Download Lin, R., C. D. Allis and S. J. Elledge. 1996. PAT1

PAT1, an evolutionarily conserved acetyltransferase
homologue, is required for multiple steps in the
cell cycle
Rueyling Lina, C. David Allisb and Stephen J. Elledge*
Verna and Marrs McLean Department of Biochemistry, Howard Hughes Medical Institute, Baylor College of Medicine,
Houston, Texas 77030, USA
Communicated by : Virginia Zakian
Abstract
Background: Acetylation has been implicated in
many biological processes. Mutations in N-terminal
acetyltransferases have been shown to cause a
variety of phenotypes in Saccharomyces cerevisiae
including activation of heterochromatin, inability
to enter G0, and lethality. Histone acetylation has
been shown to play a role in transcription regulation, histone deposition and histone displacement
during spermatogenesis, although no known histone acetyltransferase is essential.
Results: Studies aimed at revealing a role for histone
H1 in yeast have uncovered a mutation in a putative
acetyltransferase, PAT1. The mutant ( pat1-1) cells
can live only in the presence of vertebrate H1. PAT1
is essential for mitotic growth in S. cerevisiae; mutant
cells depleted of the Pat1p show aberrant cellular
Introduction
The primary structural unit of chromatin in eukaryotes
is the nucleosome, which consists of two copies of
each core histone and 146 bp of DNA (McGhee &
Felsenfeld 1980). Higher eukaryotes also contain an
additional histone, H1, thought to be involved in
higher order chromatin structure and possibly transcriptional control (Allan et al. 1981; Zlatanova 1990).
All core histones can be divided into two functional
domains: a hydrophobic carboxy-terminal domain and
* Corresponding author : Fax: þ1 713 798 8515.
Present addresses: aFred Hutchinson Cancer Research Center,
1100 Fairview N., Seattle, WA 98109, USA; bDepart-ment of
Biology, University of Rochester, Rochester, NY 14627, USA
q Blackwell Science Limited
and nuclear morphology. PAT1 is required for
multiple cell cycle events, including passage
through START, DNA synthesis, and proper mitosis
through a microtubule-mediated process. The
S. pombe PAT1 gene was cloned by complementation
and shown to exist as part of a larger protein, the
unique portion of which is homologous to a second
S. cerevisiae gene. pat1 mutants show a variety of
mitotic defects including enhanced chromosome
loss, accumulation of multiple nuclei, generation of
giant cells, and displays classical cut phenotypes in
which cytokinesis occurs in the absence of proper
nuclear division and segregation.
Conclusion: PAT1 controls multiple processes in cell
cycle progression which suggests an essential role
for the acetylation of yet unknown substrate(s).
a hydrophilic amino-terminal tail (Smith 1991; Wolffe
& Pruss 1996a). The hydrophobic domains of core
histones are required for nucleosome assembly and cell
viability. Deletions of the N-terminal domain of any of
the core histones are viable (Wallis et al. 1983; Schuster
et al. 1986; Kayne et al. 1988). However, deletion of
the N-terminal domain of histone H4 de-represses
the silent mating site locus in yeast, suggesting that
this domain might play a role in the formation of
heterochromatin in vivo (Kayne et al. 1988). The
N-terminal domain of histone H4 contains several
highly conserved lysines that are differentially subjected
to reversible acetylation. Acetylation neutralizes the
positive charges on lysines and is thought to regulate
its interaction with negatively charged DNA (Allfrey
1977). Mutational analysis suggests that the ability to
Genes to Cells (1996) 1, 923–942 923
R Lin et al.
924 Genes to Cells (1996) 1, 923–942
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
modulate the positive charges on H4 amino terminus by
acetylation is more important than the positive charge
at these highly conserved positions (Megee et al. 1990;
Park & Szostak 1990; Durrin et al. 1991).
