Download Caulobacter Export™ Manual

UBC 92-039
Version 1.4
Oct 2007
Caulobacter S-layer Peptide and Protein Display Kit Manual
This document provides basic information on how to use the Caulobacter capabilities to display
recombinant proteins within the crystalline protein surface layer. The description provided
assumes you have the following kit components:
-Plasmid cloning vector
-Caulobacter host expression strain, provided as frozen aliquots of electrocompetent cells
-Primers to facilitate DNA sequence confirmation of constructs
-FITC-anti-cmyc monoclonal antibody. This antibody recognizes the small epitope that resides in
the cloning site of the supplied vector.
Some of the materials needed that are not provided:
-Thermotolerant polymerase (e.g., taq, pfu or Phusion™) for polymerase chain reactions
-Restriction enzymes for preparation of plasmids and inserts
-Chloramphenicol for selection of plasmids.
-E. coli strain for initial plasmid cloning
-Antisera directed to the S-layer protein (it is available separately)
-Growth medium components (e.g., peptone and yeast extract)
-Hepes buffers for low pH extraction
Please review the entire document before beginning work.
Background
Caulobacter crescentus and its S-layer:
Caulobacter crescentus is a gram-negative, non-pathogenic bacterium that is part of normal flora
in many soil and freshwater environments (12) as a member of microbial biofilms. It is
distinctive in that it is a dimorphic bacterium, alternating between a motile swarmer cell and a
nonmotile stalked cell. Because of its readily identified life cycle, the bacterium has been
studied for nearly 50 years and the main laboratory strain (C. crescentus CB15) is well
characterized genetically and biochemically (17). This includes a sequenced genome (9).
Caulobacters are readily grown using standard laboratory equipment. They can also be easily
grown in commercial fermenters to at least 30 ODs in animal protein free, defined minimal
media.
C. crescentus elaborates on its outer surface a two-dimensional crystalline protein lattice called a
surface layer (S-layer). This protein lattice is organized into a hexagonal pattern (14). This Slayer is composed a single protein, RsaA (see below for more information) (13). Crystallization
of the S-layer requires calcium ions (3, 8, 13, 16) and it is anchored to the cell surface by noncovalent interaction with at least some of the RsaA subunits and a lipopolysaccharide (LPS) in
the outer membrane (15). It is thought that the function of the S-layer is to act as a physical
barrier to parasites and lytic enzymes.
-1-
UBC 92-039
Version 1.4
Oct 2007
The LPS has been studied in some detail, in part because of a concern that it would act as an
endotoxin in this protein expression system, much like the LPS of E. coli. Fortunately,
Caulobacter has one of the rare forms of LPS that exhibits much lower endotoxin activity—at
least 100-1000 fold lower than the LPS of E. coli.
The RsaA protein is expressed to high levels in Caulobacter cells, accounting for 10-12% of the
total protein in the cell. The RsaA protein is high in hydroxyl-containing residues (25% of the
amino acids are serine or threonine) and small neutral residues. It contains few charged amino
acids. Those few result in an acidic protein with a predicted pI of 3.46. Finally, there are no
cysteine residues (7).
Structural Features of RsaA:
The RsaA protein has been characterized functionally and studies have identified specific
functional domains within the protein (Figure 1):
• The N-terminus (approximately amino acids 1-220) is required for attachment of at least some
of the protein monomers to the cell surface (3, 4, 7, 11).
• Glycine-Aspartate rich “RTX” motifs in the C-terminal portion of the protein (amino acids
860-905) are required for calcium binding (2, 5), which may, in turn, be needed for proper
folding and secretion of the native protein.
• The C-terminal (minimally amino acids 944-1026) is required for secretion of the protein (5).
In practice, the last 120 amino acids or more is needed for useful secretion levels for
heterologous fusion proteins.
Figure 1. Type 1 transporter
-2-
UBC 92-039
Version 1.4
Oct 2007
Type I Secretion and display:
Because RsaA is the protein that forms the S-layer it must be produced inside the cell and
exported to the cell surface. Export is mediated by a secretion mechanism categorized as a Type
I transporter. It is a bacterial secretion system that uses ATP to generate the energy needed for
protein export (1). In general, Type I-secreted proteins exhibit the following characteristics:
• The secretion signal resides in the C-terminus of the protein.
