Download The Use of Multiple Transcription Starts Causes the Dual Targeting

Plant Cell Physiol. 43(7): 697–705 (2002)
JSPP © 2002
The Use of Multiple Transcription Starts Causes the Dual Targeting of
Arabidopsis Putative Monodehydroascorbate Reductase to Both
Mitochondria and Chloroplasts
Keisuke Obara 1, 3, Kazuyoshi Sumi 1 and Hiroo Fukuda 1, 2
1
2
Department of Biological Sciences, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-0033 Japan
Plant Science Center, RIKEN, 1-7-22 Suehiro, Tsurumi-ku, Yokohama, Kanagawa, 230-0045 Japan
;
region. Because mitochondria and chloroplasts share some
overlapping functions, such as DNA replication, transcription,
translation and protection from oxidative stress (Small et al.
1998), some enzymes are present in both organelles. Although
it is generally accepted that one gene encodes one isozyme,
there are some exceptions in which a single gene encodes multiple isoforms that carry out the same function in different
organelles. Several tRNA synthetases, biosynthetic proteins
and oxidoreductases coded by a single gene are dual-targeted to
both mitochondria and chloroplasts (reviewed in Small et al.
1998, Peeters and Small 2001). These examples help us understand the mechanism of protein transport to mitochondria and
chloroplasts, but the precise mechanism is still not fully understood. To further elucidate this mechanism, we used the transport mechanism of the protein involved in the antioxidant system as a model because some of the antioxidant molecules are
present in both organelles, where they work to remove excess
reactive oxygen species (ROS).
During respiratory and photosynthetic electron transport,
copious quantities of ROS are produced at very high rates, even
under optimal conditions (Noctor and Foyer 1998). Recent
studies indicated that plants utilize ROS, especially H2O2, as
signal molecules in cases such as ABA signaling (Pei et al.
2000, Murata et al. 2001), and responses to cellular and environmental stress (Prasad et al. 1994, Wagner 1995). ROS are
also used as a weapon against invading pathogens in the oxidative burst (Lamb and Dixon 1997, Somssich and Hahlbrock
1998). However, it is generally thought that ROS are toxic to
the cell because of their ability to cause damage to proteins,
lipids and DNA. Therefore, ROS production and removal must
be strictly controlled. One efficient way to avoid the damage
caused by excess accumulation of ROS is to remove them with
antioxidant molecules. Ascorbate is a major primary antioxidant (Nijs and Kelley 1991) and is ubiquitous in animals
and plants. Ascorbate is also involved in the plant antioxidant
system as an electron donor for ascorbate peroxidase that
scavenges H2O2 and produces H2O. Oxidation of ascorbate in
this process generates the monodehydroascorbate radical. The
monodehydroascorbate radical is then in turn reduced by
Monodehydroascorbate reductase (MDAR) isoforms
exist in mitochondria, chloroplasts, cytosol and microbodies. Two putative MDAR sequences with an extended Nterminal region are found in Arabidopsis. They differ in the
length of the extension by 21 bp. We have shown that these
two isoforms arise from a single gene by the use of multiple
transcription starts. Green fluorescent protein was fused to
each extension, revealing that the longer and shorter fusion
proteins were imported into mitochondria and chloroplasts, respectively. These results demonstrate that putative MDAR is a dual-targeting protein transported into
both mitochondria and chloroplasts. Although there have
been several reports of dual targeting of proteins to mitochondria and chloroplasts, this is the first example in which
the dual targeting of the protein to mitochondria and chloroplasts is achieved by the use of multiple transcription initiation sites.
Keywords: Arabidopsis — Chloroplast — Dual targeting —
Mitochondria — Monodehydroascorbate reductase — Multiple transcription initiation sites.
Abbreviations: GFP, green fluorescent protein; MDAR, monodehydroascorbate reductase; PMDAR-L, putative monodehydroascorbate reductase-long; PMDAR-S, putative monodehydroascorbate
reductase-short; ROS, reactive oxygen species; 5¢-UTR, 5¢-untranslated region.
Introduction
Plants acquired chloroplasts in addition to mitochondria
by endosymbiosis. Following the endosymbiosis, many of the
genes of the endosymbionts were transferred to the nucleus,
and therefore most mitochondrial and chloroplast proteins are
encoded by nuclear genes and are synthesized in the cytosol.
These proteins are usually translated as precursor proteins that
have mitochondrial or chloroplast targeting sequences (presequence and transit peptide, respectively) at the N-terminal
3
Corresponding author: E-mail, [email protected]; Fax, +81-3-5841-4462.
697
698
Dual targeting of Arabidopsis putative MDAR
Fig. 1 Alignment of the deduced amino acid sequences of Arabidopsis MDAR-like sequences. Amino acid residues conserved in all sequences
were highlighted. Gray boxes indicate conserved residues in more than four sequences. Note that only D84417 and NP_564818 have an N-terminal
extension.
monodehydroascorbate reductase (MDAR) using NAD(P)H as
the electron donor to become ascorbate (Hossain et al. 1984).
