Download Activation of Metallothionein Gene Expression

[CANCER RESEARCH 59, 1315–1322, March 15, 1999]
Activation of Metallothionein Gene Expression by Hypoxia Involves Metal Response
Elements and Metal Transcription Factor-11
Brian J. Murphy,2 Glen K. Andrews, Doug Bittel, Daryl J. Discher, Jesica McCue, Christopher J. Green,
Marianna Yanovsky, Amato Giaccia, Robert M. Sutherland, Keith R. Laderoute, and Keith A. Webster
Pharmaceutical Discovery Division, SRI International, Menlo Park, California 94025 [B. J. M., C. J. G., M. Y., K. R. L., K. A. W.]; Department of Biochemistry and Molecular
Biology, University of Kansas Medical Center, Kansas City, Kansas 66160 [G. K. A., D. B.]; Department of Molecular and Cellular Pharmacology, University of Miami, Florida
33136 [D. J. D., J. M., K. A. W.]; Department of Radiation Biology, Stanford University, California 94305 [A. G.]; and Varian Biosynergy, Inc., Palo Alto, California 94304
[R. M. S.]
ABSTRACT
Metallothioneins (MTs) are a family of stress-induced proteins with
diverse physiological functions, including protection against metal toxicity
and oxidants. They may also contribute to the regulation of cellular
proliferation, apoptosis, and malignant progression. We reported previously that the human (h)MT-IIA isoform is induced in carcinoma cells
(A431, SiHa, and HT29) exposed to low oxygen, conditions commonly
found in solid tumors. The present study demonstrates that the genes for
hMT-IIA and mouse (m)MT-I are transcriptionally activated by hypoxia
through metal response elements (MREs) in their proximal promoter
regions. These elements bind metal transcription factor-1 (MTF-1). Deletion and mutational analyses of the hMT-IIA promoter indicated that the
hMRE-a element is essential for basal promoter activity and for induction
by hypoxia, but that other elements contribute to the full transcriptional
response. Functional studies of the mMT-I promoter demonstrated that at
least two other MREs (mMRE-d and mMRE-c) are responsive to hypoxia.
Multiple copies of either hMRE-a or mMRE-d conferred hypoxia responsiveness to a minimal MT promoter. Mouse MT-I gene transcripts in
fibroblasts with targeted deletions of both MTF-1 alleles (MTF-12/2; dko7
cells) were not induced by zinc and showed low responsiveness to hypoxia.
A transiently transfected MT promoter was unresponsive to hypoxia or
zinc in dko7 cells, but inductions were restored by cotransfecting a mouse
MTF-1 expression vector. Electrophoretic mobility shift assays detected a
specific protein-DNA complex containing MTF-1 in nuclear extracts from
hypoxic cells. Together, these results demonstrate that hypoxia activates
MT gene expression through MREs and that this activation involves
MTF-1.
INTRODUCTION
MTs3 are ubiquitous, low molecular weight proteins characterized
by high cysteine content and high affinities for metals such as zinc and
cadmium (reviewed in Ref. 1). Both the constitutive and stressinducible expression of MT appear to be dependent on activation of
MTF-1, a member of the Cys2His2 family of zinc finger transcription
factors (2, 3). MTs have well-established roles in metal homeostasis
and in the detoxification of heavy metals. Moreover, they also confer
protection against reactive oxygen intermediates, electrophilic antineoplastic agents, various mutagens, ionizing radiation, and nitric
oxide (4, 5). Other studies indicate roles for MTs in the regulation of
Received 9/11/98; accepted 1/14/99.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
This study was supported by NIH Grants CA57692 (to B. J. M.), ES05704 (to
G. K. A.), CA67166, Project 5 (to K. R. L.), and HL44578 (to K. A. W.) and by a grant
from the Cigarette and Tobacco Surtax of the State of California through the TobaccoRelated Disease Research Program of the University of California, 1RT-402 (to
K. A. W.). D. B. is supported by NIH postdoctoral fellowship NRSA: F32 ES05753.
2
To whom requests for reprints should be addressed, at Pharmaceutical Discovery,
SRI International, Room LA257, 333 Ravenswood Avenue, Menlo Park, CA 94025.
E-mail: [email protected].
3
The abbreviations used are: MT, metallothionein; MTF, metal transcription factor;
hMT, human MT; mMT, mouse MT; MRE, metal response element; GSH, glutathione;
ARE, antioxidant response element; USF, upstream stimulatory element; MEF, mouse
embryo fibroblast; Luc, luciferase; HIF, hypoxia-inducible factor; HRE, hypoxia response
element; CMV, cytomegalovirus.
cellular proliferation and apoptosis (6 –9), perhaps through an interaction of MT with nuclear factor-kB-DNA complexes (10). These
properties of MTs reflect their potential importance for malignant
progression; high expression of MTs correlates with poor prognosis
and progressive disease in a number of human tumors (11, 12). In this
context, MTF-1 may be important for tumorigenesis not only through
MT expression but also through its regulation of other genes. For
example, MTF-1 activity is necessary for the expression of g-glutamylcysteine synthetase (13), the rate-limiting enzyme for the synthesis of GSH (14). GSH is a major contributor to cellular defenses
against environmental alkylating agents and oxidants, including reactive oxygen species generated by ionizing radiation (14). Thus,
MTF-1 may be critical for modulating gene expression associated
with malignant phenotypes such as resistance to therapy.
The mammalian MT family consists of two ubiquitous isoforms
(MT-I and MT-II) and two tissue-specific isoforms (MT-III and
MT-IV). Although only one isoform of mammalian MT-II has been
identified (MT-IIA), at least seven unique functional isoforms have
been described for the hMT-I gene (15). The expression and regulation
of some of the hMT genes (e.g., MT-IA, MT-IB, MT-1G, and MT-IIA)
have been described (15, 16). MT-IIA is the predominant human MT
isoform and is expressed in most cultured human cells (15). In
contrast, MT-I is the predominant MT isoform in the mouse. The
mammalian MT-I and MT-II genes are transcriptionally regulated by
metal ions, such as zinc and cadmium, and by a wide variety of other
stimuli. These latter agonists include bacterial endotoxin (lipopolysaccharides), phorbol esters, xenobiotics, and oxidative stress (3). The
hMT-IIA gene is also induced by hypoxia, growth factors, cytokines,
UV radiation, glucocorticoids, X-irradiation, and some specific DNAdamaging agents (4, 15, 17). Although the regulatory mechanisms of
these nonmetallic inducers are not well understood, some appear to
involve redox stresses (3).
Both MT-I and MT-II promoters contain multiple copies of specific
cis-acting elements that cooperate to direct metal inducibility (MREs;
1). The MRE-associated transcription factor (MTF-1) that binds to
MREs and activates MT transcription has been cloned from mouse
and human cells (18, 19). The mechanism by which metals activate
transcription through MTF-1 has not been well established, although
it appears to involve interactions at the zinc finger domain of MTF-1
(20). We have observed that oxidative stress activates the mMT-1 gene
through MTF-1 binding to the MREs in the proximal promoter (21,
22). In addition to the MREs, proximal mMT-1 promoters contain Sp1
binding sites, USF binding sites, AREs, glucocorticoid-responsive
elements, and consensus TATA box sequences (23, 24). The hMT-IIA
promoter is also complex and contains a glucocorticoid-responsive
element, Sp1 and AP1 binding sites, three putative AP2 sites, four
metal response elements (MRE-a through MRE-d), and a TATA box
(15).