Acetylation is an energy intensive, dynamic phenomenon whose steady-state balance is mediated by the
opposing activities of histone acetyltransferase and
deacetylase enzyme systems. Recently, the non-essential
yeast gene GCN5 (Georgakopoulos & Thireos 1992),
was shown to be an A-type histone acetyltransferase,
demonstrating a strong link between histone acetylation
and regulated transcription (Brownell et al. 1996; Wolffe
& Pruss 1996b), and a mammalian histone deacetylase
has been related to the yeast transcriptional regulator
Rpd3p (Taunton et al. 1996). Taken together, these
data indicate that the steady-state balance of histone
acetylation plays a direct role in the modulation of
chromatin structure to create new patterns of transcription (Brownell & Allis 1996).
Histone H1, unlike core histones, is highly diverged
in sequence among species. However, most histone
H1s have a high percentage of lysines and share a
distinctive secondary structure: a central globular
domain that is flanked by a short N-terminal tail and
a long, highly charged C-terminal tail (Allan et al.
1980). Although histone H1 has been implicated in
many biological processes, including chromatin compaction and gene regulation (Allan et al. 1981;
Zlatanova 1990), its role in vivo is still unclear. This is
in part due to the fact that H1 has not been identified
in genetically tractable eukaryotes such as S. cerevisiae,
although a number of conventional approaches have
been taken (Certa et al. 1984; Srebreva et al. 1987).
Electron microscopic analyses have indicated that
chromatin in yeast cells can fold into a higher-order
structure that appears similar to the 30-nm filaments of
higher eukaryotic cells, suggesting that histone H1 or
H1-like protein exists in yeast (Allan et al. 1984; Lowary
& Widom 1989).
In this study, we describe an attempt to identify a
yeast histone H1 homologue by screening for yeast
mutants whose growth is dependent on the expression
of a vertebrate H1. Consistent with the results of
Linder & Thoma (1994), we found that the low level
expression of an exogenous histone H1 in yeast does not
cause any obvious phenotype. A mutant that appears to
be dependent on H1 expression was isolated by the
colony-colour-sectoring assay. The wild-type gene
responsible for this phenotype was cloned and characterized. It encodes a small novel protein whose
function is essential for mitotic growth in Saccharomyces
cerevisiae and that shares significant homology to
acetyltransferases. Genetic analyses have indicated that
the PAT1 gene is involved in multiple steps in the cell
cycle: passage through START after an a-factor block,
the progression of DNA synthesis, and mitosis through
a microtubule-mediated process.
Results
Isolation of histone H1-dependent mutants
The chicken H1 11L (chH1) genomic sequence
was amplified by PCR and cloned into a centromeric expression vector pMW29. The resulting
plasmid, pMW29H1, contains a GAL1-chH1 fusion.
pMW29H1 was transformed into YMW1-6 and its
effect on cell growth was analysed. This strain has
doubling times of 81 min in SC glucose and 124 min in
SC galactose media at 30 8C, which are identical to the
doubling times of YMW1-6 under the same conditions.