Therefore, MDAR plays an important role in the plant antioxidant system through its ability to regenerate ascorbate to
maintain the ascorbate pool in the cell. Recently, MDAR was
shown to be also capable of reducing phenoxyl radicals to their
respective parental phenols (Sakihama et al. 2000), which are
also thought to be potent antioxidants (Rice-Evans et al. 1997).
In plants, isoforms of MDAR exist in chloroplasts, mitochondria, microbodies and in the cytosol, and cDNA of MDAR
has been cloned from cucumber (Sano and Asada 1994), garden pea (Murthy and Zilinskas 1994), tomato (Grantz et al.
1995), rice (Accession No. D85764), Arabidopsis (Accession
No. D84417) and leaf mustard (Accession No. AF109695).
Because mitochondria and chloroplasts are major sources of
ROS in the cell, MDAR activity in these organelles might be
essential for cell function (Puntarulo et al. 1991, Asada 1999,
Møller 2001). Our preliminary search of the Arabidopsis
genome and cDNA databases indicated the presence of two
MDAR-like sequences that possess putative mitochondrial/
chloroplast targeting sequences. Interestingly, the longer one
contained the entire sequence of the shorter one. Therefore, we
tried to elucidate the targeting compartment of the two MDARlike proteins and the mechanism by which the two sequences
are made. Our results demonstrate that alternative transcription
of a single gene generates two different proteins, of which one
is transported into mitochondria and the other into chloroplasts.
Results
A single putative MDAR gene generates two mRNAs
A search of the Arabidopsis thaliana genome and cDNA
databases revealed the presence of at least seven MDAR-like
sequences. There were eight hits in Arabidopsis, but the two of
them, D84417 and AAG52455, overlapped and contained a one
base mismatch, which may have been caused by polymorphism or misreading of the sequence. Therefore, the two
sequences were represented by D84417 in this paper. Fig. 1
shows their deduced amino acid sequences, of which two
(D84417 and NP_564818) had an extended region at the Nterminus. The results of several computer programs predicting
protein localization or signal sequences suggested that the two
putative MDARs with the extended N-terminal region were targeted to two organelles at high frequency; the longer one to
mitochondria and the shorter one to chloroplasts. The others
were not predicted to be targeted to either mitochondria or
chloroplasts. Interestingly, the Arabidopsis genome database
indicated that the two putative MDARs arise from the same
ORF on chromosome 1. Taken together, it is suggested that one
putative MDAR gene generates two mRNAs that differ in
length by 21 b and that their products are targeted to different
organelles. We designated the longer one as PMDAR-L (putative monodehydroascorbate reductase – long) and the shorter
one as PMDAR-S (putative monodehydroascorbate reductase –
short). There was no difference between the PMDAR-L and
PMDAR-S sequences except that PMDAR-L had the extended
seven amino acid residues from the first Met of PMDAR-S
Dual targeting of Arabidopsis putative MDAR
699
Fig. 2 RT-PCR experiments showing the existence of two mRNAs originating from a PMDAR gene. (A) Genome sequence of the 5¢ region corresponding to PMDAR-L and PMDAR-S mRNAs. Protein-coding sequences are underlined and their corresponding amino acid sequences are
described below them. Start codons, ATGs, are boxed. An intron (gray letters) ranging approximately 90 bp exists between the two start codons,
and conserved consensus sequences of the initiation and termination of intron, GT and AG, are dotted. Hooked arrows represent the forward primers used in the RT-PCR analysis. The reverse primer was designed from the stop codon of PMDAR (see B). Note that primers S-2 to S-6 were
designed within the first intron of PMDAR-L, so that they can amplify only PMDAR-S specifically. In contrast, the primer S-1 can amplify the
fragment from both PMDAR-L and PMDAR-S. (B) The primer sequences used. (C) PCR amplification of PMDAR-L and PMDAR-S cDNA. Onefiftieth of the PCR products were run on a 1% agarose gel and stained with ethidium bromide. The primer sets used are shown above each lane.
The positions of 1700 bp and 1159 bp are given on the left. Lane 1, l DNA digested with PstI was used as a molecular marker. Lanes 2–4, PCR
products amplified with the forward primers designed at 5¢-UTR of PMDAR-L and the reverse primer. Lane 5, PCR products amplified with the
forward primer S-1 and the reverse primer. Lanes 6–10, PCR products amplified with the primer sets that are specific to PMDAR-S. (D) The Nterminal sequence of the fragments L-1 and S-6 obtained by RT-PCR with the forward primers L-1 and S-6, respectively. Translation start codons
were boxed. The protein coding region was underlined. Note that the fragment S-6 contained a part of the intron sequence of fragment L-1 (gray
letters) at its 5¢-UTR. This region was spliced out in the fragment L-1.
(data not shown). To elucidate how a single PMDAR gene can
generate two mRNAs, we first analyzed the genomic structure
of the gene. Fig. 2A shows the genome sequence of the 5¢
region of the gene. The extended region of the PMDAR-L
sequence contained an intron ranging approximately 90 bp.
