of MoAbs and biologic response modifiers has been investigated as a means of increasing tumor lysis. Cytokines including interleukin-2 (IL-2) and granulocyte-macrophage colony-stimulating factor (GM-CSF) have been shown to enhance both in vitro cytotoxicity mediated by MoAbs against tumor targets and in vivo killing of tumor xenografts in animal model systems.4-9 Because of the toxicity of systemically administered cytokines, however, methods are needed to target these biologically potent immunologic mediators to the tumor site. One approach, gene transfer, has demonstrated that tumor cells engineered to secrete cytokines stimulate antitumor immunity and rejection in animal models,10-17 illustrating the importance of localizing cytokines to tumors. However, at the present time, this approach is impractical in the clinical setting. An alternative method is the use of antibody-cytokine fusion proteins to direct such immunologically active molecules to tumor sites.18-20 In this way high local concentrations of cytokines within tumors can be achieved and systemic toxicity is minimized or avoided. In this report, we describe the development of such molecules for the treatment of hematologic malignancies. Lym2 is a murine IgG1 MoAb directed against a human major histocompatability complex (MHC) class II variant that is strongly reactive with a high percentage of human B-cell NHL, chronic lymphocytic leukemia, and multiple myeloma cell lines and biopsy specimens.21 Lym-2 has recently been shown to have a direct inhibitory effect on human lymphoma MATERIALS AND METHODS Reagents The plasmid pcD-hGM/Eo-CSF containing the human GM-CSF cDNA22 was obtained from the American Type Culture Collection From the Department of Pathology, University of Southern California School of Medicine, Los Angeles; the Division of HematologyOncology, the Department of Medicine, UCLA School of Medicine, Los Angeles, CA; and the Section of Pediatric Hematology-Oncology, Mayo Clinic, Rochester, MN. Submitted December 16, 1996; accepted January 31, 1997. Supported in part by Cancer Therapeutics, Inc (Los Angeles, CA), Techniclone Corp (Tustin, CA), Brilliance Pharmaceuticals (Shanghai, China), and a grant from Children’s Cancer Research Fund, the Hedberg Foundation (Minneapolis, MN). Address reprint requests to Alan L. Epstein, MD, PhD, Department of Pathology, University of Southern California School of Medicine, 2011 Zonal Ave, HMR 210, Los Angeles, CA 90033. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate this fact. q 1997 by The American Society of Hematology. 0006-4971/97/8912-0001$3.00/0 Blood, Vol 89, No 12 (June 15), 1997: pp 4437-4447 AID Blood 0001 / 5h37$$$$$1 4437 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 4438 HORNICK ET AL (clone 57594; Rockville, MD). The plasmid pBC12/HIV/IL-2 containing the human IL-2 cDNA23 was obtained from the American Type Culture Collection (clone 67618). The plasmids pEE6hCMVB and pEE12 were purchased with the Glutamine Synthetase Gene Amplification System from Celltech Biologics (Slough, UK). Restriction endonucleases, T4 DNA ligase, and other molecular biology reagents were purchased from New England Biolabs (Beverly, MA) or Boehringer Mannheim (Indianapolis, IN). RPMI-1640 medium, minimal essential medium (MEM) nonessential amino acids solution, penicillin-streptomycin solution, Dulbecco’s phosphate-buffered saline (PBS), dialyzed fetal bovine serum, Sephadex, buffer salts, and other reagents such as chloramine T, sodium metabisulfite, hydrogen peroxide, and ABTS (2,2*-azino–bis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt) were purchased from Sigma Chemical Co (St Louis, MO). Hybridoma-SFM medium with and without glutamine was purchased from Life Technologies (Gaithersburg, MD). Fetal bovine serum was obtained from HyClone Laboratories, Inc (Logan, UT). Iodine-125 and iodine-131 were obtained as sodium iodide in 0.1 N sodium hydroxide from DuPont/New England Nuclear (North Billerica, MA). Balb/C and athymic nude mice were purchased from Harlan Sprague Dawley (Indianapolis, IN). Antibodies and Cell Lines The murine MoAb Lym-2 (muLym-2, IgG1), directed against a B-cell surface antigen,21 was obtained from Techniclone International, Inc (Tustin, CA). The human-mouse chimeric MoAb Lym1 (chLym-1, IgG1k) was generated as previously described.24 The chimeric MoAb CLL-1 (chCLL-1, IgG1k) was produced as previously described (Funakoshi et al, in preparation). The chimeric MoAb TNT-1 (chTNT-1, IgG1k), the cDNAs for whose variable regions were cloned from the murine TNT-1 hybridoma,25 was constructed and expressed in the same manner as chCLL-1. The murine Lym-2 antiidiotype MoAb (7E2) was generated as previously described for the antiidiotype to Lym-1 (1A7).24 Iodine-125 and iodine131-labeled MoAbs were prepared using a modified chloramine T method as previously described.24 The NS0 murine myeloma cell line, which was obtained from Celltech Biologics, was grown in nonselective medium consisting of Hybridoma-SFM supplemented with 10% fetal bovine serum, L-glutamine, MEM nonessential amino acids solution, penicillin G (100 U/mL), and streptomycin (100 mg/ mL). Selective medium consists of Hybridoma-SFM without glutamine supplemented with 10% dialyzed fetal bovine serum, glutamic acid, asparagine, nucleosides, penicillin G, and streptomycin, according to the protocol provided with the Glutamine Synthetase Gene Amplification System (Celltech Biologics). The ARH-77 human myeloma cell line,26 obtained from the American Type Culture Collection, was grown in RPMI-1640 medium supplemented with 10% fetal bovine serum, L-glutamine, penicillin G, and streptomycin. Construction of Expression Vectors The expression vectors were constructed using standard techniques. The expression vector for chCLL-1, 12/chCLL-1/HL, was used as the parent vector. This plasmid contains the cDNA sequences for the human-mouse chimeric CLL-1 heavy and light chains, each under the control of the cytomegalovirus (CMV) major immediate early promoter, and the cDNA sequence for glutamine synthetase, under the control of the SV40 early promoter. Two oligonucleotide primers, 5*- GGTAAAGCGGCCGCAGGAGGTGGTAGCGCACCCGCCCGCTCGCCCAGC - 