We reported previously that low pO2 levels, similar to those measured in tumors ,1 mm in diameter (25), significantly induced hMTIIA transcript and protein expression in a variety of carcinoma cell
lines (17). In this study, we present the following major observations:
1315
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
MT REGULATION BY HYPOXIA
(a) the most downstream MRE in the proximal promoter region of the
hMT-IIA gene regulates MT-IIA transcriptional inductions by hypoxia, whereas at least two distal MREs are involved in the mMT-I
activation; (b) MTF-1 is required for this process; and (c) it is
therefore likely that MTF-1 is a redox-responsive transcription factor
that regulates coordinate gene expression in hypoxic and reoxygenated tumor microenvironments.
MATERIALS AND METHODS
CCGGCTC. The fragment was also inserted between the XhoI/BglII sites of
pMT-I(242)-Luc.
Cell Transfections and Treatments. Subconfluent C2C12 myoblasts or
NIH3T3R cells were used for analysis of both the hMT-IIA and mMT-I
promoters and were transfected with either 10 mg of total DNA by the calcium
phosphate technique as described previously (17) or with 2 mg of DNA using
a standard DEAE dextran method (31). The DEAE dextran method was also
used for cotransfections of the mMTF-12/2 fibroblast cells (dko7) involving
2.0 mg of pMT-I(2153)-Luc and variable amounts of an mMTF-1 expression
vector (up to 1.0 mg). Where appropriate, a Bluescript phagemid was used to
maintain an equal administration of total DNA. Transfections were normalized
either by cotransfection with a plasmid containing the b-galactosidase gene,
driven by the mouse hydroxymethylglutaryl-CoA reductase promoter, which
has a minimal hypoxia response (32), or with a Renilla luciferase control
(Dual-Luciferase Reporter Assay System; Promega). At 24 h after transfection,
the medium was replenished, and the cells were subjected to hypoxia or metal
treatments. Luciferase activity in cell extracts was assayed with a Promega
Biotec assay kit and either a LKB BioOrbit 1250 luminometer or a Turner
Designs TD-20/20 luminometer (Promega).
MTF-1 Null Analyses. The mouse dko7 cell line, which lacks MTF-1, was
a gift of Walter Schaffner (University of Zurich, Zurich, Switzerland; Ref. 2).
These fibroblast-like cells were derived from embryonic stem cells and immortalized with SV40 large T antigen (33). Wild-type MEF cells, which were
also immortalized with SV40 large T antigen, were obtained from Dr. John
Lazo, University of Pittsburgh (Pittsburgh, PA; Ref. 28). Both lines were
maintained in high-glucose DMEM supplemented with 10% FBS (2). The
expression plasmid CMV-mMTF-1 was created by inserting the mMTF-1
cDNA, isolated by reverse transcription-PCR, into the NotI site of a cytomegalovirus expression vector (20).
Nuclear Extracts and Electrophoretic Mobility Shift Assay. Nuclear
extracts were prepared from confluent C2C12 myocytes grown in a normal
aerobic environment or under hypoxia. Cells were serum starved (0.5% serum)
for 4 –5 days before treatments to eliminate the effects of mitogens and serum
metals. For hypoxic cell extracts, cell lysis was performed with the cells still
under hypoxia to avoid reoxygenation effects (34). Cells were lysed in a buffer
containing 10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT,
0.4 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate, 5 mM b-glycerophosphate, 5 mM benzamidine, 5 mM NaF, and 10 mM sodium PPi. Nuclei
were removed by centrifuging at 3000 3 g for 20 min, and proteins were
extracted (35). Sequences of the sense-strand oligonucleotide probes used
were: hMRE-a, 59-AGCTTCGGGGCTTTTGCACTCGTCCCGGCTCTA39; hMRE-a mut, 59-AGCTTCGGGGCTTTgatgCTCGTCCCGGCTCTA-39;
MRE-s, 59-GATCCAGGAGCTCTGCACAGGCCCAAAAGTA-39; HIF-1,
59-AGCTTGCCCTACGTGCTGTCTCA-39; and Sp1, 59-ATTCGATCGGGGCGGGGCGAGC-39.
Gel-purified, double-stranded oligonucleotides were end-labeled using
T4 polynucleotide kinase (Promega) and [g-32P]ATP (NEN/DuPont). Equal
amounts of radioactive probe (1.5–2.5 3 104 cpm) were added to binding
reactions that contained 8 mg of protein in 20 ml of a buffer containing 4
mM Tris (pH 7.8), 12 mM HEPES (pH 7.9), 60 mM KCl, 30 mM NaCl, 0.1
mM EDTA, and 1 mg of poly(deoxyinosinic-deoxycytidylic acid; Pharmacia). Reactions were incubated for 15 min at 22°C before separation on
Cell Culture and Hypoxia. The culture of C2C12 myoblasts, NIH3T3R
(Ha-ras transformed NIH3T3 cells), dko7 fibroblasts, and MEF cells and our
methods for exposing cells to hypoxia are described elsewhere (2, 26 –29).
Briefly, culture dishes were incubated in aluminum chambers at 37°C and
made hypoxic by repeated cycles of partial evacuation and gassing with 5%
CO2/N2. The final O2 tension at the end of the pump/gas period was #0.1% of
atmospheric O2. After incubation at 37°C for periods up to 14 h, the chambers
were opened under N2 in a humidified anaerobic chamber (Anaerobe Systems,
Santa Clara, CA) and harvested. Aerobic controls were incubated in 5%
CO2/air at 37°C.
Northern Blots. Our procedure for Northern analysis is described elsewhere (17). Blots were probed with a EcoRI/HindIII (1.85-kb) fragment of the
mMT-I genomic DNA (American Type Culture Collection, Rockville, MD)
labeled by the random primer method. Signals were quantified by video
densitometry using a Lynx 4000 image analyzer and normalized to b-actin
mRNA levels detected by using a 32P-labeled, 200-bp oligomer of human
b-actin (Clontech, Palo Alto, CA).