This intron had conserved consensus sequences, GT and AG,
which are usually seen at the initiation and termination sites of
the intron, respectively. The start codon, ATG, for the PMDARS sequence lies in the second exon of the PMDAR-L. Although
the two start codons for PMDAR-L and PMDAR-S sequences
are in-frame even through the intron, there are two stop codons,
in this frame, in the intron. Next, to examine the existence of
two mRNAs corresponding to PMDAR-L and PMDAR-S, RTPCR was performed with the oligonucleotides shown in Fig.
2B as forward primers and cDNA copied from Poly(A)+ RNA
as a template. Each of the primers used amplified a single band
of the expected size (Fig. 2C), of which the two fragments
amplified with L-1-Reverse and S-6-Reverse set (hereafter
referred to as fragment L-1 and S-6, respectively) were cloned
and sequenced. As predicted, the fragment L-1 had a sequence
700
Dual targeting of Arabidopsis putative MDAR
Fig. 3 Determination of two transcription initiation sites of the Arabidopsis PMDAR. (A) The positions of primers designed to amplify the fragments containing the transcription initiation site of PMDAR-L and PMDAR-S. The first PCR was performed with the primer sets of 1RC (see B)
and R-1. For the nested-PCR, 2RC primer (see B) was used as a forward primer, and R-2 or R-3 as reverse primers. (B) The primer sequences
used to determine the transcription starts. 1RC and 2RC are the forward primers designed at the oligonucleotides that were copied from oligoribonucleotides artificially attached to replace the 5¢ cap structure (see Materials and Methods). (C) The amplified products were run on a 4% GTG
Nusieve Agarose gel and stained with ethidium bromide. The primer sets used are shown above each lane. The positions of 500 bp and 100 bp are
given at left. Lane 1, a molecular marker of 100-bp ladder. Lane 2, the first PCR product. Lanes 3–7, nested PCR products amplified with primer
sets, 2RC/R-2, 2RC/R-3, only 2RC, only R-2, and only R-3, respectively. In Lane 2, no band was detected. In Lanes 3 and 4, several bands were
detected. Of these bands, those that were not amplified in negative control experiments (Lanes 5–7) are indicated by arrowheads. The fragments
corresponding to these two bands were cloned and sequenced. Note that R-3 primer was designed inside the first intron of PMDAR-L so that the
fragment specific to PMDAR-S was expected to be amplified. (D) Transcription starts for PMDAR-L and PMDAR-S (TS-L and TS-S, respectively) shown by arrowheads. A putative TATA box (double underline) was found upstream of TS-S. Start codons, ATGs, are boxed. The gray
sequence indicates the first intron of PMDAR-L, and the donor and acceptor site of the intron are dotted. Protein coding regions are underlined
and the amino acid residues corresponding to each triplet are shown below. Note that TS-S lies inside the first intron of PMDAR-L. (E) Schematic
representation of how the two isoforms are produced from a single PMDAR gene.
in which the region between the GT and AG was spliced out,
and the fragment S-6 contained, in its 5¢-untranslated region
(5¢-UTR), a part of the spliced-out sequence in the fragment L1 (Fig. 2D). It was confirmed that these PCR products had not
been originated from contaminated genomic DNAs because
they did not contain intron sequences that they have within
their genomic sequences (16 introns for PMDAR-L and 15
introns for PMDAR-S). Therefore, we concluded that two
mRNAs encoding PMDAR-L (481 a.a. from 17 exons) and
PMDAR-S (474 a.a. from 16 exons) are produced in vivo.
We then determined the transcription initiation site for
PMDAR-L and PMDAR-S using the cap site hunting method
(Maruyama and Sugano 1994). Fragments containing each
transcription start were amplified from cap site cDNA by
Dual targeting of Arabidopsis putative MDAR
701
Fig. 4 Transport of green fluorescent proteins (GFPs) fused to the N-terminal extension of PMDAR-L and PMDAR-S. (A) Schematic representation of the fusion proteins. The linker sequence, a three-times repetition of GlyGlyGlySer, was designed between the N-terminal extension and
GFP. These constructs and a control construct (35S-GFP-nosT) were introduced into Arabidopsis epidermal and vascular bundle sheath cells by
particle bombardment. (B–F) Fluorescence images of cells having GFP proteins. (B) A cell transformed by the control construct (35S-GFP-nosT),
showing green fluorescence in the nucleus and cytoplasm. An arrowhead indicates a gold particle shot into the nucleus. (C) A cell with Signal-LGFP showing green fluorescence in mitochondria. (D) A cell with Signal-S-GFP showing green fluorescence in chloroplasts. (E) Autofluorescence of chloroplasts. (F) A merged image of E and F. Note that the fluorescence of GFP overlapped with that of chloroplasts. The bar indicates
20 mm.
nested-PCR with primer sets listed in Fig. 3B. The first PCR
was performed with the primer set of R-1 and 1RC that was
designed inside the oligonucleotides copied from oligoribonucleotides that were artificially fused to replace the 5¢ cap structure. The PCR product was subjected to nested-PCR with R-2
and 2RC that was also designed inside the oligonucleotides.