3* and 5* - TCAATGCGGCCGCTCACTCCTGGACTGGCTCCCAGCA - 3*, were used to amplify by polymerase chain reaction (PCR) the human GM-CSF cDNA AID Blood 0001 / 5h37$$$$$1 from the pcD-hGM/Eo–CSF plasmid template. To amplify the human IL-2 cDNA from the pBC12/HIV/IL-2 plasmid template, two primers, 5* - GGTAAAGCGGCCGCAGGAGGTGGTAGCGCACCTACTTCAAGTTCTACA - 3* and 5* - TCATGCGGCCGCTCAAGTTAGTGTTGAGATGATGCT - 3*, were used. The PCR fragments were each inserted into the Not I site of 12/chCLL-1/HL, resulting in the expression vectors 12/chCLL-1/HL/GM-CSF and 12/chCLL-1/HL/IL-2, encoding the chimeric light chain and a fusion protein consisting of the chimeric CLL-1 heavy chain with human GM-CSF or human IL-2 at its C-terminus. Expression and Purification of Fusion Proteins The fusion proteins were expressed from NS0 murine myeloma cells according to the protocol of the manufacturer (Celltech Biologics). Briefly, linearized plasmids were electroporated into NS0 cells, which were plated in nonselective Hybridoma-SFM medium. Selective glutamine-free medium was added 24 hours later. When transfectants appeared approximately 3 weeks later, supernatants were tested for the presence of chimeric fusion protein by indirect enzyme-linked immunosorbent assay (ELISA). The highest-producing clones were identified by 24-hour rate of production assays. To maximize the yield of chCLL-1/GM-CSF, amplification of vector copy number was achieved by expanding the clone and incubating the cells in increasing concentrations of methionine sulfoximine, a specific inhibitor of glutamine synthetase. Three to 4 weeks later, viable clones were again assayed for rate of chimeric fusion protein production. After subcloning by limiting dilution, the highest-producing clones were expanded, incubated in 10 L bioreactors, and chCLL-1/GM-CSF and chCLL-1/IL-2 were purified stepwise from cell culture medium by protein A affinity chromatography and ionexchange chromatography, as described previously.24 The purity of each fusion protein was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in a reducing gel according to the method of Laemmli27 and by high performance liquid chromatography (HPLC). The samples were filtered through a 0.22 mm Nalgene disposable filter unit before injection. The fusion proteins were analyzed with a Beckman HPLC Gold System (Beckman Instruments, Fullerton, CA) equipped with two 110B solvent pumps, a 210A valve injector, a 166 programmable UV detector, and a 406 analog interface module. Size exclusion chromatography was performed on a G4000SW column (TosoHaas; Montgomeryville, PA) with 0.1 mol/L PBS, pH 7.2 as the solvent system, eluting at a flow rate of 1 mL/min. The UV absorbance of the HPLC eluate was detected at 280 nm. Immunoassays ELISA. Chimeric fusion protein-containing supernatants were initially identified by indirect ELISA using murine Lym-2 antiidiotype 7E2 MoAb, as described previously.24 For production rate assays, 106 cells were plated in 1 mL of selective medium and allowed to incubate for 24 hours. ELISA was then performed as before. Supernatants were serially diluted and applied to wells of microtiter plates coated with goat antihuman IgG (H/L) (CalTag, South San Francisco, CA). Dilutions of a control chimeric antibody were used to generate a standard curve using 4-parameter fit by an automated ELISA reader (Bio-Tek Instruments, Inc, Winooski, VT), from which concentrations of unknowns were estimated. Rates of production expressed as mg/mL/106 cells/24 hours were compared to identify the highest producing clones. ARH-77 cell competition radioimmunoassay. The antigen-binding activity of chCLL-1/GM-CSF and chCLL-1/IL-2 was determined by a competition radioimmunoassay for binding to fixed ARH-77 myeloma cells. For these studies, 2 1 106 ARH-77 cells previously 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. GM-CSF AND IL-2 ANTIBODY FUSION PROTEINS 4439 fixed in 2% paraformaldehyde28 were incubated with 20 ng of 125Ilabeled muLym-2 and serial dilutions of cold muLym-2, chCLL-1/ GM-CSF, chCLL-1/IL-2, or an irrelevant MoAb (chLym-1). The cells and MoAbs or fusion proteins were incubated for 1 hour at room temperature with constant mixing. The cells were then washed twice, and the cell pellet-associated radioactivity was measured in a gamma counter. Maximal binding was determined from tubes containing no cold antibodies. Determination of Avidity To determine the avidity constants of chCLL-1/GM-CSF and chCLL-1/IL-2, a fixed cell radioimmunoassay was performed using the method of Frankel and Gerhard.29 Each experimental variable was run in duplicate. ARH-77 myeloma cell suspensions containing 106 cells/mL were incubated with 10 to 110 ng of 125I-labeled chCLL1/GM-CSF or chCLL-1/IL-2 in 200 mL PBS for 1 hour at room temperature with constant mixing. The cells were then washed three times with PBS containing 1% bovine serum albumin to remove unbound antibody and counted in a gamma counter. The amount of fusion protein bound was then determined by the remaining cellbound radioactivity (cpm) in each tube and the specific activity (cpm/ ng) of the radiolabeled fusion protein. Scatchard plot analysis was used to obtain the slope. The equilibrium or avidity constant Ka was calculated by the equation K Å 0(slope/n), where n is the valence of the antibody (2 for IgG). Isolation of Bone Marrow Cells Bone marrow samples were obtained in preservative-free heparin from normal donors after receiving their informed consent (with the approval of UCLA Institutional Review Board). Cells were diluted with an equal volume of PBS containing 0.6% ACD-A (anticoagulant citrate dextrose solution, Formula A; Baxter-Fenwal Corp, Deerfield, IL) and mononuclear cells (MNC) were isolated by gradient centrifugation on Ficoll-Paque (Pharmacia LKB; Uppsala, Sweden) followed by two washes with PBS/ACD-A. CD34/ cells were purified from MNC using a CD34/ Progenitor Cell Isolation Kit (Miltenyi Biotec; Auburn, CA) without modification of the manufacturer’s instructions. Colony Assays Bone marrow MNC (7.5 1 104 cells/well) or CD34/ cells (1 1 104 cells/well) were plated in triplicate in 24-well plates in semisolid medium containing 0.3% bacto agar in Iscove’s