• The secretion signals are not cleaved, and remain on the exported protein.
The Type I secretion pathway is very different from the more typical “General Secretory
Pathway” (also called the sec-dependent pathway). In the latter, a N-terminal signal leader
peptide is recognized by the secretion pathway and later is cleaved. Because the Type I secretion
mechanism creates a water-filled pathway to the exterior, proteins that might not be suited for
secretion by the general secretory pathway might be successfully secreted by such a system.
Indeed it is really the only known alternative secretion mechanism that is adaptable for
recombinant protein secretion or surface display. The Caulobacter version is one of few that
expresses at high levels and is the only one we are aware of in a host with low levels of
endotoxin.
Of particular interest in applications of peptide/protein display on bacteria is that the export
pathway appears quite tolerant of many foreign proteins when fused to the rsaA secretion signal
or when inserted into a “permissive site” in the complete gene (6, 10, 11). In addition, the Slayer crystallization and surface attachment processes can also be remarkably tolerant of
significant additions of foreign protein at selected permissive sites. There are no guarantees that
any sequence will be successfully secreted, displayed and folded correctly. But in our experience
peptides of about 50 amino acids or less are displayed with >90% success rate and our current
success rate for proteins of 50 to about 250 amino acids is about 50-60%. In addition, although
there have been a small number of attempts we also have display successes in the >300 amino
acid range.
It should also be mentioned that if the goal of your work is to identify protein segments that you
then wish to produce in quantity, success in display in most cases means that the clone can also
be expressed as a secreted fusion protein using the Caulobacter S-layer Export kit.
General cloning strategies
The plasmid expression vector:
The single vector supplied for cloning your insertion can also be used as a positive control for Slayer secretion and display, since the sequence inserted to enable cloning of segments (at a
position originally corresponding to aa723 of the native protein) preserves translation reading
frame and is readily expressed. It is called p4A723/cmyc (5.8 kb). Also see Appendix A. It
contains several unique restriction sites (shown below in their reading frames). We recommend
preparing PCR-generated or synthesized segments that will clone into the BglII and PstI sites for
directional cloning, while maintaining translation reading frame. The marker on the plasmid is
-3-
UBC 92-039
Version 1.4
Oct 2007
chloramphenicol resistance (CM). In E. coli CM is used at 20 µg/ml and in Caulobacter use only
2 µg/ml; 20 µg/ml will not work.
GGA TCC AGA TCT GTT AAC AAT GCA TCA GAG CAG AAG CTG ATC TCG GAA GAG GAC CTC AGG CCT TCT GCA GAT GGA TCC
CCT AGG TCT AGA CAA TTG TTA CGT AGT CTC GTC TTC GAC TAG AGC CTT CTC CTG GAG TCC GGA AGA CGT CTA CCT AGG
------- ------- ------- -------------- -------------BamH1
Bgl 11 Hpa 1
Nsi 1
Cmyc
Stu 1
Pst 1
BamH1
The restriction site map of the complete plasmid is shown below; the EcoRI and HindIII sites
flank the RsaA gene:
734 Nco I
659 PflM I
437 SnaB I
429 BspM II
331 Pvu II
1956 EcoR I
1950 Sac I
1950 Ban II
1940 Xma I
1940 Sma I
2754 Xmn I
1727 NspH I
2608 Cla I
1727 Nsp7524 I
1413 ApaL I
2515 Not I
pUC8 CVX ²SD Hps12 ²F-S GSCC²
5835 base pairs
4283 Pst I
4276 Stu I
4272 Bsu36 I
4269 Ava II
4268 PpuM I
4238 Nsi I
4231 Hpa I
4225 Bgl II
4138 BstB I
3785 BstX I
5466 BspM I
5311 HinD III
5230 Avr II
Unique Sites
Between the NsiI and StuI sites is the sequence encoding the c-myc epitope. This will be displayed on
Caulobacter if the unmodified vector is introduced into the host strain. This can be readily detected
using the FITC-anti-cmyc antibody included with the kit (see a suggested procedure below).