Although this primer set was expected to amplify two fragments that contained the transcription start of PMDAR-L and
PMDAR-S, only a specific fragment that was not seen in the
negative control experiment was amplified (Fig. 3C, compare
Lanes 3 and 5). Cloning and sequencing of this fragment
revealed the transcription start of PMDAR-L. The fragment
with the transcription start of PMDAR-S was not amplified
with this primer set, probably because of competition for R-2
between PMDAR-L and PMDAR-S cDNA. Therefore, to
amplify the fragment with the transcription start of PMDAR-S
specifically, we designed the reverse primer (R-3) inside the
first intron of the PMDAR-L. This primer amplified a fragment
containing the transcription start of PMDAR-S (Fig. 3C, Lane
4). Cloning and sequencing of this fragment revealed that the
transcription initiation site of PMDAR-S lies inside the first
intron of PMDAR-L, further confirming the existence of the
multiple transcripts. In conclusion, two PMDAR mRNAs are
produced from a single gene by alternative transcription (Fig.
3E).
The N-terminal extension of PMDAR-L and PMDAR-S proteins
can transport green fluorescent protein into mitochondria and
chloroplast, respectively
Next, we examined the subcellular localization of the
PMDAR-L and PMDAR-S proteins. We constructed fusion
proteins (Fig. 4A) in which the extended N-terminal regions of
PMDAR-L and PMDAR-S (Signal-L and Signal-S, respectively) were fused to the green fluorescent protein (GFP)
sequence. Constructs for the GFP fusion proteins were introduced into Arabidopsis leaves, and the fluorescence was
observed (Fig. 4B–F). Cells expressing Signal-L-GFP exhibited green fluorescence from many small moving compartments (Fig. 4C). The shape and number of the compartments
was characteristic of mitochondria. We have confirmed that a
702
Dual targeting of Arabidopsis putative MDAR
Fig. 5 A structure of Signal-L. (A) An amino acid sequence of Signal-L. Basic amino acid residues are colored red. Non-polar and polar
residues are in green and blue, respectively. The putative mitochondrial presequence cleavage site and a relatively conserved motif are
dotted and underlined, respectively. (B) Helical wheel representation
of amino acid residues 1–8 of Signal-L. Hydrophobic residues are
clustered on one face of the helix whereas basic and polar residues are
on the other face.
similar fluorescence pattern was obtained by MitoTracker
Orange (a mitochondrial-staining dye) staining (data not
shown). No green fluorescence was detected from chloroplasts
in these cells, suggesting that Signal-L is not an ambiguous targeting sequence that can direct the proteins to both mitochondria and chloroplasts, as is often seen (Creissen et al. 1995,
Chow et al. 1997, reviewed in Peeters and Small 2001). On the
other hand, green fluorescence of Signal-S-GFP was detected
from chloroplasts (Fig. 4D). This result was confirmed by
merging the red autofluorescence of chloroplasts (Fig. 4E, F).
Cells in which a control construct, 35S-GFP, was introduced,
exhibited green fluorescence from the nucleus and cytoplasm
(Fig. 4B). These results strongly suggest that two PMDAR isoforms produced by alternative transcription are targeted to different organelles: PMDAR-L to mitochondria and PMDAR-S
to chloroplasts. It is also suggested that the first 50 or 43 amino
acid residues are sufficient to target this protein to the mitochondria or to the chloroplasts, respectively.
Discussion
The use of multiple transcription starts causes dual targeting of
PMDAR proteins to both mitochondria and chloroplasts
Our results show that PMDAR is a dual-targeted protein
to mitochondria and chloroplasts, which results from the use of
multiple transcription starts. Although most proteins playing
the same role in different compartments are encoded by different
genes, many exceptions have been reported in all of the eukaryotic systems that have been thoroughly investigated (reviewed
in Danpure 1995, Small et al. 1998). These exceptions include
the examples of dual targeting of proteins to mitochondria and
chloroplasts. A glutathione reductase of pea was reported to be
targeted to mitochondria and chloroplasts (Creissen et al.
1995). An Arabidopsis ferrochelatase-I is another example of a
protein shown to be imported into both mitochondria and
chloroplasts, although this was demonstrated in vitro (Chow et
al. 1997). Dual targeting of these proteins is achieved by an
ambiguous targeting signal that can be used for targeting both
mitochondria and chloroplasts. A spinach protoporphyrinogen
oxidase II (Che et al. 2000) was also imported into both
mitochondria and chloroplasts (Watanabe et al. 2001). A single
mRNA of this enzyme generated two isoforms that differed in
length by alternative use of translation initiation codons. These
are examples of dual targeting of proteins that arise from a single mRNA. We have shown in this research that at least two
mRNAs were generated from a single PMDAR gene by alternative transcription. Therefore, the mechanism of dual targeting
of Arabidopsis PMDAR is clearly different from that of the
examples enumerated above in that it is regulated, in the case
of PMDAR, at the transcriptional level rather than at the translational or post-translational level. The use of multiple transcription initiation sites itself is seen in many genes (reviewed
in Danpure 1995). In plants, several genes with multiple ATG
at the N terminal region have been reported to use multiple
transcription starts (Cheng et al. 1994, Lumbreras et al. 1995,
Cunillera et al. 1997, Luo et al. 1997). However, in every case,
the relationship between the multiple transcripts and the localization of their products has not been demonstrated clearly.