Modified Dulbecco’s Medium, 20% fetal bovine serum (Atlanta Biological, Norcross, GA), 50 mg/mL gentamicin, 0.4 mmol/L L-glutamine. Colony assays were supplemented with either hu-GM-CSF (generously provided by Amgen; Thousand Oaks, CA), chCLL-1/GM-CSF, or chCLL-1. Cultures were maintained humidified at 377C in 5% CO2. Colonies containing more than 30 cells were enumerated after 14 to 16 days in culture. IL-2 Bioassay Biologic activity of chCLL-1/IL-2 was determined by a standard IL-2–dependent T-cell proliferation assay.30 Carrier-free recombinant IL-2 obtained from Hoffmann La Roche, Inc (Nutley, NJ) was used as a standard. Roche IL-2 stock (7.8 mg/mL, specific activity É12 1 106 IU/mg) was diluted to yield a stock solution containing 2 1 106 IU/mL. Growth of the IL-2–dependent murine T-cell line, CTLL-2, was used to determine the amount of IL-2 bioactivity in a sample. Briefly, serially diluted samples and standard were incubated with 2 1 104 CTLL-2 cells in triplicate for 20 hours at 377C in 96well flat bottom microtiter plates. The cells were then pulsed with 0.5 mCi of 3H-thymidine for 6 hours, and the samples were harvested and counted. Cytotoxicity Assays ADCC was performed using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega, Madison, WI), which is a colorimetric assay that quantitatively measures lactate dehydrogenase release.31 Effector cells were peripheral blood MNC or neutrophilic polymorphonuclear leukocytes (PMN). MNC were isolated from healthy human donors by Ficoll-Paque gradient centrifugation, and PMN were purified by centrifugation through a discontinuous percoll gradient (70% and 62%) followed by hypotonic lysis to remove residual erythrocytes as described previously.32 ARH-77 myeloma cells were used as target cells. ARH-77 cells were suspended in HybridomaSFM medium supplemented with 2% fetal bovine serum and plated in 96-well V-bottom microtiter plates at 2 1 104 cells/well. Antibody or fusion protein preparations (chCLL-1/GM-CSF, chCLL-1/IL-2, chCLL-1, muLym-2, or chTNT-1 as an isotype-matched irrelevant control) were added in triplicate to individual wells at 1 mg/mL, and effector cells were added at various effector:target cell ratios (12.5:1 to 50:1). The plates were incubated for 4 hours at 377C, after which the supernatants were harvested, lactate dehydrogenase release was determined, and % specific lysis was calculated according to the protocol of the manufacturer. Data are reported as mean { standard deviation (SD). Differences between groups were analyzed by unpaired Student’s t-test. Pharmacokinetic and Biodistribution Studies Six-week-old Balb/C mice were used to determine the pharmacokinetic clearance of chCLL-1, chCLL-1/GM-CSF and chCLL-1/IL2. Groups of mice (n Å 5) were administered intraperitoneal (IP) injections of 125I-labeled fusion proteins (30 to 40 mCi/mouse). The whole body activity at injection and at selected times thereafter was measured with a CRC-7 microdosimeter (Capintec, Inc, Pittsburgh, Fig 1. Schematic diagram depicting the linker containing the Not I cloning site between the human g1 and human GM-CSF or human IL-2 cDNAs in the chimeric CLL-1 heavy chain/cytokine fusion genes. AID Blood 0001 / 5h37$$$$$1 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 4440 HORNICK ET AL Fig 2. Electrophoretic identification of chCLL-1/cytokine fusion proteins. Coomassie Blue-stained 4% to 20% acrylamide gradient trisglycine reduced gel of purified chCLL-1 (lane 1), chCLL-1/GM-CSF (lane 2), and chCLL-1/IL-2 (lane 3). PA). The data were analyzed and half-lives were determined using the RSTRIP pharmacokinetic program (MicroMath, Inc, Salt Lake City, UT). To determine the tissue biodistribution of chCLL-1/GMCSF and chCLL-1/IL-2, 6-week-old female athymic nude mice were irradiated with 400 rads from a cesium source, 3 days after which they were injected with a 0.2 mL inoculum containing 4 1 107 ARH-77 cells and 4 1 106 human fetal lung fibroblast feeder cells subcutaneously (SC) in the left thigh. The tumors were grown for 3 weeks until they reached approximately 1 cm in diameter. Within each group (n Å 5), individual mice were injected intravenously (IV) with a 0.1 mL inoculum containing 100 mCi/10 mg of 125Ilabeled fusion protein. Animals were killed by sodium pentobarbital overdose at 72 hours postinjection, and various organs, blood, and tumors were removed and weighed. The radioactivity in the samples was then measured in a gamma counter. For each mouse, data were expressed as percent injected dose/gram (% ID/g) and tumor:organ ratio (cpm per gram tumor/cpm per gram organ). From these data, the mean and SD were calculated for each group. Fig 3. Competitive binding radioimmunoassay with chCLL-1/GMCSF and chCLL-1/IL-2. Purified antibody fusion proteins were assayed for their ability to inhibit the binding of 125I-labeled muLym-2 to ARH77 human myeloma cells. muLym-2 and chLym-1 served as positive and negative controls, respectively. PCR. A PCR fragment containing either the human GMCSF cDNA or the human IL-2 cDNA preceded by a seven amino acid linker peptide was then inserted into the Not I site, producing CLL-1 VH/human g1/human GM-CSF or CLL-1 VH/human g1/human IL-2 fusion genes (Fig 1). This resulted in the expression vectors 12/chCLL-1/HL/GM-CSF and 12/chCLL-1/HL/IL-2, encoding the chimeric light chain and a fusion protein consisting of the chimeric CLL-1 heavy chain with human GM-CSF or human IL-2 at its C-terminus. The fusion proteins were expressed from NS0 murine myeloma cells using the glutamine synthetase gene amplifica- Imaging Studies ARH-77 human myeloma tumors were grown in the left thighs of athymic nude mice as described above. When the tumors had reached approximately 1 cm in diameter, the mice were injected IV with a 0.1 mL inoculum containing 100 mCi/10 mg of 131I-labeled chCLL-1, chCLL-1/GM-CSF, or chCLL-1/IL-2. At 1, 3, and 5 days postinjection, the mice were anesthetized with a SC injection of 0.8 mg sodium pentobarbital. The immobilized mice were then imaged in a prone position with a Spectrum 91 camera equipped with a pinhole collimator (Raytheon Medical Systems, Melrose Park, IL) set to record 5,000 to 10,000 counts using the Nuclear MAX Plus image analysis software package (MEDX Inc, Wood Dale, IL). RESULTS Construction, Expression, and Purification of chCLL-1/GM-CSF and chCLL-1/IL-2 A Not I site was previously appended immediately downstream of the terminal codon of the human g1 sequence by AID Blood 0001 / 5h37$$$$$1 Fig 4. Colony-forming activity of chCLL-1/GM-CSF. Various concentrations of recombinant human GM-CSF, chCLL-1/GM-CSF, or chCLL-1 were cultured with 7.5 Ì 104 bone marrow MNC in triplicate in semisolid medium for 14 to 16 days at 377C until colonies containing more than 30 cells formed. 