Expression of chH1 was confirmed by both mRNA
Figure 1 (A) Deletion analysis defines the PAT1 genomic locus. A deletion series was generated from a complementing genomic clone
and tested for their ability to complement the pat1-1 mutation; plus signs (þ) indicate clones that complement and minus signs (–)
indicate a failure to complement. The complementation activity was narrowed to a 1.5 kb SacII fragment whose sequence is shown in
(B). The closed arrowhead points to the first ATG and the open arrow indicates the termination codon. pat1-∆2::HIS3 is a disrupted
allele in which NcoI-BalI fragment is replaced by a HIS3 cassette indicated as a hatched box. (B) The nucleotide sequence of the 1.5 kb
SacII fragment and predicted amino acid sequence of Pat1p. The numbering for both nucleic acid (plain) and amino acid (bold) are
shown to the left of these sequences. The region between amino acid 97 and 148 which is referred to as the ‘acetyltransferase domain’ in
(C) is shaded. (C) Comparison of the Pat1p sequence with other acetyltransferases and related sequences, including Staphylococcus aureus
atl gene product (STAPH, GENBANK accession number D17366), Escherichia coli streptothricin acetyltransferase (Sat3, g669115),
Pseudomonas aeruginosa 6 0 -N-acetyltransferase (AAC, M29695), Mouse spermidine/spermine N1-acetyltransferase (SSAT, L10244),
Saccharomyces cerevisiae L-A virus protein N-acetyltransferase (MAK3, Q03503), Saccharomyces cerevisiae hypothetical protein (SC8554.04,
Z46796), Saccharomyces cerevisiae protein involved in silencing HMR (Sas2p, U14548), Saccharomyces cerevisiae hypothetical protein
(YBL052C, Z35814), Saccharomyces cerevisiae N-terminal acetyltransferase (Ard1p, M11621), Saccharomyces cerevisiae histone
acetyltransferase (Hat1p, U33335), and Saccharomyces cerevisiae transcriptional activator (Gcn5p, X68628). Gaps are allowed to generate
the best alignment. Identical residues (to Pat1p) are indicated in black whereas conserved residues are shaded in grey.
q Blackwell Science Limited
Genes to Cells (1996) 1, 923–942 925
R Lin et al.
analysis and by the construction of a translational fusion
between chH1 and lacZ (data not shown).
A genetic screen was performed to identify mutants
whose growth is dependent on the expression of chH1.
These mutants are expected to be defective either in
the yeast histone H1 homologue or other genes that
are suppressible by chicken H1 protein. Cells with
lethal mutations in the desired gene are unable to grow
in the absence of the plasmid carrying chH1 and can be
identified by screening for mutants that are unable to
lose pMW29H1 in the absence of nutritional selection.
The screen is based on the colony-colour-sectoring
assay described previously (Kranz & Holm 1990; Zieler
et al. 1995) with which the plasmid loss can be easily
visualized by a colour change. This assay took advantage of the fact that ade2 yeast cells accumulate red
pigments but ade2 ade3 cells do not. When an ade2 ade3
strain carries ADE3 on an autonomously replicating
plasmid, it forms red colonies. White sectors form in
red colonies when cells lose plasmids during colony
growth (referred to as Sectþ phenotype).
Three main criteria were anticipated for
H1-dependent mutants; failure to survive plasmid loss
resulting in homogeneously red, non-sectoring (Sect – )
colonies; inability to grow on plates containing
5-fluoro orotic acid (5-FOA), and failure to grow
when chH1 expression is repressed on glucose media.
To isolate H1-dependent mutants, YMW1-6 containing pMW29H1 was mutagenized and plated on YPG
(galactose) plates. Forty Sect – mutants were isolated
from 30 000 examined colonies. These mutants
were tested for their ability to grow on SC-uracil
media and sensitivity to 5-FOA to ensure that the
Sect – phenotype was due to the retention of
pMW29H1 rather than reasons unrelated to the
plasmid. Yeast cells that contain URA3 are sensitive
to 5-FOA. Among the 40 Sect – mutants, 11 were able
to grow on SC-uracil plates but not 5-FOA plates.
These 11 mutants were further tested for their
dependency on galactose, which is indicative of the
dependency on the chH1 expression. The GAL1
promoter is repressed in the presence of glucose but
activated in the absence of glucose and in the presence
of galactose. Only one mutant, YRL4, showed
lethality on YPD plates. The other 10 Sect – mutants
that showed 5-FOA sensitivity but not galactose
dependency were similar to the background mutants
observed in Kranz & Holm (1990). The reason most of
these mutants maintain pMW29H1 was a requirement
for either ADE3 or URA3 genes. Using a plasmid
shuffle protocol (Rose & Fink 1987), we were able to
show that these mutants can lose pMW29H1 when a
926 Genes to Cells (1996) 1, 923–942
wild-type copy of URA3 or ADE3 on a second
plasmid was introduced (data not shown). They are
likely to be mutations involved in nucleoside metabolic pathways.