MT Plasmid Constructs. The vector pHS1, containing 2764 to 76 bp
relative to the transcription start site of the hMT-IIA gene, was a generous gift
of T. Mulcahy (University of Wisconsin-Madison, Madison, WI). Constructs
containing successive deletions of the proximal promoter (from 2167 bp) were
generated by the PCR using the primers described below and pHS1 as the
template. Primers were designed from the published hMT-IIA sequence (30),
and the amplified fragments were cloned into the XhoI/HindIII site of the
pGL2 Basic luciferase reporter plasmid (Promega Corp., Madison, WI). All
resulting constructs were confirmed by double-stranded sequencing using the
PCR primers. The following mMT-I promoter constructs have been described
elsewhere (22): pmMT-I(-153)-Luc containing the 2153 to 62-bp fragment;
pmMT-I (D153)-Luc containing the 2153-bp deletion mutant (2100 to 289
deleted); pmMT-I(-42)-Luc containing the 242 to 62-bp minimal promoter,
and pmMT-I (MRE-d95)-Luc containing five tandem copies of mMRE-d
repeats cloned upstream of the minimal promoter from pmMT-I(-42)-Luc. The
primers used were as follows [mutant (mut) bases are shown in lowercase]:
universal 39-primer (to 23 of hMT-IIA), TTTAAGCTTGGGACTTGGAGGAGGCGTGGTGGAGTGCAG; 59-primers to 2167-bp [phMT-IIA(2167)Luc], TTTTCTCGAGGTGCAGAGCCGGGTG; 59-primers to 290 bp
[phMT-IIA(290)-Luc], TTCTCGAGGCGGGGCGTGTGCAGGCACGGCCGGGGCGGGGC; 59-primers to 270 bp [phMT-IIA(270)-Luc], TTTTCTCGAGGCCGGGGCGGGGCTTTTGCACTCGT; 59-primers to 257 bp [phMTIIA(257)-Luc], TTTCTCGAGTTTTGCACTCGTCCCGGCTC; and 59primers to 270 bp [hMRE-a mut; phMT-IIA(270 mut)-Luc], TTTTCTCGAGGCCGGGGCGGGGCTTTgatgCTCGT.
Selected mMRE double-stranded oligonucleotides (monomers) were synthesized and cloned into the XhoI/BglII sites of pmMT-I(242)-Luc, immediately upstream of the minimal mMT-1 promoter (242 to 62; 22). The mMT-I
MRE-s, including a consensus MRE (MRE-s) that lacks an Sp1-like overlapping sequence, were as follows: mMRE-d, 59-GATCCAGGGAGCTCTGCACTCCGCCCGAAAAGTA-39 and 39-GTCCCTCGAGACGTGAGGCGGGCTTTTCATCTAG-59; mMRE-d mut, 59-GATCCAGGGAGCTaattACTCCGCCCGAAAAGTA-39 and 39-GTCCCTCGATTAATGAGGCGGGCTTTTCATCTAG-59; mMRE-c, 59-GATCCCCGAAAAGTGCGCTCGGCTCTGCCAAGTA-39 and 39-GGGCTTTTCACGCGAGCCGAGACGGTTCATCTAG-59; and mMRE-s, 59-GATCCAGGGAGCTCTGCACACGGCCCGAAAAGTA-39 and 39-GTCCCTCGAGACGTGTGCCGGGCTTTTFig. 1. Northern analysis of mMT-I induction kinetics. C2C12 cells were exposed to
CATCTAG-59.
hypoxia (#0.1% O2) for 0 –12 h, and mMT-I RNA was detected by Northern analysis
A construct containing five tandem copies of the hMRE-a was assembled
using a 32P-labeled MT-I EcoRI/HindIII fragment of the mouse MT-I genomic DNA. This
using a monomer containing the 15-bp hMRE-a sequence and 5-bp natural representative blot was reprobed for b-actin mRNAs as described in “Materials and
flanking sequences on both the 59 and 39 sides: GGGGCTTTTGCACTCGTC- Methods.”
1316
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
MT REGULATION BY HYPOXIA
Fig. 2. Mapping of the hMT-IIA proximal promoter
element involved in the transcriptional response to hypoxia. A, a schematic representation of the deletion
analysis of the proximal promoter of the hMT-IIA gene.
Mean Luc activities relative to hMT-IIA(2167)-Luc
are shown for each construct. C2C12 cells were transfected with the indicated promoter-reporter constructs
as described in “Materials and Methods.” Promoter
constructs containing successive deletion fragments
from 2167 to 257 (to 23) were generated by PCR and
cloned into pGL2 (Promega); the hMRE-a mutant was
constructed using pMT(270)-Luc. B, after a recovery
period of 24 – 48 h, cells were exposed to hypoxia or
zinc for 12 and 6 h, respectively. Cells were harvested,
and cell lysates were assayed for Luc activities. Reporter inductions were calculated as the ratio of normalized Luc activity in treated cells to that in control
cells (see “Materials and Methods”). Data represent the
means of at least three independent transfection assays
for each construct; bars, SD.
nondenaturing 6% polyacrylamide gels at 4°C. For competition assays,
binding reactions included 100 ng of indicated unlabeled oligonucleotide.
For supershift assays, polyclonal antibodies (0.5 ml) against a recombinant
GST-mMTF-1 fusion protein, or against Sp1 (Santa Cruz Biotechnology,
Inc., Santa Cruz, CA) were added to the binding buffer 1 h before addition
of the labeled oligonucleotide. The polyclonal antiserum against GSTmMTF-1 expressed in Escherichia coli was raised in rabbits (Covance
Research Products, Inc., Denver, CO) and was enriched for IgG by protein
A affinity purification.
RESULTS
Induction of MT-I mRNA
We demonstrated previously that the expression of the predominant
human MT isoform, hMT-IIA, is up-regulated in a number of carcinoma cell lines by hypoxia (17). Fig. 1 shows that the steady-state
levels of mMT-I mRNA are increased in rodent C2C12 muscle cells by
exposure to hypoxia. We confirmed this finding in a number of other
rodent cell lines including NIH 3T3, ras-transformed NIH3T3
(NIH3T3R), and mouse hepatoma cells (Hepa).4 Hypoxia treatments
resulted in 12.8 6 7.0-fold inductions of state levels of mMT-I mRNA
after 12 h; ZnCl2 exposures (100 mM; 4 – 6 h) resulted in .17-fold
induction. These values are similar to those reported for MT-IIA
mRNA in A431 human squamous carcinoma cells (17). The blot
shown in Fig. 1 was reprobed with b-actin as a control gene that is not
affected by hypoxia.
Mapping of MT Hypoxia-responsive Regions
hMT-IIA. To define the element(s) responsible for the induction
of the hMT-II gene by hypoxia, deletions of the proximal promoter
region were made and assayed under aerobic, hypoxic, or metaltreated conditions as described in “Materials and Methods.” The basal
activities of the reporter constructs dropped as successive deletions
were introduced downstream of 2167 bp (Fig. 2). Specifically,
4
B. J. Murphy and M. Yanovsky, unpublished results.
phMT-IIA(290)-Luc and phMT-IIA(270)-Luc showed approximately 2- and 9-fold lower basal activities, respectively, as compared
with phMT-IIA(2167)-Luc. Deletion to 257 bp caused an additional
7-fold reduction in basal transcriptional activity as compared with
phMT-IIA(270)-Luc. The deletion from 2167 to 290 bp eliminates
two MREs (hMRE-d and hMRE-c), an AP2 sequence and an AP1
element; deletion from 290 to 270 bp removes hMRE-b, whereas the
deletion from 270 to 257 bp removes a GC (Sp1 family) binding site.