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. GM-CSF AND IL-2 ANTIBODY FUSION PROTEINS 4441 centrations of chCLL-1/GM-CSF, chCLL-1/IL-2, muLym2, or an irrelevant MoAb (chLym-1) were evaluated for their ability to inhibit the binding of 125I-labeled muLym-2 to ARH-77 cells (Fig 3). Because it binds to a nonoverlapping epitope, chLym-1 was unable to compete with 125I-labeled Fig 5. Biologic activity of chCLL-1/IL-2 as determined by the ability to support proliferation of CTLL-2 cells. Serial dilutions of chCLL-1/ IL-2, chCLL-1, or recombinant IL-2 standard were incubated with 2 Ì 104 CTLL-2 cells in triplicate for 20 hours at 377C. The cells were pulsed with 0.5 mCi of 3H-thymidine for 6 hours, and the samples were harvested and counted. tion system (Celltech Biologics). After subjection to vector amplification, the highest chCLL-1/GM-CSF–producing subclone secreted approximately 26 mg/mL/106 cells/24 hours in static culture. The highest chCLL-1/IL-2–producing subclone expressed approximately 16 mg/mL/106 cells/24 hours. Upon scale-up, greater than 100 mg/mL of chCLL-1/ GM-CSF were obtained after purification. When the chCLL1/IL-2–producing cell line was grown in a 10-L bioreactor, approximately 70 mg/mL of fusion protein were obtained. Both chimeric antibody fusion proteins were properly assembled as demonstrated by reducing SDS-PAGE; two welldefined bands were resolved for chCLL-1/GM-CSF at approximately 25 and 66 kD and for chCLL-1/IL-2 at approximately 25 and 65 kD, corresponding to the molecular weights of the immunoglobulin light chain and heavy chain plus cytokine (Fig 2). Both fusion proteins appeared as a single peak by HPLC analysis (data not shown). Immunobiochemical Analysis The immunoreactivity of purified chCLL-1/GM-CSF and chCLL-1/IL-2 with the target antigen of muLym-2 was assessed by determining the binding to antigen-bearing ARH77 myeloma cells. In a radioimmunoassay, increasing con- r Fig 6. ADCC activity of chCLL-1 and fusion proteins. MoAb or fusion protein (1 mg/mL) was cultured with ARH-77 human myeloma target cells and human mononuclear effector cells at varying effector:target cell ratios as indicated. (A) Comparison between ADCC mediated by muLym-2 and chCLL-1. (B) Comparison between ADCC mediated by chCLL-1 and chCLL-1/IL-2. (C) Comparison between ADCC mediated by chCLL-1 and chCLL-1/GM-CSF. Specific lysis with the isotype-matched negative control (chTNT-1) was Ú5% (data not shown). Expressed as mean Ô SD. At each effector:target cell ratio, the difference between pairs is significant (P Ú .001). AID Blood 0001 / 5h37$$$$$1 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 4442 HORNICK ET AL tion of the IL-2-dependent cell line compared with the recombinant IL-2 standard. This corresponds to a specific activity of approximately 8 1 105 IU/mg of fusion protein. At higher concentrations (eg, ú1 nmol/L), maximum proliferation was achieved as evidenced by the plateau of the incorporation of 3H-thymidine into DNA. As expected, chCLL-1 had no activity. Cytotoxicity Studies Fig 7. Whole body pharmacokinetic clearance of 125I-labeled chCLL-1, chCLL-1/GM-CSF, and chCLL-1/IL-2 in nontumor-bearing mice. Activity at injection and at selected times thereafter was measured with a microdosimeter. muLym-2, but chCLL-1/GM-CSF and chCLL-1/IL-2 inhibited 125I-labeled muLym-2 binding to ARH-77 cells. These studies confirm that chCLL-1/GM-CSF and chCLL-1/IL-2 maintain the immunoreactivity of muLym-2. Avidity binding studies were then conducted in which 125Ilabeled chCLL-1/GM-CSF or chCLL-1/IL-2 was incubated with ARH-77 cells and the bound radioactivity used to calculate the avidity constant Ka by Scatchard analysis as described in the Materials and Methods. chCLL-1/GM-CSF and chCLL-1/IL-2 had similar binding constants of 3.3 1 108 mol/L01 and 3.0 1 108 mol/L01, respectively. The binding constant of muLym-2 was determined to be 2.9 1 108 mol/ L01. These studies demonstrate that the presence of the cytokines on the C-terminus of the heavy chain does not affect binding to the antigenic target. Colony-Forming Activity of chCLL-1/GM-CSF Biologic activity of the GM-CSF moiety was determined by colony assays using both bone marrow MNC and CD34/ cells. As indicated in Fig 4, chCLL-1/GM-CSF compares favorably with recombinant human GM-CSF in its ability to stimulate colony formation from the MNC fraction of normal bone marrow. In addition, the fusion protein is capable of inducing the formation of colonies from isolated CD34/ progenitor cells (data not shown). No colonies formed in the presence of chCLL-1. IL-2 Bioactivity of chCLL-1/IL-2 Biologic activity of the IL-2 moiety was determined by assaying the ability of chCLL-1/IL-2 to support IL-2-dependent T-cell proliferation. A bioassay with the IL-2–dependent CTLL-2 line was performed in which chCLL-1/IL-2 was assayed along with chCLL-1 and the IL-2 standard (Fig 5). On a molar basis, chCLL-1/IL-2 had approximately 50% of the activity required to produce 50% maximum prolifera- AID Blood 0001 / 5h37$$$$$1 chCLL-1/GM-CSF, chCLL-1/IL-2, chCLL-1, and muLym2 were evaluated for their ability to mediate ADCC by colorimetric lactate dehydrogenase release assays against ARH77 myeloma target cells. At a concentration of 1 mg/mL, chCLL-1 mediated 65% cytotoxicity, while muLym-2 mediated only 10% specific lysis of tumor cells by human MNC at an effector:target cell ratio of 50:1 (Fig 6A). At the same effector:target cell ratio, both fusion proteins mediated approximately 100% specific lysis of target cells (Fig 6B and C). Similar enhancement of specific lysis mediated by both fusion proteins over