YRL4 was the only mutant that met all three criteria:
Sect – , 5-FOA sensitivity, and galactose-dependency.
The galactose dependency suggests that the mutation
in YRL4 is suppressed by the expression of H1 and not
another gene on the plasmid. However, the phenotype
of YRL4 appears to be unstable; old colonies
sometimes sector and grow on YEPD plates. Great
efforts have been made to address the dependency of
the expression of chH1 in YRL4. This includes plasmid
shuffling using a second plasmid containing either
wild-type or disrupted chH1 gene. Nevertheless, due
to the instability of this mutation, we were unable to
conclusively prove that it was the chH1 gene alone that
was responsible for suppression of this mutation. We
detected a fivefold increased level of chH1 message in
YRL4 compared to the level of chH1 message in wildtype controls (data not shown). This may indicate that
the mutant required higher levels of H1 expression
than originally expressed from this plasmid, which
might be an important factor complicating the
dependency analysis.
Isolation and characterization of the
PAT1 gene
The gene complementing the glucose lethality of YRL4
was isolated from genomic libraries as described in
Experimental procedures. One positive clone was
obtained from the centromeric-based genomic library
and nine were obtained from a YEP13-based genomic
library. All clones also complement both the Sect – and
5-FOA sensitive phenotypes of the mutation. Restriction mapping and Southern blotting analyses indicate
that a 5 kb region is shared by all 10 clones (Fig. 1A).
Further analyses revealed that the complementing
activity resides within a 0.6 kb XhoI-XbaI fragment
(Fig. 1A). The DNA sequence of a 1.5 kb SacII
fragment (Fig. 1B) was determined and it overlaps
with a sequence reported from a lambda clone from
chromosome VI (accession no. Z46255). The longest
open reading frame (ORF) in the 1.5 kb SacII fragment
is 480 bp, starting 47 bp downstream of the XhoI site
and ending 62 bp upstream of the XbaI site. When
Northern blot analysis was performed using the 0.6 kb
XhoI-XbaI fragment as a probe, a single band of about
700 nucleotides was detected in both wild-type and
YRL4 RNA (data not shown). The predicted amino
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
Figure 2 (A) Nucleic acid and deduced amino acid sequences of the spPAT1 cDNA. The numbering for both nucleic acid (plain)
and amino acid (bold) are shown to the left of these sequences. (B). The alignment of amino acid sequences among Pat1p, spPat1P and
YGL021. Identical residues are shaded and conserved residues are boxed.
acid sequence from this ORF shows no significant
homology with histone H1. However, a domain of this
protein (I97 to G152) shares significant homology with
many previously identified acetyltransferases (Fig. 1C)
and this gene was named PAT1 (for Putative Acetyl
Transferase). The original pat1-1 allele and the parental
PAT1 gene were isolated by gap repair, sequenced, and
pat1-1 was found to have a D99N mutation in the
homology domain indicating the relevance of this
domain to Pat1p function.
q Blackwell Science Limited
To help establish the position of the translational
initiation codon and the intron/exon structure of the
PAT1 gene, we isolated cDNAs. To accomplish this,
a yeast cDNA library was prepared in lYES-R (Elledge
et al. 1991). The RNA source of cDNA came from
the strain Y133 (MATa, ura3-52, lys2-801, ade2-101,
his3-∆200, Trp1∆). We obtained 1 × 108 independent
lambda clones. The 0.6 kb XhoI-XbaI fragment was
used to screen this library and 10 independent cDNA
clones were obtained that coincide with this ORF. Two
Genes to Cells (1996) 1, 923–942 927
R Lin et al.