The results confirm previous studies showing the importance of a
number of promoter elements, including other MREs, in maintaining
high basal promoter activity (for an example, see Ref. 15). Although,
the basal transcriptional activities fell in these successive deletion
constructs, the relative responses to hypoxia and zinc were maintained, including the smallest deleted promoter [phMT-IIA(257)Luc]. This 257-bp promoter fragment contains only the hMRE-a
element upstream of the TATA box sequence (15). To delineate a
putative contribution of hMRE-a, a mutation was introduced into the
59-core region of the hMRE-a element in phMT-IIA(270)-Luc. This
mutation eliminated both basal and inducible expression. These findings suggest a critical role for the hMT-IIA MRE-a in hypoxia and
metal inducibility and in the maintenance of basal transcriptional
rates.
mMT-I. The proximal promoter of mMT-I contains four MREs, an
Sp1 element, an overlapping USF/ARE, and a TATA box (Fig. 3A).
A construct containing this promoter region truncated to 2153/67 bp
(relative to the transcription start site) inserted immediately upstream
of a luciferase reporter gene (pGL2-Basic), pmMT-I(2153)-Luc, was
induced 7.1 6 2.1-fold by hypoxia and 12.1 6 5.3-fold by zinc (Fig.
3B). To analyze the contributions of mMREs to the hypoxia inducibility of mMT-I, selected MRE monomers were inserted into pmMTI(242)-Luc. These included mMRE-d, a mutated (mut) mMRE-d,
mMRE-c, and a consensus mMRE (mMRE-s), as described above.
Because single-copy mMREs were poorly expressed in C2C12 cells
(data not shown; see also Refs. 36 and 37), we used the cell line
NIH3T3R in which endogenous MTs are strongly induced by both
1317
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
MT REGULATION BY HYPOXIA
Fig. 3. Mapping of the mMT-I (and hMT-IIA)
proximal promoter elements involved in hypoxiaassociated responses. A, a schematic representation
of the proximal promoter of the mMT-I gene and the
Luc-based constructs used in this analysis of its
hypoxia-responsive promoter region. Mean Luc activities relative to pMT-I(2153)-Luc are shown for
each construct. B, the pMT-I(2153)-Luc, pmMT-I
(153D)-Luc, phMT-IIA(MRE-(a95)-Luc, or pmMTI(MRE-d95)-Luc were transfected into C2C12 cells
and treated as described in “Materials and Methods.” C, the pMT-I(2153)-Luc and selected mMRE
monomer sequences [ligated into pMT-I(242)Luc] were transfected into NIH3T3R cells as described in “Materials and Methods.” The MRE
monomer constructs included mMT-I MRE-d and
its mutant form (mMRE-d mut), MRE-c, and a
consensus mMRE that lacks an associated Sp1 homology sequence (mMRE-s). Transfectant cells
were treated exactly as described in Fig. 2, with the
Luc activity in treated cells reported relative to that
in the controls. Data represent the means of at least
three independent transfection assays for each construct; bars, SD.
hypoxia and zinc.4 Fig. 3C shows that both mMRE-d and mMRE-c
conferred both hypoxia and zinc induction. A 3-bp mutation in the
core region of the mMRE-d completely eliminated inducibility by
both stresses. A consensus mMRE (mMRE-s), which lacks the GCrich 59-flanking sequence, was also responsive to hypoxia (Fig. 3C),
implying that all of these mMREs may be capable of inducing
transcription in response to hypoxia. Previous studies indicated that
the composite USF/ARE (2100 to 289) mediated, in part, the response to H2O2 (22). In contrast, deletion of the USF/ARE did not
affect the hypoxia-responsiveness of the mMT-I promoter (Fig. 3B).
However, this deletion did result in significant reductions in basal
activities of the promoter by 10- to 20-fold (Fig. 3A), which is
consistent with other studies (22).
To further confirm the roles of the MREs as hypoxia-responsive
elements, we inserted synthetic DNA fragments containing five copies
of either hMRE-a or mMRE-d in tandem immediately upstream of
pmMT-I(242)-Luc (see “Materials and Methods”). Multiple copies
were used to boost expression because other studies, including this
report (see Fig. 2), have demonstrated enhanced activity of multiple
compared with single elements in the response to metals (36, 37).
Multiple copies of either hMRE-a or mMRE-d [phMT-IIA(MRE-a95)Luc or pmMT-I(MRE-d95)-Luc], respectively) conferred significant
hypoxia inducibility to the minimal mouse promoter, pMT-I(242)Luc, transfected into C2C12 cells. Hypoxia and zinc inductions were
similar in mMRE-d95 transfectants (;6-fold), whereas zinc activations were slightly higher in the hMRE-a95 transfected cells (;7- and
4-fold, respectively; see Fig. 3B).
MT Regulation in Fibroblasts from MTF-12/2 dko7 Cells
The transient expression results implicate MREs in the activation of
MT expression by hypoxia. To determine whether the MRE-binding
transcription factor, MTF-1, is involved in this response, we analyzed
the expression of mMT-I mRNA levels and of a transfected mMT-I
promoter-reporter in MTF-12/2 cells (dko7) and wild-type MEFs.
Fig. 4A shows a representative study of the steady-state levels of
mMT-1 mRNA transcripts from untreated, hypoxia-treated, and zinctreated cells. The induction by zinc was abolished in the MTF-12/2
cells, and the induction by hypoxia was reduced by ;60% compared
with that in normal MEFs. Absolute fold inductions were impossible
to compute because the steady-state levels of mMT-I mRNA were
undetectable. The residual hypoxia response must be due to other
transcription factors or posttranscriptional mechanisms.
Transient expression studies of the pmMT-I(2153)-Luc reporter
1318
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
MT REGULATION BY HYPOXIA
Similarly, anti-MTF-1 antibody suppressed the zinc-induced band and
generated a supershift. Anti-Sp1-specific antibody did not affect the
specific MRE-complexes (Fig. 5C, Lane 5), whereas it strongly supershifted the low mobility complex that bound to an Sp1 consensus
binding site (Fig. 5D). Therefore, Sp1 is probably not a component of
the MRE-specific complex. It should be noted that the mobility of the
MRE-specific protein-DNA complexes was identical in zinc-treated
and hypoxic cells. However, the hypoxia-mediated increase in MTF-1
binding activity was considerably less than that detected in zinctreated cells, and this may explain the inability to detect a supershift
with the hypoxia-treated extracts (Fig. 5C). Fig. 5E shows that HIF1-specific binding was also induced in these cells within 2 h of
exposure to hypoxia. In contrast to the MRE-specific complex, HIF-1
binding was activated by cobalt treatment but not by zinc. These
results indicate that HIF-1 and MTF-1 are distinct factors that are both
activated by hypoxia in C2C12 cells and with similar kinetics.
