* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA Scavenger Hunt
DNA sequencing wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA profiling wikipedia , lookup
Homologous recombination wikipedia , lookup
Microsatellite wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA replication wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA Scavenger Hunt Revisited You have already translated the DNA strands. Now you will look at mutations in the DNA strands and identify what has happened and how the strands have changed. Original DNA Strand 1 = GCGGACAAG (6 points) Mutated DNA Strand 1 = GGGACAAG How is the mutated strand different from the original strand? _________________ ______________________________________________________________________________ What type of mutation is this? _______________________________________________ What is the mutated secret word? ____________________________________________ Look at the bottom of the sheet to tell what the mutated amino acids would be: ______________________________________________________________________________ ______________________________________________________________________________ Original DNA Strand 2 = TATGGGGAGAAT (7 points) Mutated DNA Strand 2 = TATGCGGAGAAT How is the mutated strand different from the original strand? _________________ ______________________________________________________________________________ What type of mutation is this? _______________________________________________ What is the mutated secret word? ____________________________________________ Look at the bottom of the sheet to tell what the mutated amino acids would be: ______________________________________________________________________________ ______________________________________________________________________________ Original DNA Strand 3 = TGCGGAGACAAA (7 points) Mutated DNA Strand 3 = TGCGGAACAAA How is the mutated strand different from the original strand? _________________ ______________________________________________________________________________ What type of mutation is this? _______________________________________________ What is the mutated secret word? ____________________________________________ Look at the bottom of the sheet to tell what the mutated amino acids would be: ______________________________________________________________________________ ______________________________________________________________________________ Original DNA Strand 4 = TACGGGTTCTGTTTAGTTGAT (10 points) Mutated DNA Strand 4 = TACGGGTTGTGTTTAGTTGAT How is the mutated strand different from the original strand? _________________ ______________________________________________________________________________ What type of mutation is this? _______________________________________________ What is the mutated secret word? ____________________________________________ Look at the bottom of the sheet to tell what the mutated amino acids would be: ______________________________________________________________________________ ______________________________________________________________________________