We also have two additional plasmid vectors, not included in the display kit, but available as separate
items: p4A690/cmyc and p4A944/cmyc. These are very similar to the p4A723cmyc, except that the
BamHI segment detailed above has been positioned at RsaA amino acids 690 and 944, respectively. It
may be that your cloned segment will display more efficiently or is more inclined to fold properly at a
different site in the S-layer. A pair of sequencing primers is included with each vector to assist sequence
confirmation.
PYE Medium:
This is a general-purpose Caulobacter culture medium and is typically used for plates and
cultures. Plates are incubated at 30˚C. Caulobacter colonies typically take 2-3 days to appear.
PYE Liquid medium (per liter)
Peptone
2g
Yeast Extract
1g
1.0 ml
MgSO4.7H20 (20% stock)
CaCl2.2H2O (10% stock)
1.0 ml
-4-
UBC 92-039
Version 1.4
Oct 2007
Use deionized or distilled water; occasionally problems arise with less pure sources
For solid medium add 12-15g agar. For selection of plasmids with chloramphenicol resistance
markers, add chloramphenicol to a final concentration of 2 µg/ml after autoclaving. This is done
with a 2 mg/ml or 20 mg/ml stock solution prepared in 95% ethanol and stored at –20°C or
lower.
Low pH S-layer Extraction method:
This is a procedure to determine whether the recombinant S-layer protein has been secreted and
assembled on the surface of the Caulobacters. The method takes a bit of practice to get a clean
extraction (i.e., so that other proteins are at fairly low levels), but in general it is a reliable way to
assess success in display (or lack of it).
For the extraction you will need:
• 10 ml overnight tube culture grown in PYE liquid medium
• 10mM Hepes pH 7.2
• 100mM Hepes pH 2.0
• 10N NaOH
Procedure:
• Centrifuge culture in a Sorvall SS 34 rotor or its equivalent at 10,000 RPM for 5 min…remove
supernatant.
• Gently suspend pellet with 750 µl of 10mM Hepes pH 7.2 and transfer to an eppendorf tube.
• Centrifuge for 2 min in a refrigerated microfuge, if possible. You might get a two layered
pellet: the very bottom of pellet is the single cell layer… fairly tightly packed… next layer is
more diffuse as it contains more Caulobacters that are in a rosette formation… so a fairly loose
pellet.
• Remove the supernatant.
• Gently resuspend with 750 µl 10mM Hepes pH 7.2.
• Centrifuge again for 2 min and remove supernatant.
• Add 100mM Hepes pH 2.0… the volume you add should be equivalent to the volume of the
cell pellet in the tube.
• This is the extraction step and should not go longer than 5 min.
• Neutralize the solution by adding 2.8 µl 10N NaOH for every 240 µl of 100mM Hepes pH 2.0
used in the previous step.
• Centrifuge for 3 min. You should now obtain a tightly packed pellet.
• Remove and save the supernatant; this is the low pH extracted protein.
• Examine using standard SDS-PAGE procedures. We recommend a 7.5% acrylamide
concentration. DO NOT boil the samples in loading buffer. Instead warm to ~40˚C for a short
time and load.
Preparation of Electrocompetent Caulobacter cells:
Electrocompetent Caulobacter cells are supplied with the kit and replacements can be purchased.
Should you wish to prepare your own electrocompetent Caulobacter cells, the following
procedure is provided:
-5-
UBC 92-039
Version 1.4
Oct 2007
All solutions, bottles and tubes must be sterile.
1) Start a 50 ml culture of PYE (in a 250 ml Erlenmeyer flask) and shake overnight at 30°C.
This can be done by inoculating the culture with a fairly large colony, but if starting from freezer
stocks it is necessary first prepare a 3-5 ml culture in a tube, incubating this tube with the freezer
stock.
2) Early the next day add amount of the starter culture into a 2 L flask containing 500 ml of PYE
to make the final OD600 nm in the flask of about 0.1.
3) Incubate at 30°C with shaking at about 200 RPM, checking the OD600after about 2 hours. The
target OD is between 0.3 and 0.6.
4) Centrifuge the culture in 250 ml bottles- 10,000xg for 20 min (8000 RPM in a Sorvall GSA
rotor or equivalent).
5) Aspirate the culture supernatant and discard (pouring may also work but may dislodge the
pellet).
6) Add about 25 ml sterile cold water to each bottle and resuspend with a 10 ml pipette carefully.