DISCUSSION
These studies, which extend our previous findings, demonstrate that
the major isoforms of the human and mouse MT family (hMT-IIA and
Fig. 4. Induction of mMT-I mRNA and reporter constructs in aerobic and hypoxic
MTF-1 knockout and wild-type MEFs. A, normal MEFs and MTF-122 (dko7) fibroblasts
were exposed to either hypoxia (#0.1% O2) or ZnCl2 (100 mM) and lysed, and mMT-I
mRNA levels were determined by Northern analysis. The membranes were reprobed with
b-actin. B, dko7 cells were transfected with either the hMT-IIA(2167)-Luc or pMTI(2153)-Luc reporter constructs. To determine the effects of ectopic expression of the
metal transcription factor MTF-1, varying amounts of the CMV-mMTF-1 vector (0 –1 mg)
were cotransfected with pmMT-I(2153)-Luc (1 mg) into the MTF-12/2 cells. After a
24-h recovery period, cells were exposed to hypoxia or zinc. Cells were lysed and assayed
for Luc activity as described in Fig. 2. Data represent the means of at least three
independent assays; bars, SD.
constructs in MTF-12/2 cells are summarized in Fig. 4B. The expression of luciferase was not significantly responsive to hypoxia or zinc.
When pmMT-I(2153)-Luc was cotransfected with CMV-mMTF-1,
the response to hypoxia or zinc treatment was restored. Specifically,
a titration of pmMTF-1 (0 –2.0 mg) indicated that Luc activities were
increased ;3-fold by hypoxia and 9-fold by zinc at a concentration of
0.5 mg of CMV-mMTF-1. A reporter construct, containing a herpes
simplex virus-thymidine kinase promoter and a Renilla luciferase, was
cotransfected as an internal control and was not responsive to either
hypoxia or zinc. These data confirm that MTF-1 plays a role in the
response of MT genes to hypoxia.
Binding Studies
Electrophoretic mobility shift assays were used to confirm the
presence of MTF-1 in C2C12 cells and to determine whether hypoxia
affected MTF-1 binding activity. Nuclear extracts from zinc- and
hypoxia-treated cells were analyzed using the hMRE-a from the
hMT-IIA promoter (Fig. 5A) and the consensus mMRE-s (Fig. 5, B
and C). A specific hMRE-a-binding complex was detected in nuclear
proteins from cells exposed to hypoxia for 8 or 24 h. Formation of
complex M was suppressed by competition with unlabeled hMREa.
Importantly, the formation of this complex was not competed by an
oligonucleotide with a mutated hMRE sequence (hMRE-a mut; see
“Materials and Methods”) or by an oligonucleotide containing a
consensus HIF-1 binding site. Fig. 5B shows that the specific complex
was induced within 2 h of exposure to hypoxia. In Fig. 5C, the effect
of MTF-1-specific antibody was tested. Anti-MTF-1 antisera treatment of hypoxic extracts (8 and 24 h) eliminated the low mobility
complex but did not affect the higher mobility band (Fig. 5C, NS).
Fig. 5. Effects of hypoxia and metals on nuclear protein-DNA complexes. Comparison
of the effects of hypoxic and zinc exposure on proteins binding to oligonucleotides
containing core sequences corresponding to hMRE-a (A), mMRE-s (B and C), Sp1 (D),
and HRE (HIF-1 binding site; E). Exposure of cells to metals or hypoxia, harvesting,
nuclear extraction, probe sequences, and electrophoretic mobility shift analysis are described in “Materials and Methods.” Zinc chloride (60 mM) and cobalt chloride (100 mM)
were added to the cultures for the indicated time intervals. Competitor oligonucleotides
(100-fold excess in A, Lanes 5–7; B, Lane 5; D, Lane 3; and E, Lane 7) or antisera (4 mg)
were added to the extracts, and the mixtures were incubated for 1 h at 4°C before the
addition of 32P-labeled oligonucleotides. Arrows, positions of MRE-specific (M) and
nonspecific (NS) complexes, and SS refers to supershifted complexes. The binding of
MTF-1, Sp 1, and HIF-1, respectively, to these elements has been described previously
(18, 35, 61– 63).
1319
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
MT REGULATION BY HYPOXIA
mMT-I, respectively) are transcriptionally activated by hypoxia. Transient transfection studies using a series of constructs containing fragments of the hMT-IIA and mMT-I proximal promoters showed that
hypoxia treatments caused transcriptional activations that are mediated by MREs within these promoters. DNA binding experiments,
studies using MTF-1 knockout cells, and Northern analysis demonstrate the importance of MTF-1 for the transcriptional activation of
MTs by hypoxia. In addition, these studies suggest that other transcription factors and/or posttranscriptional events are necessary for
the full hypoxic response of MTs.
Deletion and mutational analyses of the hMT-IIA promoter demonstrated the requirement for an intact hMRE-a from the hMT-IIA
promoter for both basal expression and induction by either hypoxia or
zinc. MREs are highly conserved 13- to 15-bp sequences that contain
a heptanucleotide core sequence TGC(A/G)CNC and a partially overlapping, less conserved GC-rich flanking region (15, 16). Mutation of
the four 59 core nucleotides of the hMT-IIA MRE-a resulted in
elimination of both basal and inducible (hypoxia and zinc) activities.
This result is in agreement with a previous study demonstrating a
critical role for the hMRE-a in basal and zinc-inducible expression of
the human MT-IG isoform (16). Our studies also confirm earlier
studies (15) that more downstream elements (e.g., other MREs, Sp1,
and AP1) within the proximal hMT-IIA promoter are essential for
maintenance of high basal promoter activities. It is inferred that these
promoter elements form a highly efficient and active enhanceosome(s) (38) with the MRE-a, allowing for maximum inductions of
absolute transcription rates in response to inducers such as hypoxia
and zinc.
In the functional analysis of the effects of hypoxia on the mMT-I
promoter, we focused on mMRE-d and mMRE-c because previous
studies have shown that the MRE-d of the mMT-I proximal promoter
is involved in its regulation by zinc and oxidative stress (22), and that
both mMRE-d and mMRE-c are strongly footprinted by these treatments (21). This present study extends these reports and now documents the involvement of the mMRE-d and mMRE-c in the hypoxiaassociated regulation of mMT-I, suggesting a redox-sensitive
characteristic of these MREs. Furthermore, transfection of a consensus mMRE, mMRE-s, clearly showed that other mMREs can contribute to the regulation of this promoter by hypoxia, indicating redundancy among these elements. These elements appear to constitute
multifunctional response elements, which probably cooperate in regulating the mMT-I promoter (21, 36, 37, 39). This is further supported
by the higher basal and stress-induced transcriptional activity levels of
reporter constructs containing multiple copies of mMREs compared
with a single copy of the element (;3– 4-fold higher basal levels were
observed in the multiple MREs containing plasmids compared with
the single copy). It is also noteworthy that mMRE-s and mMRE-c,
both of which lack any Sp1-like binding sites, remain responsive to
hypoxia, suggesting that the Sp1 transcription factor is not directly
involved in the activation of these elements by hypoxia. Similar to the
human MT-IIA promoter, an active enhanceosome, involving elements including Sp1, may be critical for the maintenance of optimal
basal and inducible activities. Indeed, sequences within the 2100 to
289 bp of the mMT-I promoter are essential for high transcriptional
activities (Fig. 3; see also Ref. 22).