chCLL-1 and by chCLL-1 over muLym2 can be seen at lower effector:target cell ratios. The isotypematched irrelevant control (chTNT-1) mediated õ5% specific lysis at all effector:target cell ratios (data not shown). Neither the fusion proteins nor antibodies mediated specific lysis of target cells by human PMN at an effector:target cell ratio of 50:1 (õ5%, data not shown). In Vivo Pharmacokinetic and Tumor Targeting Studies Whole body clearance studies were performed to establish differences in pharmacokinetics among chCLL-1/GM-CSF, chCLL-1/IL-2, and chCLL-1. Mice were injected with 125Ilabeled fusion proteins or chimeric antibody, and the whole body activity at injection and selected times thereafter was measured with a microdosimeter. chCLL-1/IL-2 cleared rapidly with a whole body half-life of 11 hours (Fig 7). chCLL1/GM-CSF had a half-life of approximately 30 hours, while chCLL-1 cleared slowly, with a half-life of 100 hours. The difference among clearance rates was evident when tumor and normal organ biodistribution was examined in ARH-77 myeloma-bearing nude mice. As indicated in Fig 8A, tumor uptake of chCLL-1 after 72 hours was 2.54% { 0.14% injected dose/gram, while tumor uptake of chCLL-1/ IL-2 and chCLL-1/GM-CSF was significantly lower (1.14 { 0.08 and 1.07 { 0.10, respectively; P õ .001). However, uptake of the fusion proteins in normal tissues was considerably lower than chCLL-1, which can be attributed to the rapid clearance of the fusion proteins. This low normal tissue uptake produces higher tumor/organ ratios, as can be seen in Fig 8B. Imaging studies were also performed to examine tumor targeting with the fusion proteins. Tumor-bearing nude mice were injected with 131I-labeled chimeric antibody or fusion protein and imaged at 1, 3, and 5 days postinjection. In Fig 9, the difference in clearance is manifested by the unambiguous localization of the fusion proteins to the tumor after 24 hours, while the mouse injected with chCLL-1 demonstrated high signal throughout the body at 1 and 3 days postinjection. 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. GM-CSF AND IL-2 ANTIBODY FUSION PROTEINS 4443 Fig 8. Tissue biodistribution and tumor uptake of chCLL-1, chCLL-1/GM-CSF, and chCLL-1/IL-2 at 72 hours postinjection in ARH-77 myeloma tumor-bearing nude mice. (A) Tumor uptake measured by percent injected dose/gram of 125I-labeled MoAb or fusion protein in the indicated tissues. (B) Tumor:organ ratios expressed as mean Ô SD. Nevertheless, by day 5, localization of chCLL-1 to the tumor site is clear. In mice that received chCLL-1/GM-CSF or chCLL-1/IL-2, by day 5 no signal remained except in the tumor. These data demonstrate that chCLL-1/GM-CSF and chCLL-1/IL-2 effectively localize to the ARH-77 human myeloma xenografts. DISCUSSION In this study, recombinant fusion proteins containing the chimeric MoAb CLL-1 and human GM-CSF or IL-2 have AID Blood 0001 / 5h37$$$$$1 been generated, which retain both tumor targeting and cytokine functions. The GS gene amplification system was used for high level expression of the fusion proteins from myeloma cells so that large-scale production can yield sufficient products to enable clinical studies to be undertaken. With this expression system, gram quantities of the fusion proteins can be produced in batch cultures. Biochemical analysis demonstrates the presence of two GM-CSF or IL-2 molecules per chimeric antibody molecule (Fig 2). GM-CSF or IL-2 is located at the C-terminus of the heavy chain follow- 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 4444 HORNICK ET AL Fig 9. Imaging of ARH-77 myeloma tumor-bearing nude mice injected with 131I-labeled chCLL1 (A), chCLL-1/GM-CSF (B), or chCLL-1/IL-2 (C). Mice were imaged in a prone position at the indicated times postinjection. ing a short linker peptide to facilitate proper folding of the cytokine. The immunoreactivity of the fusion proteins was retained, as evidenced by competition with 125I-labeled muLym-2 for binding to antigen-bearing ARH-77 myeloma cells (Fig 3). Moreover, the binding affinity of the AID Blood 0001 / 5h37$$$$$1 fusion proteins was unaffected by the presence of the cytokine molecules. In addition, the biological activity of the cytokines within the fusion proteins was confirmed by appropriate assays; chCLL-1/GM-CSF possesses colonyforming activity (Fig 4), while chCLL-1/IL-2 is able to 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. GM-CSF AND IL-2 ANTIBODY FUSION PROTEINS 4445 support the proliferation of an IL-2 – dependent T-cell line (Fig 5). Cytotoxicity studies clearly demonstrate the improved effector functions of chCLL-1 over muLym-2 and of both fusion proteins over chCLL-1 (Fig 6). Human IgG1 constant regions were selected for construction of the chimeric MoAb based on earlier observations of the enhanced antitumor cytotoxic activity of chimeric IgG1 over chimeric MoAbs of other isotypes.33 At each effector:target cell ratio, chCLL-1/ IL-2 mediates higher specific tumor lysis by human MNC than the chimeric MoAb alone (Fig 6B). This is in agreement with previous reports of augmented MNC ADCC either by free recombinant IL-24-7,9 or by a recombinant MoAb/IL-2 fusion protein.34,35 chCLL-1/GM-CSF also mediates higher specific tumor lysis by human MNC than chCLL-1 (Fig 6C). Ragnhammar et al36 have previously shown that short-term preincubation of MNC with GM-CSF enhances ADCC against colorectal carcinoma and lymphoma cell lines. Other investigators have observed no effect of GM-CSF on MNC ADCC against malignant B-cell lines.9 There is evidence that GM-CSF and IL-2 can act synergistically in vitro. In this regard, GM-CSF has been shown to augment the induction of lymphokine-activated killer (LAK) activity by IL-2 against a human Burkitt’s lymphoma cell line through monocytes.37 In addition, GM-CSF and IL-2 enhance ADCC against a colorectal carcinoma cell line,38 leading the investigators to suggest combination therapy consisting of low dose IL-2, GM-CSF, and MoAb. No specific lysis of target cells by PMN in ADCC mediated by chCLL-1 or chCLL-1/GM-CSF was observed in our studies. It has recently been demonstrated that antibodies recognizing HLA class II mediate lysis of malignant