Moreover, none of these is an example of dual targeting of the
proteins to mitochondria and chloroplasts. Therefore, to our
knowledge, this is the first example of dual targeting to mitochondria and chloroplast that is achieved by the use of multiple transcription starts of a single gene.
In Arabidopsis, there was no sequence that is similar to
known MDAR other than the seven sequences listed in Fig. 1.
Of the seven sequences, the only two sequences, PMDAR-L
and PMDAR-S, had the extended N-terminal region and were
predicted to be targeted to mitochondria or chloroplasts.
Indeed, Signal-L and Signal-S could transport the fused GFP
into mitochondria and chloroplasts, respectively (Fig. 4). All
the other sequences were expected by the several computer predictions to localize in compartments other than mitochondria
and chloroplasts. Therefore, it is strongly suggested that
PMDAR-L and PMDAR-S proteins are responsible for the
MDAR activities existing in mitochondria and chloroplasts,
respectively. However, further analysis will be needed to verify this.
PMDAR-S cDNAs were more amplified in the RT-PCR
experiment than PMDAR-L. However, this RT-PCR was not
Dual targeting of Arabidopsis putative MDAR
performed under quantitative conditions, and therefore the
result may not reflect the amount of mRNA expressed in vivo.
It will be interesting to determine the expression level of
PMDAR-L and PMDAR-S in different tissues by the quantitative RT-PCR method and to compare the ratio of PMDAR-L to
PMDAR-S between the photosynthetic and non-photosynthetic
tissues, because photosynthesis generates a copious amount of
ROS in chloroplasts.
The N-terminal extended region of PMDAR-L possesses the
features of both mitochondrial and chloroplast targeting
sequences
Signal-L could import the fused GFP into mitochondria
whereas Signal-S, shorter by only seven amino acid residues,
could import it into chloroplasts. How is it possible to sort the
protein into different organelles with a seven amino acid residue extension? Fig. 5A shows the whole amino acid sequence
of Signal-L. Signal-L has the features characteristic of a mitochondrial presequence (von Heijne et al. 1989), namely, the
absence of acidic residues and enrichment in basic, hydroxylated, and hydrophobic residues. It contains the sequence of
RIAS (amino acid residues 45–48) that fits the most commonly reported mitochondrial targeting peptide cleavage motif
RX/XS (where X represents any amino acid) (von Heijne et al.
1989, Sjöling and Glase 1998). Moreover, it contains, at amino
acid residues 1–8, a potent positively charged amphiphilic ahelix in which hydrophobic residues are clustered on one side
of the helix whereas the basic and polar residues lie at the other
side (Fig. 5B). Amphiphilic a-helixes have been suggested to
be important for the function of mitochondrial targeting
sequences. On the other hand, Signal-S has some features of
chloroplast transit peptides. It contains three distinct regions
that are often seen in stromal-targeting transit peptides (Bruce
2000, Bruce 2001). These are: (1) an uncharged N-terminal
domain with Ala following the initial Met; (2) a central domain
lacking acidic residues but enriched in hydroxylated residues,
Ser and Thr in particular; and (3) a C-terminal domain enriched
in Arg. Moreover, Signal-S was predicted to display a random
coil structure almost throughout the sequence in an aqueous
environment (data not shown). A random coil structure in an
aqueous environment is also a typical feature of chloroplast
transit peptides (Schmidt et al. 1979, von Heijne and
Nishikawa 1991). Therefore, Signal-L possesses some features
of both mitochondrial and chloroplast targeting sequences
within its amino acid sequence. By fusing the mitochondrial
and chloroplast targeting sequences in tandem, Silva Filho et
al. (1996) reported that the targeting signal at the more extreme
N-terminal position is important in determining the direction of
the transport. The amphiphilic a-helix of Signal-L is, therefore, likely to play an essential role in mitochondrial targeting
of the protein by having a dominant influence against the
downstream chloroplast transit peptide. In the case of spinach
protoporphyrinogen oxidase II, the product with the longer
extended region was imported into chloroplasts, whereas the
703
shorter isoform was imported into mitochondria (Watanabe et
al. 2001). A typical chloroplast transit peptide was found at the
most N-terminal region of the longer isoform. Similarly, an
Arabidopsis THI1 gene encoding thiamine biosynthetic enzyme
generates two isoforms by alternative translation, and the longer
isoform, which possesses a chloroplast transit peptide upstream
of the mitochondrial presequence, was imported into chloroplasts. The shorter one without the most N-terminal chloroplast transit peptide was targeted to mitochondria (Chabregas et
al. 2001). On the basis of our results and these reports, it may
be rather common that the most N-terminal targeting sequence
exerts a larger influence in the determination of the final location of the protein.