7) Then fill the bottles to the top with sterile cold water (full volume wash) and centrifuge at
10,000xg for 20 min.
8) Aspirate off supernatant (note: pellets tend to be looser after the water washes)
9) Repeat the process for suspension of each pellet in 10 ml sterile cold-water (step 6).
10) Fill bottles approximately half full with sterile cold water (“half wash”).
11) Centrifuge at 10,000xg for 20 min.
12) Aspirate the supernatant.
13) Suspend and combine the pellets in 10% glycerol to a total volume of about 10% original
culture volume (i.e., 50 ml if you started with 500 ml).
14) Transfer glycerol suspension to 30 ml Corex tubes and centrifuge 10,000xg for 15 min.
15) Resuspend pellets in 3 ml per liter of initial culture volume in 10% glycerol (if you started
with 500 ml, resuspend in 1.5 ml 10% glycerol)
16) Aliquot 50 μl portions into sterile 1.7 ml eppendorf tubes and freeze in –70 to 80˚C.
Typical Cloning Procedures:
The plasmid vector p4A723 c-myc is supplied in the kit. Although you may purchase additional
amounts of plasmid from us, it is common to introduce the plasmid into an E. coli strain (e.g.,
DH5alpha, Top10F’), and then do a standard plasmid preparation, using any of the commercial
kits, to obtain useful amounts of plasmid for your work. You will discover that yields are
comparable to other small colE1 type plasmid vectors.
The target sequence is generally obtained by PCR amplification of a target sequence or by gene
synthesis. In designing a PCR amplification strategy be sure to maintain the correct translation
reading frame, as described above. When arranging for gene synthesis, advise your supplier to
use Caulobacter crescentus CB15 codon preference (see www.kazusa.or.jp/codon). However,
despite the high GC content (65%) and the consequent codon bias, in our experience codon
usage bias has not been a major problem with the expression system. In general, DNA with 50%
GC or above is likely to be suitable for cloning. Correspondingly, we advise caution in
proceeding with direct amplification and cloning of high AT DNA, such as genes from bacteria
such as Bacillus or Clostridium.
-6-
UBC 92-039
Version 1.4
Oct 2007
Ligation of gene segment into the expression plasmid and introduction into E. coli is done by
standard methods. We recommend initial cloning of ligated vector and insert into a standard E.
coli strain (e.g., DH5alpha), followed by restriction digest mapping and sequence confirmation.
We strongly recommend that all segments cloned into this display system be confirmed by DNA
sequence analysis. This is especially true for gene segments that are obtained by PCR
amplification. It is not uncommon for errors to be introduced during the PCR process. This can
even occur with editing polymerases. To assist sequence confirmation we have supplied two
DNA primers. These hybridize to regions immediately adjacent to the cloning site and so can be
used for Sanger sequencing methods to obtain sequence from both directions. For the
p4a723/cmyc vector they are:
•RAT 3533 (top strand) 5’ CGACGGCACCGACGTTCT 3’
•IRAT 3700 (bottom strand) 5’ CGGAGCCGCCAGAACGGTCAGGCCGACATTCAC 3’
As mentioned above, two different pairs of primers are sold with the p4A690cmyc and
p4A944cmyc vectors.
Gene segment synthesis:
This is a good alternative to PCR methods if the target DNA is AT rich or if you wish to avoid
the steps in this process. A number of companies are prepared to synthesize gene segments
according to your specifications (e.g., GeneArt GmbH) are accustomed to adapting codon usage
to match the ideal usage of Caulobacter and provide this service at a surprisingly low cost. They
provide sequence confirmation and a sufficient quantity of DNA for initial subcloning to the
Caulobacter expression vector. We would be happy to provide assistance in linking you with a
company that provide this service or assist that company in providing you a gene segment
already cloned into the Caulobacter expression vector.
Electroporation of Caulobacters to introduce plasmid constructs into host cells:
Once the plasmid construct is confirmed, prepare plasmid from your E. coli strain (or use the one
prepared for sequence confirmation) and electroporate the plasmid into Caulobacters, using
methods that are similar to the procedures used for E. coli (except that the growth temperature is
30°C and you must use PYE medium instead of LB or other standard media for E. coli). Since
Caulobacters have electroporation efficiencies comparable to E. coli electrocompetent cells, you
will find that this step requires only small amounts of DNA, goes easily and you typically get
thousands of colonies to choose from. Be prepared to plate several dilutions of the
electroporated cells, so that you will get a plate with well-isolated colonies. Caulobacter
colonies typically take 2-3 days to appear (anything that appears sooner than that is not a
Caulobacter!).