Like hypoxia, the induction of mMT-I expression by oxidative
stress and zinc is also mediated through MREs and is accompanied by
rapid increased DNA-binding activity of MTF-1 (21, 22). Our MREbinding studies showed that MTF-1 binding increased slightly within
2 h of the onset of hypoxia and remained active for at least 24 h.
However, the changes in the binding intensities of MTF-1 were less
than those induced by zinc and oxidative stress. Interestingly, the
hypoxia-induced binding of MTF-1 is similar to that of cadmium, a
powerful inducer of MT gene expression, which causes a relatively
low increase in the amount of MTF-1 binding activity in cultured cells
(40), despite its essential role in the cadmium activation of mMT-I
gene expression (2). These results suggest that hypoxia and cadmium
may activate MT gene expression by increasing the transactivation
potential of MTF-1. This could be accomplished by interactions with
coactivators (e.g., other transcription factors), removal of an inhibitor,
and/or posttranslational modifications. An inhibitor of MTF-1 transactivation potential has been suggested (18, 41), and reversible phosphorylation of MTF-1 may modulate the activities of MTF-1. Previous studies have shown that protein kinases are activated by hypoxic
stress and may be involved in signaling pathways that modulate gene
expression (27, 42, 43). We presently have no direct evidence that
hypoxia mediates the phosphorylation of MTF-1, although activated
Ras potentiates the induction of MTs by low oxygen.5 The ability of
ectopic expression of mMTF-1 to restore hypoxia-associated induction of a transfected MT promoter in mMTF-1 deleted cells (Fig. 4B)
supports its role in the pathway(s) of activation of MTs by hypoxia.
However, the induction of endogenous MT-I transcript levels by
hypoxia was only partially blocked in the MTF-12/2 cells (Fig. 4A),
indicating the involvement of other transcription factors and/or posttranscriptional regulation. This is also supported by our findings that
MTF-1 ectopic expression in the MTF-1 knockout cells was unable to
restore comparable inducibility of the mMT-I gene by hypoxia compared with zinc. One posttranscriptional mechanism implicated in the
induction of specific mRNA accumulation in hypoxic cells is message
stability (43– 46). Our estimates of C2C12 MT-I mRNA half-lives
indicated that these were in excess of 7 h for both aerobic controls and
hypoxic cells with no discernible difference (data not shown). Therefore, changes in the mRNA accumulation probably do not contribute
to the hypoxia-associated increases in MT-I mRNA.
Several hypoxia-responsive transcription factors from mammalian
cells have been identified, including HIF-1 (47–50), nuclear factor-kB
(51), p53 (52, 53), c-Jun, and c-Fos (42, 43, 54). In addition, the ARE
has been shown to be responsive to hypoxia (55). The heterodimeric
complex of HIF-1, which binds to the hypoxia-sensitive HRE, is a
ubiquitous hypoxia-sensitive transcription factor that regulates a variety of hypoxic stress genes (56). Our data, including functional and
binding studies, demonstrated that neither HIF-1 nor HREs are involved in the regulation of MTs by hypoxia. Furthermore, the AP1
site in the hMT-IIA promoter and the ARE in the mMT-I promoter do
not appear to be directly activated by hypoxia but probably cooperate
with other elements to maintain high basal and inducible promoter
activities. Therefore, the MREs represent a stress response activated
by both hypoxia and oxidative stress signals (21, 22) and controlled,
at least, by modulations of MTF-1.
Hypoxia is known to have roles in a number of physiological and
pathophysiological processes, including erythroid development, angiogenesis, wound healing, cardiovascular-related diseases, and neoplasia. For example, many animal tumors contain a significant fraction of hypoxic cells that can cycle between hypoxic and
reoxygenation states, and it is believed that these regions affect
therapeutic responsiveness and malignant progression partially
through increased synthesis of a set of hypoxic stress proteins (57,
58). As mentioned above, MT is both a hypoxic and an oxidative
stress protein that contributes to the resistance of mammalian cells to
reactive oxygen intermediates (generated by a variety of conditions
including electrophilic and other antineoplastic drugs, radiation, and
ischemia/reperfusion) and that may regulate both cellular proliferation
and apoptotic pathways (5, 9, 59). We further suggest that MTF-1 is
5
B. J. Murphy and M. Yanovsky, unpublished results.
1320
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
MT REGULATION BY HYPOXIA
a determinant of clinically important malignant phenotypes not only
through redox control of MT expression but also through regulation of
other target genes such as g-glutamylcysteine synthetase (13, 60). For
example, enhanced GSH synthesis owing to MTF-1 activation in
tumor microenvironments could complement or synergize with a
mechanism of drug resistance involving overexpressed cellular sulfhydryl proteins such as MT.
ACKNOWLEDGMENTS
We acknowledge the assistance of R. J. Chin, A. M. Knapp, E. Watson, and
S. Eklund.
REFERENCES
1. Andrews, G. K. Regulation of metallothionein gene expression. Prog. Food Nutr. Sci.,
14: 193–258, 1990.
2. Heuchel, R., Radtke, F., Georgiev, O., Stark, G., Aguet, M., and Schaffner, W. The
transcription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression. EMBO J., 13: 2870 –2875, 1994.
3. Dalton, T., Paria, B. C., Fernando, L. P., Huet-Hudson, Y. M., Dey, S. K., and
Andrews, G. K. Activation of the chicken metallothionein promoter by metals and
oxidative stress in cultured cells and transgenic mice. Comp. Biochem. Physiol.,
116B: 75– 86, 1997.
4. Lazo, J. S., and Pitt, B. R. Metallothioneins and cell death by anticancer drugs. Annu.
Rev. Pharmacol. Toxicol., 35: 635– 653, 1995.
5. Schwartz, M. A., Lazo, J. S., Yalowich, W. P., Allen, W. P., Whitmore, M., Bergonia,
H. A., Tzeng, E., Billiar, T. R., Robbins, P. D., and Lancaster, J. R. Metallothionein
protects against the cytotoxic and DNA-damaging effects of nitric oxide. Proc. Natl.
Acad. Sci. USA, 92: 4452– 4456, 1995.
6. Studer, R., Vogt, C. P., Cavigelli, M., Hunziker, P. E., and Kagi, H. R. Metallothionein accretion in human hepatic cells is linked to cellular proliferation. Biochem. J.,
328: 63– 67, 1997.
7. Nagel, W. W., and Vallee, B. L. Cell cycle regulation of metallothionein in human
colonic cancer cells. Proc. Natl. Acad. Sci. USA, 92: 579 –583, 1995.
8. Abdel-Mageed, A., and Agrawal, K. C. Antisense down-regulation of metallothionein
induces growth arrest and apoptosis in human breast carcinoma cells. Cancer Gene
Ther., 4: 199 –207, 1997.
9. Kondo, Y., Rusnak, J. M., Hoyt, D. G., Settineri, C. E., Pitt, B. R., and Lazo, J. S.
Enhanced apoptosis in metallothionein null cells. Mol. Pharmacol., 52: 195–201,
1997.
10. Abdel-Mageed, A. B., and Agrawal, K. C. Activation of nuclear factor k B: potential
role in metallothionein-mediated mitogenic response. Cancer Res., 58: 2335–2338,
1998.