Besides Arabidopsis, some MDAR sequences from several plant species are found in the databases. Of these
sequences, only one MDAR protein from spinach has the second Met at amino acid residue 8. Interestingly, it also contains
the third Met at amino acid residue 11. However, the relationship between the three Met residues and the intracellular localization of the protein is unknown. The other MDAR sequences
did not contain the second Met at or around amino acid residue
8. Further accumulation of information about MDAR in various plants will help us understand the evolution of dual targeting of MDAR.
Materials and Methods
Cloning of PMADR-L and PMDAR-S cDNA
cDNA of PMDAR-L and PMDAR-S was cloned by RT-PCR
methods. Total RNA was extracted from the above-ground parts of
Arabidopsis ecotype Columbia, at 4 weeks after sowing. Poly(A)+
RNA was purified from the total RNA using oligotex-dT30 (JSR,
Tokyo). The purified Poly(A)+ RNA was primed with oligo(dT) and
then copied into cDNA using reverse transcriptase. The cDNA was
subjected to PCR using TaKaRa Extaq HS (TaKaRa, Tokyo) or KOD
plus (TOYOBO, Tokyo) as a DNA polymerase, forward primer
designed at 5¢-UTR of each mRNA, and the reverse primer designed at
the stop codon. Forward primers of PMDAR-S were designed inside
the first intron of PMDAR-L to amplify the cDNA of PMDAR-S specifically (see Fig. 2A, B). Amplified fragments were concentrated
using Microcon PCR (Millipore, Bedford, MA, U.S.A.) and cloned
into pGEM-T Easy vector (Promega, Madison, WI, U.S.A.).
Determination of transcription initiation sites
Determination of the transcription starts was performed following the methods described in the manual attached to Cap Site cDNA
(NIPPON GENE, Tokyo). Cap Site cDNA is composed of cDNAs
reverse transcribed from mRNAs 5¢ cap structure of which had been
replaced by artificially synthesized oligoribonucleotides (Maruyama
and Sugano 1994). Cap Site cDNA of Arabidopsis leaves was obtained
from NIPPON GENE and subjected to nested-PCR using primer sets
designed at the artificial oligonucleotide region and specific reverse
primers (see Fig. 3A, B). TaKaRa Extaq HS (TaKaRa) was used as a
DNA polymerase. Nested-PCR products were electrophoresed in 4%
Nusieve GTG agarose (BioWhittaker Molecular Applications, Rockland, ME, U.S.A.) and stained with ethidium bromide. Specific fragments that were not amplified in negative control experiments were
cloned into pGEM-T Easy vector (Promega) and sequenced.
704
Dual targeting of Arabidopsis putative MDAR
Construction of GFP fusion proteins
Signal-L and Signal-S were amplified from each cDNA by PCR
using KOD plus polymerase (TOYOBO) and primer sets (forward
primer for Signal-L: 5¢-GGGTCGACCATGTCTGCAGTTCGTAGAGTC-3¢; forward primer for Signal-S: 5¢-GGGTCGACATGGCGTTAGCATCAACC-3¢; reverse primer for both: 5¢-GGCCATGGACCCCCCCCCGGACCCCCCCCCGGACCCCCCCCCGCTTCTGGAAGCG
ATTCTA-3¢) designed to have a linker sequence (three-times repetition of GlyGlyGlySer) and restriction enzyme sites (SalI and NcoI at 5¢
end and 3¢ end, respectively). Amplified products were inserted inframe into the corresponding site of the pTH-2 vector (kind gift from
Dr. Niwa, Y., University of Shizuoka; Chiu et al. 1996, Niwa et al.
1999) that contains the CaMV 35S promoter, sGFP (S65T), SalI and
NcoI sites between the promoter and sGFP, and the nos-terminal.
Introduction of the genes into Arabidopsis
The constructs were introduced into cells of Arabidopsis rosette
leaves by the particle bombardment method. Rosette leaves at 4 weeks
after sowing were cut off and placed gently on a MS plate with the
abaxial side up. Gold particles (1.0 mm; Bio-Rad, Hercules, CA,
U.S.A.) coated with the constructs were shot to the abaxial side using a
particle gun (TANAKA, Hokkaido). Leaves were then incubated on a
MS plate with the adaxial side up for one night at 22°C in the dark.
Observation
After the one-night incubation, leaves were observed under an
inverted fluorescence microscope (model IX70, Olympus, Tokyo)
equipped with a cooled CCD camera (MicroMAX-1300B, NIPPON
ROPER, Chiba). A successful introduction of the plasmids was confirmed by the fluorescence of GFP from some epidermal and vascular
bundle sheath cells. Vascular bundle sheath cells expressing fusion
proteins were observed further because they have differentiated chloroplasts whereas epidermal cells often do not contain differentiated
chloroplasts. GFP was excited using a mercury lamp, an excitation filter (BP470–490, Olympus) and a dichroic mirror (DM505, Olympus).