Figure 3 Aberrant morphology of Pat1p depleted cells. Abnormal cellular (phase contrast, left-hand column) and nuclear (DAPI
stain, right-hand column) morphologies becomes apparent in YRL18 (pat1-∆2::HIS3/pRL46) when shifted from YPG (a,b) to YPD
(c–j) media for 24 h. Small arrows indicate aberrant nuclear segregation. Large arrows point to anucleated, large-budded cells.
Bar ¼ 20 mm.
of these were completely sequenced. The longer cDNA
contained sequences from –13 to þ548 according
to the genomic sequences in Fig. 1B where +1 is the
first ATG. The shorter cDNA contained sequences
from þ9 to þ551. The PAT1 gene contains no introns
and most likely utilizes the first ATG in the ORF as
928 Genes to Cells (1996) 1, 923–942
the initiation codon. This would generate a protein of
159 amino acids with predicted molecular weight of
19 203 Da.
To address the significance of this acetyltransferase
domain and possible phylogenetic conservation of this
gene we sought to isolate the S. pombe homologue by
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
complementation. An S. pombe cDNA library (Becker
et al. 1991) was used to complement a pat1 null mutant
(see Experimental procedures). Of 180 cDNA clones
capable of suppressing pat1, all contained the same gene.
The spPAT1 conceptual translation product is 356
amino acids (Fig. 2A) and the last 80 amino acids share
50% identity with the C-terminal half of the Pat1
protein (Fig. 2B). The homology extends beyond the
putative acetyltransferase homology domain. Interestingly, the N-terminal third of the spPat1p is homologous to another S. cerevisiae gene YGL021 (Fig. 2B), a
putative membrane protein on chromosome VII whose
disruption shows no phenotype (Chen et al. 1991). No
apparent membrane spanning domain is predicted from
the PAT1 protein sequence.
Taken together, the sequence analysis suggests that
PAT1 is not the yeast homologue of histone H1.
Instead, the homology with other acetyltransferases, the
conservation in the putative acetyltransferase domain
with its S. pombe functional homologue, and the missense mutation detected in the original pat1-1 mutation
all suggest that Pat1p is likely to be an acetyltransferase.
PAT1 is essential for mitotic growth
A pat1 disruption allele (pat1-∆2::HIS3) was generated
by one-step gene replacement in a diploid, YRL9,
and used to examine whether PAT1 is required for
mitotic growth. While the wild-type parental diploid
gave rise to tetrads with four viable spores, YRL9 gave
tetrads with only two viable spores which were always
His – . The inviable spores germinated and each gave
rise to an average of eight to 16 progeny cells. These
data indicates that PAT1 is essential for mitotic growth.
When PAT1, but not a disrupted pat1, on a LEU2
centromeric plasmid was introduced into YRL9, the
resulting strain gave rise to tetrads that often contained
greater than two viable spores. Every Hisþ spore was
also Leuþ , indicating that PAT1 is required for the
viability of spores containing the pat1-D2::HIS3 allele.
The inviability of a pat1 deletion strain can also be
rescued by the PAT1 cDNA under control of the GAL1
promoter. This was examined with both the longer
(–13 to +548, pRL45) and shorter (+9 to +551,
pRL46) cDNAs described above. The longer cDNA
produces a protein of 159 amino acids, whereas the
shorter cDNA produces a 148 amino acid protein
lacking the first 11 amino acids. While both cDNAs
rescue the spore inviability associated with the pat1
disruption allele on galactose media, they behave
differently on glucose media. When streaked on YPD
plates, the pat1 deletion strain that contains pRL45
q Blackwell Science Limited
(YRL17) could grow, while cells containing pRL46
(YRL18) could not.
