Download DNA Scavenger Hunt

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA sequencing wikipedia , lookup

Eukaryotic DNA replication wikipedia , lookup

Telomere wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

DNA repair wikipedia , lookup

DNA repair protein XRCC4 wikipedia , lookup

DNA profiling wikipedia , lookup

Helicase wikipedia , lookup

Homologous recombination wikipedia , lookup

Microsatellite wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

DNA polymerase wikipedia , lookup

DNA replication wikipedia , lookup

DNA nanotechnology wikipedia , lookup

Helitron (biology) wikipedia , lookup

Replisome wikipedia , lookup

Transcript
DNA Scavenger Hunt Revisited
You have already translated the DNA strands. Now you will look at mutations
in the DNA strands and identify what has happened and how the strands have
changed.
Original DNA Strand 1 = GCGGACAAG (6 points)
Mutated DNA Strand 1 = GGGACAAG
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________
Original DNA Strand 2 = TATGGGGAGAAT (7 points)
Mutated DNA Strand 2 = TATGCGGAGAAT
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________
Original DNA Strand 3 = TGCGGAGACAAA (7 points)
Mutated DNA Strand 3 = TGCGGAACAAA
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________
Original DNA Strand 4 = TACGGGTTCTGTTTAGTTGAT (10 points)
Mutated DNA Strand 4 = TACGGGTTGTGTTTAGTTGAT
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________