Fluorescence was detected through the dichroic mirror and a band-pass
filter (BA515–550, Olympus) allowing the recording of green fluorescence without detecting the red autofluorescence of chloroplasts.
Autofluorescence of chloroplasts was detected using an excitation filter (S555/28x, Chroma Technology, Brattleboro, VT, U.S.A.), a dichroic mirror (86100BS, Chroma Technology) and an emission filter
(S617/73m, Chroma Technology) to record the red autofluorescence
without detecting the fluorescence of GFP. Images were acquired using
MetaMorph software (UNIVERSAL IMAGING, Downingtown, PA,
U.S.A.).
Acknowledgments
This work was supported in part by Grants-in-Aid from the Ministry of Education, Science, Sports and Culture of Japan (14036205,
10219201 to H.F.), from the Japan Society for the Promotion of Science (13440236 to H.F. and Research Fellowship for Young Scientists
to K.O.), and from the Ministry of Agriculture, Forestry and Fisheries
(Gene discovery and elucidation of functions of useful genes in rice
genome by gene-expression monitoring system to H.F.).
References
Asada, K. (1999) The water-water cycle in chloroplasts: scavenging of active
oxygens and dissipation of excess photons. Annu. Rev. Plant Physiol. Plant
Mol. Biol. 50: 601–639.
Bruce, B.D. (2000) Chloroplast transit peptides: structure, function and evolution. Trends Cell Biol. 10: 440–447.
Bruce, B.D. (2001) The paradox of plastid transit peptides: conservation of
function despite divergence in primary structure. Biochim. Biophys. Acta
1541: 2–21.
Chabregas, S.M., Luche, D.D., Farias, L.P., Ribeiro, A.F., van Sluys, M.-A.,
Menck, C.F.M. and Silva-Filho, M.C. (2001) Dual targeting properties of the
N-terminal signal sequence of Arabidopsis thaliana THI1 protein to mitochondria and chloroplasts. Plant Mol. Biol. 46: 639–650.
Che, F.-S., Watanabe, N., Iwano, M., Inokuchi, H., Takayama, S., Yoshida, S.
and Isogai, A. (2000) Molecular characterization and subcellular localization
of protoporphyrinogen oxidase in spinach chloroplasts. Plant Physiol. 124:
59–70.
Cheng, S.-H., Cline, K. and DeLisle, A.J. (1994) An Arabidopsis chloroplast
RNA-binding protein gene encodes multiple mRNAs with different 5¢ ends.
Plant Physiol. 106: 303–311.
Chiu, W.-I., Niwa, Y., Zeng, W., Hirano, T., Kobayashi, H. and Sheen, J. (1996)
Engineered GFP as a vital reporter in plants. Curr. Biol. 6: 325–330.
Chow, K.-S., Singh, D.R., Roper, J.M. and Smith, A.G. (1997) A single precursor protein for ferrochelatase-I from Arabidopsis is imported in vitro into
both chloroplasts and mitochondria. J. Biol. Chem. 272: 27565–27571.
Creissen, G., Reynolds, H., Xue, Y. and Mullineaux, P. (1995) Simultaneous targeting of pea glutathione reductase and of a bacterial fusion protein to chloroplasts and mitochondria in transgenic tobacco. Plant J. 8: 167–175.
Cunillera, N., Boronat, A. and Ferrer, A. (1997) The Arabidopsis thaliana FPS1
gene generates a novel mRNA that encodes a mitochondrial farnesyl-diphosphate synthase isoform. J. Biol. Chem. 272: 15381–15388.
Danpure, C.J. (1995) How can the products of a single gene be localized to
more than one intracellular compartment? Trends Cell Biol. 5: 230–238.
Grantz, A.A., Brummell, D.A. and Bennett, A.B. (1995) Ascorbate free radical
reductase mRNA levels are induced by wounding. Plant Physiol. 108: 411–
418.
Hossain, M.A., Nakano, Y. and Asada, K. (1984) Monodehydroascorbate
reductase in spinach chloroplasts and its participation in regeneration of
ascorbate for scavenging hydroxy peroxide. Plant Cell Physiol. 25: 385–395.
Lamb, C. and Dixon, R.A. (1997) The oxidative burst in plant disease resistance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48: 251–275.
Lumbreras, V., Campos, N. and Boronat, A. (1995) The use of an alternative
promoter in the Arabidopsis thaliana HMG1 gene generates an mRNA that
encodes a novel 3-hydroxy-methylglutaryl coenzyme A reductase isoform
with extended N-terminal region. Plant J. 8: 541–549.
Luo, M., Orsi, R., Patrucco, E. and Pancaldi, S.R.C. (1997) Multiple transcription start sites of the carrot dihydrofolate reductase thymidylate synthase
gene, and sub-cellular localization of the bifunctional protein. Plant Mol.
Biol. 33: 709–722.