B-cell lines by PMN, while antibodies to other B-cell antigens fail to mediate such ADCC.32 In these studies, Lym-1 and 1D10, both of which recognize HLA class II related epitopes, did not mediate ADCC by PMN from healthy donors, although both MoAbs mediated ADCC with PMN from patients treated with granulocyte colony-stimulating factor. Similar results have been observed with Lym-1 in combination with GM-CSF.9 GM-CSF has also been shown to enhance PMN ADCC against solid tumor cell line targets, including neuroblastoma, melanoma, and colorectal carcinoma.36,39,40 It is as yet unclear why MoAbs directed against particular antigens on malignant B cells possess the ability to mediate PMN ADCC, while those with specificity for other B-cell antigens do not. Based on in vitro ADCC data and clinical experience with a murine MoAb, a clinical trial using the combination of the MoAb and GM-CSF for the treatment of metastatic colorectal carcinoma was initiated.41 In this study, complete remissions were achieved in some patients, providing clinical evidence for the benefit of combination therapy. In the current study, pharmacokinetic analysis in Balb/C mice demonstrated the marked difference in whole body clearance among chCLL-1 and the fusion proteins (Fig 7). We have recently shown that a fusion protein consisting of chLym-1 and IL-2 has a half-life of 11 hours,35 which is identical to that observed for chCLL-1/IL-2. chCLL-1/GMCSF has a whole body half-life intermediate between the AID Blood 0001 / 5h37$$$$$1 chimeric MoAb and the IL-2–containing fusion protein. The relatively longer half-life of a GM-CSF–containing antibody fusion protein compared with those containing other cytokines has previously been described for the antiganglioside MoAb ch14.18.42 It has yet to be demonstrated whether similar differences in clearance between chimeric MoAbs and cytokine-containing antibody fusion proteins exist in patients. Biodistribution and imaging studies in human myeloma-bearing nude mice illustrate the tumor targeting abilities of chCLL-1/IL-2 and chCLL-1/GM-CSF (Figs 8 and 9). Despite their rapid clearance profiles, they retain the capacity to localize to tumor xenografts effectively. In fact, such rapid clearance might be beneficial in clinical applications, wherein potentially injurious cytokine exposure to normal tissues would be minimized. This is particularly true for IL2, which induces a capillary leak syndrome when administered systemically in high doses.43-46 There is considerable evidence that high local concentrations of cytokines within tumors can stimulate antitumor immunity and rejection in animal models. The majority of such efforts have employed gene transfection to engineer tumor cell lines to secrete cytokines.10-17 Although these studies demonstrate the utility of delivering cytokines directly to tumors, they are presently impractical in the clinical setting. A more feasible approach to generating high local concentrations of cytokines within tumors is targeting cytokines via antibody fusion proteins.18,19 This approach combines the cytotoxicity that MoAbs can mediate against tumor targets with the host antitumor immune response, which is stimulated by high local concentrations of cytokines. Several groups have taken such an approach to delivering cytokines by engineering fusion proteins consisting of IL-2 and antibody fragments including F(ab*)19 and single-chain antibodies.47-49 Intact MoAbs may have greater effectiveness than fragments, however, because they can mediate ADCC. An alternative approach that also employs antibody-cytokine fusion proteins is engineering a cancer vaccine using idiotypecytokine fusion proteins including IL-2 and GM-CSF.50,51 In a murine B-cell lymphoma model, such fusion proteins have been shown to induce antitumor responses. The efficacy of antibody-targeted IL-2 has been elegantly demonstrated in both a SCID mouse human neuroblastoma model20,52 and a syngeneic murine melanoma model.53,54 In these studies, the effector cell population responsible for antitumor responses was identified as CD8/ T cells. As the fusion protein retained a therapeutic effect in natural killer (NK) cell-deficient mice, the investigators concluded that tumor eradication was not dependent on NK cells.55 Whether such a mechanism of antitumor cytotoxicity holds for other antibody-cytokine fusion proteins in the treatment of other malignancies remains to be determined. The chimeric antibody fusion proteins described in the current study have the potential for producing tumor killing by a number of mechanisms. The parent muLym-2 is reactive with a majority of human B-cell lymphomas, chronic lymphocytic leukemias, and multiple myeloma,21 suggesting that this MoAb and derivatives may be of use in treating a variety of B-cell malignancies. Both muLym-2 and chCLL- 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 4446 HORNICK ET AL 1 have a direct inhibitory effect on human lymphoma cell lines and can improve the survival of SCID mice injected with human lymphoma cells (Funakoshi et al, in preparation). Furthermore, both chCLL-1/GM-CSF and chCLL-1/ IL-2 mediate enhanced ADCC against a human myeloma cell line. Finally, the combination of GM-CSF and IL-2 targeted to the tumor site may be sufficient to bring about the induction of effective cytotoxic T-cell responses. As the antigen recognized by chCLL-1 is not present in animal lymphomas and hence a syngeneic model is unavailable in which to evaluate immune responses induced by chCLL-1/ GM-CSF and chCLL-1/IL-2, clinical trials will be undertaken to test the immunotherapeutic efficacy of these novel reagents against human B-cell malignancies. ACKNOWLEDGMENT The authors wish to thank Barbara H. Biela, Jahangir Sharifi, and Myra M. Mizokami for assistance with the animal studies. REFERENCES 1. Maloney DG, Liles TM, Czerwinski DK, Waldichuk C, Rosenberg J, Grillo-Lopez A, Levy R: Phase I clinical trial using escalating single-dose infusion of chimeric anti-CD20 monoclonal antibody (IDEC-C2B8) in patients with recurrent B-cell lymphoma. Blood 84:2457, 1994 2. Dillman RO: Antibodies as cytotoxic therapy. J Clin Oncol 12:1497, 1994 3. Wilder RB, DeNardo GL, DeNardo