Once a colony is selected, we suggest the low pH extraction process to learn whether you are
making recombinant S-layer protein and that it is secreted and assembled. If an antibody to your
insert is available, you should attempt a western immunoblot analysis or fluorescence labeling
for microscopy to directly determine whether the insert is properly displayed. Contact us about
advice for methods here (John Smit 604 822-4417 or [email protected]).
-7-
UBC 92-039
Version 1.4
Oct 2007
Note: Unlike E. coli, Caulobacters cannot be prepared to be competent for plasmid uptake by
chemical methods. In particular, the methods used for preparing chemically competent E. coli
cells will not work with Caulobacter.
Storage of C. crescentus clones:
Caulobacters store well at -70°C in 5% dimethyl sulfoxide (DMSO) or 10% glycerol. We
recommend sterilization of freezers vials containing about 50 µl of DMSO. When a fresh culture
is obtained pipette about 1 ml of culture into the vial, mix briefly and freeze. Never thaw this
frozen stock. When cultures are to be inoculated, scrape a little of the “ice” from the surface
using a sterile tool (e.g., sterilized wooden applicator sticks or plastic pipettor tips) and inoculate
a plate or liquid culture.
Fluorescence microscopy labeling using the FITC-anti-cmyc antibody:
The plasmid vector supplied contains the cmyc epitope at the cloning site. Thus the unmodified
vector can be used to gain experience in labeling the Caulobacters for the detection of your
displayed element. When cloning your peptide sequences, the loss of the cmyc epitope is one
additional proof of a successful introduction of a foreign sequence. Here is a suggested
procedure:
1) In a microfuge tube mix ~25 µl of a mid-late log phase Caulobacter culture grown in
PYE (OD600 of 0.4-1) with 175 µl of cold PYE and 2 µl of the FITC-anti-cmyc antibody.
Incubate on ice for 20-30 min.
2) Fill the tube with PYE, mix and centrifuge at full speed (12-15,000 xg) in a microfuge for
4 min. Promptly remove most of the supernatant with a 1 ml pipettor (blue tips).
3) Return the tube to the centrifuge and centrifuge for a few seconds. Promptly remove the
remaining supernatant with a 100-200 µl range pipettor (yellow tips).
4) Add about 5µl of PYE medium to the pellet. Suspend the pellet using a yellow tip
pipettor and examine 1-2 µl by standard fluorescence microscopy methods. If you wish
to photograph the results, suspend the cells in a 50:50 mixture of PYE and glycerol
instead and examine only 1 µl.
To adapt this procedure to use of an unlabeled primary antibody (directed to your cloned
insert) and a fluorescent labeled secondary antibody (e.g., FITC-anti-mouse), use steps 1-3
for your primary antibody (adjusting antibody quantities as needed) and then suspend the
cells in 200 µl of cold PYE and repeat steps 1-4 for the secondary antibody.
-8-
UBC 92-039
Version 1.4
Oct 2007
References Cited
1.
Awram, P., and J. Smit. 1998. The Caulobacter crescentus paracrystalline S-layer
protein is secreted by an ABC transporter (type I) secretion apparatus. J Bacteriol
180:3062-9.
2.
Baumann, U., S. Wu, K. M. Flaherty, and D. B. McKay. 1993. Three-dimensional
structure of the alkaline protease of Pseudomonas aeruginosa: a two-domain protein with
a calcium binding parallel beta roll motif. Embo J 12:3357-64.
3.
Bingle, W. H., J. F. Nomellini, and J. Smit. 1997. Cell-surface display of a
Pseudomonas aeruginosa strain K pilin peptide within the paracrystalline S-layer of
Caulobacter crescentus. Mol Microbiol 26:277-88.
4.
Bingle, W. H., J. F. Nomellini, and J. Smit. 1997. Linker mutagenesis of the
Caulobacter crescentus S-layer protein: toward a definition of an N-terminal anchoring
region and a C-terminal secretion signal and the potential for heterologous protein
secretion. J Bacteriol 179:601-11.
