Download DNA Scavenger Hunt

DNA Scavenger Hunt Revisited
You have already translated the DNA strands. Now you will look at mutations
in the DNA strands and identify what has happened and how the strands have
changed.
Original DNA Strand 1 = GCGGACAAG (6 points)
Mutated DNA Strand 1 = GGGACAAG
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________
Original DNA Strand 2 = TATGGGGAGAAT (7 points)
Mutated DNA Strand 2 = TATGCGGAGAAT
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________
Original DNA Strand 3 = TGCGGAGACAAA (7 points)
Mutated DNA Strand 3 = TGCGGAACAAA
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________
Original DNA Strand 4 = TACGGGTTCTGTTTAGTTGAT (10 points)
Mutated DNA Strand 4 = TACGGGTTGTGTTTAGTTGAT
How is the mutated strand different from the original strand? _________________
______________________________________________________________________________
What type of mutation is this? _______________________________________________
What is the mutated secret word? ____________________________________________
Look at the bottom of the sheet to tell what the mutated amino acids would be:
______________________________________________________________________________
______________________________________________________________________________