SJ: Radioimmunotherapy: Recent results and future directions. J Clin Oncol 14:1383, 1996 4. Bianchi AC, Heslop HE, Veys P, Macey M, Holland M, Prentice HG, Brenner MK: Enhancement of monoclonal antibody dependent cell mediated cytotoxicity by IL2 and GM-CSF. Br J Haematol 73:468, 1989 5. Vuist WMJ, Buitenen Fv, de Rie MA, Hekman A, Rümke P, Melief CJM: Potentiation by interleukin 2 of Burkitt’s lymphoma therapy with anti-pan B (anti-CD19) monoclonal antibodies in a mouse xenotransplantation model. Cancer Res 49:3783, 1989 6. Gill I, Agah R, Hu E, Mazumder A: Synergistic antitumor effects of interleukin 2 and the monoclonal Lym-1 against human Burkitt lymphoma cells in vitro and in vivo. Cancer Res 49:5377, 1989 7. Biddle WC, Pancook J, Goldrosen M, Han T, Foon KA, Vaickus L: Antibody-dependent, cell-mediated cytotoxicity by an anti-class II murine monoclonal antibody: Effects of recombinant interleukin 2 on human effector cell lysis of human B-cell tumors. Cancer Res 50:2991, 1990 8. Hooijberg E, Sein JJ, van den Berk PCM, Hart AAM, van der Valk MA, Kast WM, Melief CJM, Hekman A: Eradication of large human B cell tumors in nude mice with unconjugated CD20 monoclonal antibodies and interleukin 2. Cancer Res 55:2627, 1995 9. Ottonello L, Morone P, Dapino P, Dallegri F: Monoclonal Lym-1 antibody-dependent lysis of B-lymphoblastoid tumor targets by human complement and cytokine-exposed mononuclear and neutrophilic polymorphonuclear leukocytes. Blood 87:5171, 1996 10. Fearon ER, Pardoll DM, Itaya T, Golumbek P, Levitsky HI, Simons JW, Karasuyama H, Vogelstein B, Frost P: Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell 60:397, 1990 11. Tsai S-CJ, Gansbacher B, Tait L, Miller FR, Heppner GH: Induction of antitumor immunity by interleukin-2 gene-transduced mouse mammary tumor cells versus transduced mammary stromal fibroblasts. J Natl Cancer Inst 85:546, 1993 AID Blood 0001 / 5h37$$$$$1 12. Porgador A, Tzehoval E, Vadai E, Feldman M, Eisenbach L: Immunotherapy via gene therapy: Comparison of the effects of tumor cells transduced with the interleukin-2, interleukin-6, or interferong genes. J Immunother Emphasis Tumor Immunol 14:191, 1993 13. Cignetti A, Guarini A, Carbone A, Forni M, Cronin K, Forni G, Gansbacher B, Foa R: Transduction of the IL2 gene into human acute leukemia cells: Induction of tumor rejection without modifying cell proliferation and IL2 receptor expression. J Natl Cancer Inst 86:785, 1994 14. Visseren MJW, Koot M, van der Voort EIH, Gravestein LA, Schoenmakers HJ, Kast WM, Zijlstra M, Melief CJM: Production of interleukin-2 by EL4 tumor cells induces natural killer cell- and T-cell-mediated immunity. J Immunother 15:119, 1994 15. Katsanis E, Orchard PJ, Bausero MA, Gorden KB, McIvor RS, Blazar BR: Interleukin-2 gene transfer into murine neuroblastoma decreases tumorigenicity and enhances systemic immunity causing regression of preestablished retroperitoneal tumors. J Immunother 15:81, 1994 16. Allione A, Consalvo M, Nanni P, Lollini PL, Cavallo F, Giovarelli M, Forni M, Gulino A, Colombo MP, Dellabona P, Hock H, Blankenstein T, Rosenthal FM, Gansbacher B, Bosco MC, Musso T, Gusella L, Forni G: Immunizing and curative potential of replicating and nonreplicating murine mammary adenocarcinoma cells engineered with interleukin (IL)-2, IL-4, IL-7, IL-10, tumor necrosis factor a, granulocyte-macrophage colony-stimulating factor, and ginterferon gene or admixed with conventional adjuvants. Cancer Res 54:6022, 1994 17. Gunji Y, Tagawa M, Matsubara H, Takenaga K, Shimada H, Kondo F, Suzuki T, Nakajima K, Aoki T, Asano T, Ochiai T, Isono K, Kageyama H, Nakamura Y, Sakiyama S: Murine colon carcinoma cells engineered to produce human interleukin-2 induce tumor-specific anti-tumor response. Int J Cancer 66:135, 1996 18. Gillies SD, Reilly EB, Lo K-M, Reisfeld RA: Antibody-targeted interleukin 2 stimulates T-cell killing of autologous tumor cells. Proc Natl Acad Sci USA 89:1428, 1992 19. Fell HP, Gayle MA, Grosmaire L, Ledbetter JA: Genetic construction and characterization of a fusion protein consisting of a chimeric F(ab’) with specificity for carcinomas and human IL-2. J Immunol 146:2446, 1991 20. Sabzevari H, Gillies SD, Mueller BM, Pancook JD, Reisfeld RA: A recombinant antibody-interleukin 2 fusion protein suppresses growth of hepatic human neuroblastoma metastases in severe combined immunodeficiency mice. Proc Natl Acad Sci USA 91:9626, 1994 21. Epstein AL, Marder RJ, Winter JN, Stathopoulos E, Chen F-M, Parker JW, Taylor CR: Two new monoclonal antibodies, Lym1 and Lym-2, reactive with human B-lymphocytes and derived tumors, with immunodiagnostic and immunotherapeutic potential. Cancer Res 47:830, 1987 22. Lee F, Yokota T, Otsuka T, Gemmell L, Larson N, Luh J, Arai K, Rennick D: Isolation of cDNA for a human granulocytemacrophage colony-stimulating factor by functional expression in mammalian cells. Proc Natl Acad Sci USA 82:4360, 1985 23. Cullen BR: Trans-activation of human immunodeficiency virus occurs via a bimodal mechanism. Cell 46:973, 1986 24. Hu P, Glasky MS, Yun A, Alauddin MM, Hornick JL, Khawli LA, Epstein AL: A human-mouse chimeric Lym-1 monoclonal antibody with specificity for human lymphomas expressed in a baculovirus system. Hum Antibodies Hybridomas 6:57, 1995 25. Epstein AL, Chen F-M, Taylor CR: A novel method for the detection of necrotic lesions in human cancers. Cancer Res 48:5842, 1988 26. Burk KH, Drewinko B, Trujillo JM, Ahearn MJ: Establish- 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. GM-CSF AND IL-2 ANTIBODY FUSION PROTEINS 4447 ment of a human plasma cell line in vitro. Cancer Res 38:2508, 1978 27. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680, 1970 28. Epstein AL, Marder RJ, Winter JN, Fox RI: Two new monoclonal antibodies (LN-1, LN-2) reactive in B5 formalin-fixed, paraffin-embedded tissues with follicular center and mantle zone human B lymphocytes and derived tumors. J Immunol 133:1028, 1984 29. Frankel ME, Gerhard W: The rapid determination of binding constants for antiviral antibodies by a radioimmunoassay: An analysis of the interaction between hybridoma proteins and influenza virus. Mol Immunol 16:101, 1979 30. Anderson PM, Rogosheske JR, Ramsay NKC, Weisdorf DJ: Biological activity of recombinant interleukin-2 in intravenous admixtures containing antibiotic, morphine sulfate, or total parenteral nutrient solution. Am J Hosp Pharm 49:608, 1992 31. Korzeniewski C, Callewaert DM: An enzyme-release assay for natural cytotoxicity. J Immunol Methods 64:313, 1983 32. Elsässer D, Valerius T, Repp R, Weiner GJ, Deo Y, Kalden JR, van de Winkel JGJ, Stevenson GT, Glennie MJ, Gramatzki M: HLA class II as potential target antigen on malignant B cells for therapy with bispecific antibodies in combination with granulocyte colony-stimulating factor. Blood 87:3803, 1996 33. Steplewski Z, Sun LK, Shearman CW, Ghrayeb J, Daddona P, Koprowski H: Biological activity of human-mouse IgG1, IgG2, IgG3, and IgG4 chimeric monoclonal antibodies with antitumor specificity. Proc Natl Acad Sci USA 85:4852, 1988 34. Naramura M, Gillies SD, Mendelsohn J, Reisfeld RA, Mueller BM: Mechanisms of cellular cytotoxicity mediated by a recombinant antibody-IL2 fusion protein against human melanoma cells. Immunol Lett 39:91, 1994 35. Hu P, Hornick JL, Glasky MS, Yun A, Milkie MN, Khawli LA, Anderson PM, Epstein AL: A chimeric Lym-1/interleukin 2 fusion protein for increasing tumor vascular permeability and enhancing antibody uptake. Cancer Res 56:4998, 1996 36. Ragnhammar P, Frödin J-E, Trotta PP, Mellstedt H: Cytotoxicity of white blood cells activated by granulocyte-colony-stimulating factor, granulocyte/macrophage-colony-stimulating factor and macrophage-colony-stimulating factor against tumor cells in the presence of various monoclonal antibodies. Cancer Immunol Immunother 39:254, 1994 37. Singh SM, Sone S, Inamura N, Ogura T: Up-regulation by granulocyte-macrophage colony-stimulating factor (GM-CSF) of induction of lymphokine (IL-2)-activated killer (LAK) cells by human blood monocytes. Int J Cancer 44:170, 1989 38. Masucci G, Ragnhammar P, Wersäll P, Mellstedt H: Granulocyte-monocyte colony-stimulating-factor augments the interleukin2-induced cytotoxic activity of human lymphocytes in the absence and presence of mouse or chimeric monoclonal antibodies (mAb 17-1A). Cancer Immunol Immunother 31:231, 1990 39. Baldwin GC, Chung GY, Kaslander C, Esmail T, Reisfeld RA, Golde DW: Colony-stimulating factor enhancement of myeloid effector cell cytotoxicity towards neuroectodermal tumour cells. Br J Haematol 83:545, 1993 40. Kushner BH, Cheung N-KV: GM-CSF enhances 3F8 mono- AID Blood 0001 / 5h37$$$$$1 clonal antibody-dependent cellular cytotoxicity against human melanoma and neuroblastoma. Blood 73:1936, 1989 41. Ragnhammar P, Fagerberg J, Frödin J-E, Hjelm A-L, Lindemalm C, Magnusson I, Masucci G, Mellstedt H: Effect of monoclonal antibody 17-1A and GM-CSF in patients with advanced colorectal carcinoma—Long-lasting, complete remissions can be induced. Int J Cancer 53:751, 1993 42. Gillies SD, Young D, Lo K-M, Roberts S: Biological activity and in vivo clearance of antitumor antibody/cytokine fusion proteins. Bioconjug Chem 4:230, 1993 43. Rosenstein M, Ettinghausen SE, Rosenberg SA: Extravasation of intravascular fluid mediated by the systemic administration of recombinant interleukin-2. Immunology 137:1735, 1986 44. Damle NK, Doyle LV: IL-2 activated human killer lymphocytes but not their secreted products mediate increase in albumin flux across cultured endothelial monolayers. J Immunol 142:2660, 1989 45. Ohkubo C, Bigos D, Jain RK: Interleukin 2-induced leukocyte adhesion to the normal and tumor microvasculature endothelium in vivo and its inhibition by dextran sulfate: Implications for vascular leak syndrome. Cancer Res 51:1561, 1991 46. Edwards MJ, Miller FN, Sims DE, Abney DL, Schuschke DA, Corey TS: Interleukin 2 acutely induces platelet and neutrophilendothelial adherence and macromolecular leakage. Cancer Res 52:3425, 1992 47. Savage P, So A, Spooner RA, Epenetos AA: A recombinant single chain antibody interleukin-2 fusion protein. Br J Cancer 67:304, 1993 48. Xiang J, Liu E, Moyana T, Qi Y: Single-chain antibody variable region-targeted interleukin-2 stimulates T cell killing of human colorectal carcinoma cells. Immunol Cell Biol 72:275, 1994 49. Bei R, Schlom J, Kashmiri SVS: Baculovirus expression of a functional single-chain immunoglobulin and its IL-2 fusion protein. J Immunol Methods 186:245, 1995 50. Tao M-H, Levy R: Idiotype/granulocyte-macrophage colonystimulating factor fusion protein as a vaccine for B-cell lymphoma. Nature 362:755, 1993 51. Chen TT, Tao M-H, Levy R: Idiotype-cytokine fusion proteins as cancer vaccines: Relative efficacy of IL-2, IL-4, and granulocyte-macrophage colony-stimulating factor. J Immunol 153:4775, 1994 52. Pancook JD, Becker JC, Gillies SD, Reisfeld RA: Eradication of established hepatic human neuroblastoma metastases in mice with severe combined immunodeficiency by antibody-targeted interleukin-2. Cancer Immunol Immunother 42:88, 1996 53. Becker JC, Varki N, Gillies SD, Furukawa K, Reisfeld RA: An antibody-interleukin 2 fusion protein overcomes tumor heterogeneity by induction of a cellular immune response. Proc Natl Acad Sci USA 93:7826, 1996 54. Becker JC, Varki N, Gillies SD, Furukawa K, Reisfeld RA: Long-lived and transferable tumor immunity in mice following targeted interleukin 2 therapy. J Clin Invest 98:2801, 1996 55. Becker JC, Pancook JD, Gillies SD, Furukawa K, Reisfeld RA: T cell-mediated eradication of murine metastatic melanoma induced by targeted interleukin 2 therapy. J Exp Med 183:2361, 1996 05-15-97 16:52:54 bldas WBS: Blood From www.bloodjournal.org by guest on August 3, 2017. For personal use only. 1997 89: 4437-4447 Chimeric CLL-1 Antibody Fusion Proteins Containing Granulocyte-Macrophage Colony-Stimulating Factor or Interleukin-2 With Specificity for B-Cell Malignancies Exhibit Enhanced Effector Functions While Retaining Tumor Targeting Properties Jason L. Hornick, Leslie A. Khawli, Peisheng Hu, Maureen Lynch, Peter M. Anderson and Alan L. Epstein Updated information and services can be found at: http://www.bloodjournal.org/content/89/12/4437.full.html Articles on similar topics can be found in the following Blood collections Immunobiology and Immunotherapy (5498 articles) Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.