5.
Bingle, W. H., J. F. Nomellini, and J. Smit. 2000. Secretion of the Caulobacter
crescentus S-layer protein: further localization of the C-terminal secretion signal and its
use for secretion of recombinant proteins. J Bacteriol 182:3298-301.
6.
Duncan, G., C. A. Tarling, W. H. Bingle, J. F. Nomellini, M. Yamage, I. R. Dorocicz,
S. G. Withers, and J. Smit. 2005. Evaluation of a new system for developing particulate
enzymes based on the surface (S)-layer protein (RsaA) of Caulobacter crescentus: fusion
with the beta-1,4-glycanase (Cex) from the cellulolytic bacterium Cellulomonas fimi
yields a robust, catalytically active product. Appl Biochem Biotechnol 127:95-110.
7.
Ford, M. J., J. F. Nomellini, and J. Smit. 2007. S-layer anchoring and localization of an
S-layer-associated protease in Caulobacter crescentus. J Bacteriol 189:2226-37.
8.
Gilchrist, A., J. A. Fisher, and J. Smit. 1992. Nucleotide sequence analysis of the gene
encoding the Caulobacter crescentus paracrystalline surface layer protein. Can J
Microbiol 38:193-202.
9.
Nierman, W. C., T. V. Feldblyum, M. T. Laub, I. T. Paulsen, K. E. Nelson, J. A.
Eisen, J. F. Heidelberg, M. R. Alley, N. Ohta, J. R. Maddock, I. Potocka, W. C.
Nelson, A. Newton, C. Stephens, N. D. Phadke, B. Ely, R. T. DeBoy, R. J. Dodson, A.
S. Durkin, M. L. Gwinn, D. H. Haft, J. F. Kolonay, J. Smit, M. B. Craven, H.
Khouri, J. Shetty, K. Berry, T. Utterback, K. Tran, A. Wolf, J. Vamathevan, M.
Ermolaeva, O. White, S. L. Salzberg, J. C. Venter, L. Shapiro, C. M. Fraser, and J.
Eisen. 2001. Complete genome sequence of Caulobacter crescentus. Proc Natl Acad Sci
U S A 98:4136-41.
10.
Nomellini, J. F., G. Duncan, I. R. Dorocicz, and J. Smit. 2007. S-layer-mediated
display of the immunoglobulin G-binding domain of streptococcal protein G on the
surface of Caulobacter crescentus: development of an immunoactive reagent. Appl
Environ Microbiol 73:3245-53.
11.
Nomellini, J. F., M. Toporowski, and J. Smit. 2004. Secretion or Presentation of
Recombinant Proteins and Peptides Mediated by the S-layer of Caulobacter crescentus .
Horizon Scientific Press.
12.
Poindexter, J. S. 1981. The caulobacters: ubiquitous unusual bacteria. Microbiol Rev
45:123-79.
-9-
UBC 92-039
13.
14.
15.
16.
17.
Version 1.4
Oct 2007
Smit, J., H. Engelhardt, S. Volker, S. H. Smith, and W. Baumeister. 1992. The Slayer of Caulobacter crescentus: three-dimensional image reconstruction and structure
analysis by electron microscopy. J Bacteriol 174:6527-38.
Smit, J., D. A. Grano, R. M. Glaeser, and N. Agabian. 1981. Periodic surface array in
Caulobacter crescentus: fine structure and chemical analysis. J Bacteriol 146:1135-50.
Walker, S. G., D. N. Karunaratne, N. Ravenscroft, and J. Smit. 1994.
Characterization of mutants of Caulobacter crescentus defective in surface attachment of
the paracrystalline surface layer. J Bacteriol 176:6312-23.
Walker, S. G., S. H. Smith, and J. Smit. 1992. Isolation and comparison of the
paracrystalline surface layer proteins of freshwater caulobacters. J Bacteriol 174:178392.
Wheeler, R. T., J. W. Gober, and L. Shapiro. 1998. Protein localization during the
Caulobacter crescentus cell cycle. Curr Opin Microbiol 1:636-42.
- 10 -
UBC 92-039
Version 1.4
Appendix A – The p4A723/cmyc plasmid vector
- 11 -
Oct 2007