11. Jasani, B., and Schmid, K. W. Significance of metallothionein overexpression in
human tumors. Histopathology, 31: 211–214, 1997.
12. Moussa, M., Kloth, D., Peers, G., Cherian, M. G., Frei, J. V., and Chin, J. L.
Metallothionein expression in prostatic carcinoma: correlation with Gleason grade,
pathologic stage, DNA content and serum level of prostate-specific antigen. Clin.
Invest. Med., 20: 371–380, 1997.
13. Gunes, C., Heuchel, R., Georgiev, O., Muller, K. H., Lichtlen, P., Bluthmann, H.,
Marino, S., Aguzzi, A., and Schaffner, W. Embryonic lethality and liver degeneration
in mice lacking the metal- responsive transcriptional activator MTF-1. EMBO J., 17:
2846 –2854, 1998.
14. Meister, A. Glutathione deficency produced by inhibition of its synthesis and its
reversal: applications in research and therapy. Cancer Res., 54: 3082–3087, 1991.
15. Skroch, P., Buchman, C., and Karin, M. Regulation of human and yeast metallothionein gene transcription by heavy metal ions. Prog. Clin. Biol. Res., 380: 113–128,
1993.
16. Samson, S. L-A., Paramchuk, W. J., Shworak, N. W., and Gedamu, L. Functional
analysis of the human metallothionein-1G gene. J. Biol. Chem., 270: 25194 –25199,
1995.
17. Murphy, B. J., Laderoute, K. R., Chin, R. J., and Sutherland, R. M. Metallothionein
IIA is up-regulated by hypoxia in human A431 squamous carcinoma cells. Cancer
Res., 54: 5808 –5810, 1994.
18. Radtke, F., Heuchel, R., Georgiev, O., Hergersberg, M., Gariglio, M., Dembic, Z., and
Schaffner, W. Cloned transcription factor MTF-1 activates the mouse metallothionein
I promoter. EMBO J., 12: 1355–1362, 1993.
19. Brugnera, E., Georgiev, O., Radtke, F., Heuchel, R., Baker, E., Sutherland, G. R., and
Schaffner, W. Cloning, chromosomal mapping and characterization of the human
metal-regulatory transcription factor MTF-1. Nucleic Acids Res., 22: 3167–3173,
1994.
20. Dalton, T. P., Bittel, D., and Andrews, G. K. Reversible activation of mouse metal
response element-binding transcription factor 1 DNA binding involves zinc interaction with the zinc finger domain. Mol. Cell. Biol., 17: 2781–2789, 1997.
21. Dalton, T., Qingwen, L., Bittel, D., Liang, L., and Andrews, G. K. Oxidative stress
activates metal-responsive transcription factor-1 binding activity. J. Biol. Chem., 271:
26233–26241, 1996.
22. Dalton, T., Palmiter, R. D., and Andrews, G. K. Transcriptional induction of the
mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a
composite major late transcription factor/antioxidant response element and metal
response promoter elements. Nucleic Acids Res., 22: 5016 –5023, 1994.
23. Dalton, T., Fu, K., Palmiter, R. D., and Andrews, G. K. Transgenic mice that
overexpress metallothionein-I resist dietary zinc deficiency. J. Nutr., 126: 825– 833,
1996.
24. Kelly, E. J., Sandgren, E. P., Brinster, R. L., and Palmiter, R. D. A pair of adjacent
glucocorticoid response elements regulate expression of two mouse metallothionein
genes. Proc. Natl. Acad. Sci. USA, 94: 10045–10050, 1997.
25. Vaupel, P. W., and Hockel, M. Oxygenation status of human tumors: a reappraisal
using computerized pO2 histography. In: P. W. Vaupel, D. K. Kelleher, and M.
Gunderoth (eds.). Funktionanalyze Biologischer Systeme. Tumor Oxygenation, pp.
219 –232. Stuttgart, Jena, New York, Gustav Fischer Verlag, 1995.
26. Webster, K. A., Muscat, G. E. O., and Kedes, L. Adenovirus E1A products suppress
myogenic differentiation and inhibit transcription from muscle-specific promoters.
Nature (Lond.), 332: 553–561, 1988.
27. Mazure, N. M., Chen, E. Y., Laderoute, K. R., and Giaccia, A. J. Induction of vascular
endothelial growth factor by hypoxia is modulated by a phosphatidylinositol 3-kinase/
Akt signaling pathway in Ha-ras-transformed cells through a hypoxia inducible
factor-1 transcriptional element. Blood, 90: 3322–3331, 1997.
28. Kondo, Y., Woo, E. S., Michalska, A. E., Choo, A., and Lazo, J. S. Metallothionein
null cells have increased sensitivity to anticancer drugs. Cancer Res., 55: 2021–2023,
1995.
29. Laderoute, K. R., Grant, T. D., Murphy, B. J., and Sutherland, R. M. Enhanced
epidermal growth factor receptor synthesis in human squamous carcinoma cells
exposed to low levels of oxygen. Int. J. Cancer, 52: 428 – 432, 1992.
30. Karin, M., and Richard, R. I. Human metallothionein genes: primary structure of the
metallothionein-II gene and a related processed gene. Nature (Lond.), 299: 797– 802,
1982.
31. Gulick, T. Transfection using DEAE-dextran. Curr. Protocols Mol. Biol., 1: 9.2.1–
9.2.10, 1997.
32. Ikeda, E., Achen, M. G., Breirer, G., and Risau, W. Hypoxia-induced transcriptional
activation and increased mRNA stability of vascular endothelial growth factor in C6
glioma cells. J. Biol. Chem., 270: 19761–19766, 1995.
33. Radtke, F., Georgiev, O., Muller, H-P., Brugnera, E., and Schaffner, W. Functional
domains of the heavy metal-responsive transcription regulator MTF-1. Nucleic Acids
Res., 23: 2277–2286, 1995.
34. Laderoute, K. R., and Webster, K. A. Hypoxia/reoxygenation stimulates jun
kinase activity through redox signaling in cardiac myocytes. Circ. Res., 80:
336 –344, 1997.
35. Wu, X., Bishopric, N. H., Discher, D. J., Murphy, B. J., and Webster, K. W. Physical
and functional sensitivity of zinc finger transcription factors to redox change. Mol.
Cell. Biol., 16: 1035–1046, 1996.
36. Culotta, V. C., and Hamer, D. H. Fine mapping of a mouse metallothionein gene
metal response element. Mol. Cell. Biol., 9: 1376 –1380, 1989.
37. Stuart, G. W., Searle, P. F., and Palmiter, R. D. Identification of multiple metal
regulatory elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature (Lond.), 317: 828 – 831, 1985.
38. Carey, M. The enhanceosome and transcriptional synergy. Cell, 92: 5– 8, 1998.
39. Aniskovitch, L. P., and Jacob, S. T. Purification and characterization of a rat liver
protein that recognizes CCAAT-homologous sequences of the metallothionein promoter and trans-activates this promoter. Arch. Biochem. Biophys., 341: 337–346,
1997.