Maruyama, K. and Sugano, S. (1994) Oligo-capping: a simple method to replace
the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138:
171–174.
Møller, I.M. (2001) Plant mitochondria and oxidative stress: Electron transport,
NADPH turnover, and metabolism of reactive oxygen species. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 52: 561–591.
Murata, Y., Pei, Z.M., Mori, I.C. and Schroeder, J. (2001) Abscisic acid activation of plasma membrane Ca2+ channels in guard cells requires cytosolic
NAD(P)H and is differentially disrupted upstream and downstream of reactive oxygen species production in abi1-1 and abi2-1 protein phosphatase 2C
mutants. Plant Cell 13: 2513–2523.
Murthy, S.S. and Zilinskas, B.A. (1994) Molecular cloning and characterization
of a cDNA encoding pea monodehydroascorbate reductase. J. Biol. Chem.
269: 31129–31133.
Nijs, D. and Kelley, P.M. (1991) Vitamins C and E denote single hydrogen
atoms in vivo. FEBS Lett. 284: 147–151.
Niwa, Y., Hirano, T., Yoshimoto, K., Shimizu, M. and Kobayashi, H. (1999)
Non-invasive quantitative detection and applications of non-toxic, S65T-type
green fluorescent protein in living plants. Plant J. 18: 455–463.
Noctor, G. and Foyer, C.H. (1998) Ascorbate and gluthatione: Keeping active
oxygen under control. Annu. Rev. Plant Mol. Biol. 49: 249–279.
Peeters, N. and Small, I. (2001) Dual targeting to mitochondria and chloroplasts. Biochim. Biophys. Acta 1541: 54–63.
Pei, Z.M., Murata, Y., Benning, G., Thomine, S., Klusener, B., Allen, G.J., Grill,
E. and Schroeder, J.I. (2000) Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells. Nature 406: 731–734.
Prasad, T.K., Anderson, M.D. and Stewart, C.R. (1994) Evidence for chilling-
Dual targeting of Arabidopsis putative MDAR
induced oxidative stress in maize seedlings and a regulatory role for hydrogen
peroxide. Plant Cell 6: 65–74.
Puntarulo, S., Galleano, M., Sanchez, R.A. and Boveris, A. (1991) Superoxide
anion and hydrogen peroxide metabolism in soybean embryonic axes during
germination. Biochim. Biophys. Acta 1074: 277–283.
Rice-Evans, C.A., Miller, N.J. and Paganga, G. (1997) Antioxidant properties of
phenolic compounds. Trends Plant Sci. 2: 152–159.
Sakihama, Y., Mano, J., Sano, S., Asada, K. and Yamasaki, H. (2000) Reduction of phenoxyl radicals mediated by monodehydroascorbate reductase.
Biochem. Biophys. Res. Commun. 279: 919–954.
Sano, S. and Asada, K. (1994) cDNA cloning of monodehydroascorbate radical
reductase from cucumber: a high degree of homology in terms of amino acid
sequence between this enzyme and bacterial flavoenzymes. Plant Cell Physiol.
35: 425–437.
Schmidt, G.W., Devillers-Thiery, A., Desrusseaux, H., Blobel, G.F. and Chua,
N.-H. (1979) Biosynthetic pathways of two polypeptide subunits of lightharvesting chlorophyll a/b protein complex. J. Cell Biol. 83: 615–622.
Silva Filho, M.C., Chaumont, F., Leterme, S. and Boutry, M. (1996) Mitochondrial and chloroplast targeting sequences in tandem modify protein import
specificity in plant organelles. Plant Mol. Biol. 30: 769–780.
705
Sjöling, S. and Glase, E. (1998) Mitochondrial targeting peptides in plants.
Trends Plant Sci. 3: 136–140.
Small, I., Wintz, H., Akashi, K. and Mireau, H. (1998) Two birds with one
stone: genes that encode products targeted to two or more compartments.
Plant Mol. Biol. 38: 265–277.
Somssich, I.E. and Hahlbrock, K. (1998) Pathogen defense in plants – a paradigm of biological complexity. Trends Plant Sci. 3: 86–90.
von Heijne, G. and Nishikawa, K. (1991) Chloroplast transit peptides. The perfect random coil? FEBS Lett. 278: 1–3.
von Heijne, G., Steppuhn, J. and Herrmann, R.G. (1989) Domain structure of
mitochondrial and chloroplast targeting peptides. Eur. J. Biochem. 180: 535–
545.
Wagner, A.M. (1995) A role for active oxygen species as second messengers in
the induction of alternative oxidase gene expression in Petunia hybrida cells.
FEBS Lett. 368: 339–342.
Watanabe, N., Che, F.-S., Iwano, M., Takayama, S., Yoshida, S. and Isogai, A.
(2001) Dual targeting of spinach protoporphyrinogen oxidase II to mitochondria and chloroplasts by alternative use of two in-frame initiation codons. J.
Biol. Chem. 276: 20474–20481.
(Received May 13, 2002; Accepted May 27, 2002)