40. Bittel, D., Dalton, T., Samson, S. L-A., Gedamu, L., and Andrews, G. K. The
DNA-binding activity of MRE-binding transcription factor-1 is activated in vivo and
in in vitro by Zn, but not by other transition metals. J. Biol. Chem., 273: 7127–7133,
1998.
41. Palmiter, R. D. Regulation of metallothionein genes by heavy metals appears to be
mediated by a zinc-sensitive inhibitor that interacts with a constitutively active
transcription factor, MTF-1. Proc. Natl. Acad. Sci. USA, 91: 1219 –1223,
1994.
42. Muller, J. M., Krauss, B., Kaltschmidt, C., Baeuerle, P. A., and Rupec, R. A. Hypoxia
induces c-fos transcription via a mitogen-activated protein kinase-dependent pathway.
J. Biol. Chem., 272: 23435–23439, 1997.
43. Ausserer, W. A., Bourrat-Floeck, B., Green, C. J., and Sutherland, R. M. Regulation
of c-jun expression during hypoxia and low glucose stress. Mol. Cell. Biol., 14:
5032–5042, 1994.
44. Claffey, K. P., Shih, S. C., Mullen, A., Dziennis, S., Cusick, J. L., Abrams, K. R.,
Lee, S. W., and Detmar, M. Identification of a human VPF/VEGF 39 untranslated
region mediating hypoxia-induced mRNA stability. Mol. Biol. Cell, 9: 469 – 481,
1998.
45. Webster, K. A., Discher, D. J., and Bishopric, N. H. Induction and nuclear accumulation of Fos and Jun proto-oncogenes in hypoxic cardiac myocytes. J. Biol. Chem.,
268: 16852–16858, 1993.
46. Levy, A. P., Levy, N. S., and Goldberg, M. A. Post-transcriptional regulation of
vascular endothelial growth factor by hypoxia. J. Biol. Chem., 271: 2746 –2753,
1996.
47. Semenza, G. L., Nejfelt, M. K., Chi, S. M., and Antonarakis, S. E. Hypoxia-inducible
nuclear factors bind to an enhancer element located 39 to the human erythropoietin
gene. Proc. Natl. Acad. Sci. USA, 88: 5680 –5684, 1991.
48. Semenza, G. L., Roth, P. H., Fang, H-M., and Wang, G. L. Transcriptional regulation
of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J. Biol. Chem.,
269: 23757–23763, 1994.
49. Pugh, C. W., Tan, C. C., Jones, R. W., and Ratcliffe, P. J. Functional analysis of an
oxygen-regulated transcriptional enhancer lying 39 to the mouse erythropoietin gene.
Proc. Natl. Acad. Sci. USA, 88: 10553–10557, 1991.
50. Firth, J. D., Ebert, B. L., Pugh, C. W., and Ratcliffe, P. J. Oxygen-regulated control
elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes:
1321
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
MT REGULATION BY HYPOXIA
51.
52.
53.
54.
55.
56.
similarities with the erythropoietin 39 enhancer. Proc. Natl. Acad. Sci. USA, 91:
6496 – 6500, 1994.
Koong, A. C., Chen, E. Y., and Giaccia, A. J. Hypoxia causes the activation of
NF-kB through the phosphorylation of IkB on tyrosine residues. Cancer Res., 54:
1– 6, 1994.
Graeber, T., Koong, A. C., and Giaccia, A. J. Hypoxia induces the accumulation of
p53 protein but the activation of a G1 phase checkpoint by low oxygen conditions is
independent of p53 status. Mol. Cell. Biol., 14: 6264 – 6277, 1994.
Graeber, T. G., Osmanian, C., Jacks, T., Housman, D. E., Koch, C. J., Lowe, S. W.,
and Giaccia, A. J. Hypoxia-mediated selection of cells with diminished apoptotic
potential in solid tumours. Nature (Lond.), 379: 88 –91, 1996.
Yao, K-S., Xanthoudakis, S., Curran, T., and O’Dwyer, P. J. Activation of AP-1 and
of a nuclear redox factor, Ref-1, in the response of HT29 colon cancer cells to
hypoxia. Mol. Cell. Biol., 14: 5997– 6003, 1994.
Waleh, N. S., Calaoagan, J., Murphy, B. J., Knapp, A. M., Sutherland, R. M., and
Laderoute, K. L. The redox-sensitive human antioxidant responsive element induces
gene expression under low oxygen conditions. Carcinogenesis (Lond.), 19: 1333–
1337, 1998.
Iyer, N. V., Kotch, L., E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H.,
Gassmann, J. D., Gearhart, J. D., Lawler, A. M., and Yu, A. Y. Cellular and
developmental control of oxygen homeostasis by hypoxia-inducible factor 1a. Genes
Dev., 12: 149 –162, 1998.
57. Sutherland, R. M., Ausserer, W. A., Murphy, B. J., and Laderoute, K. R. Tumor
hypoxia and heterogeneity: challenges and opportunities for the future. Semin. Radiat.
Oncol., 6: 59 –70, 1996.
58. Giaccia, A. J. Hypoxic stress proteins: survival of the fittest. Semin. Radiat. Oncol.,
6: 46 –58, 1996.
59. Schwartz, M. A., Lazo, J. S., Yalowich, J. C., Reylonds, I., Kagan, V. E., Tyurin, V.,
Kim, T-M., Watkins, S. C., and Pitt, B. R. Cytoplasmic metallothionein overexpression protects NIH3T3 cells from tert-butylhydroperxide toxicity. J. Biol. Chem., 269:
15238 –15243, 1994.
60. O’Dwyer, P. J., Yao, K. S., Godwin, A. K., and Clayton, M. Effects of hypoxia on
detoxicating enzyme activity and expression in HT29 colon adenocarcinoma cells.
Cancer Res., 54: 3082–3087, 1994.
61. Semenza, G. L., and Wang, G. L. A nuclear factor induced by hypoxia via de novo
protein synthesis binds to the human erythropoietin gene enhancer at a site required
for transcriptional activation. Mol. Cell. Biol., 12: 5447–5454, 1992.
62. Liu, Y., Cox, S. R., Motita, T., and Kourembanas, S. Hypoxia regulates vascular
endothelial growth factor gene expression in endothelial cells: identification of a 59
enhancer. Circ. Res., 77: 638 – 640, 1995.
63. Firth, J. D., Ebert, B. L., and Ratcliffe, P. J. Hypoxia regulation of lactate dehydrogenase A. Interaction between hypoxia-inducible factor 1 and cAMP response elements. J. Biol. Chem., 270: 21021–21027, 1995.
1322
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.
Activation of Metallothionein Gene Expression by Hypoxia
Involves Metal Response Elements and Metal Transcription
Factor-1
Brian J. Murphy, Glen K. Andrews, Doug Bittel, et al.
Cancer Res 1999;59:1315-1322.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/59/6/1315
This article cites 59 articles, 40 of which you can access for free at:
http://cancerres.aacrjournals.org/content/59/6/1315.full#ref-list-1
This article has been cited by 43 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/59/6/1315.full#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1999 American Association for Cancer Research.