Depletion of Pat1p results in multiple
phenotypes
To address the function of PAT1, we examined the
defects in YRL18 cells when Pat1p is gradually depleted
by turning off the expression of the truncated form of
PAT1 cDNA in the presence of glucose. Yeast cells were
grown in YPG medium to the early logarithmic phase
(OD600 ¼ 0.1), washed once with water, and diluted
20-fold in YPD medium. At different intervals after
transfer to YPD medium, cells were fixed and stained
with the DNA specific dye DAPI. The depletion of
Pat1p led to multiple phenotypes which became
apparent 20 h after cells were transferred to YPD
media (Fig. 3). Cell sizes varied dramatically, with a high
percentage (30%) of giant cells whose volumes enlarged
by < 100–200-fold (Fig. 3c–f). The majority of cells
were still attached to each other, generating long chains
and multiply budded cells. DAPI staining detected
defects in nuclear segregation which gave rise to cells
with either multiple nuclei (Fig. 3d,f,i) or lacking nuclei
(Fig. 3j). These enlarged cells and multi-nucleated
phenotypes have been observed in mutations which
affect bud emergence (Bender & Pringle 1991). It was
surprising to note that cytokinesis seemed to be
proceeding in anucleated cells; anucleated cells with
large buds were observed (large arrows in Fig. 3h,j),
although we cannot rule out the possibility that these
cells once had DNA, which was degraded prior to our
analysis. In addition, it appears that cytokinesis occurred
prior to the completion of nuclear migration and
segregation in some cells, causing uneven nuclear
division (see small arrows in Fig. 3e,f,g,i). However,
in many cases observed here, cells seemed unable to
complete cytokinesis when the nuclei were caught in
the neck portion of two cells. Therefore, many cells
were still connected, forming long chains. Whether
this is an arrested point or a part of a dynamic process
is still unclear. But the results obtained from a
temperature sensitive mutation described later strongly
suggest that this is an arrest point. The original pat1-1
mutant also exhibits the phenotype described here
when it is transferred to glucose media, but less severely
in galactose media. These results suggest that Pat1p
may play a role in mitosis, concerning chromosome
segregation and/or nuclear division. The phenotypic
heterogeneity in Pat1p-depleted cells indicates that
Pat1p is either involved in multiple processes or a
process that is essential throughout the cell cycle.
Genes to Cells (1996) 1, 923–942 929
R Lin et al.
Figure 4 Terminal phenotypes of the pat1-3 mutation (pat1-3/
pat1-∆2::HIS3, YRL34) at either the permissive (23 8C, a,b) or
nonpermissive temperatures (37 8C, c–h). Phase contrast micrographs are shown in the left-hand column and the DAPI staining
are shown in the right-hand column. Multi-nucleated cells are
indicated by open arrowheads and anucleated cells are pointed
by close arrowheads. Small arrows point to the ‘cut-like’ nuclear
division and large arrows indicate cells with diffused or
fragmented nuclei. Bar ¼ 20 mm.
Isolation of a temperature sensitive allele of
the PAT1 gene
Phenotypes resulting from depletion experiments,
although informative, lack the resolution that can be
obtained by rapidly inactivating the activity of a protein
using conditional mutants. Therefore, efforts were
made to isolate Ts – PAT1 alleles by in vitro mutagenizing a plasmid containing a wild-type PAT1 gene
followed by the plasmid shuffle method, as described
in Rose & Fink (1987). One Ts – allele (pat1-3) was
isolated from 20 000 clones screened. The plasmid
pRL71, which contains pat1-3, can confer the Ts –
phenotype on cells whenever it is reintroduced into a
pat1-∆2::HIS3 mutant strain. The pat1-3 mutant strain
(YRL34) had slightly longer generation times (132 min)
than wild-type (CRY1, 90 min) or phenotypically
930 Genes to Cells (1996) 1, 923–942
wild-type (YRL37, 111 min) control strains at 23 8C,
suggesting that pat1-3 mutants are partially defective,
even at permissive temperatures.
The growth of the pat1-3 strain upon temperature
shift to 37 8C was examined and found to arrest growth
prior to one complete cell doubling (data not shown).
The survival of the wild-type and mutant cells at 37 8C
as a function of time was also examined. Wild-type cells
tolerated the non-permissive temperature as expected,
but cells expressing the pat1-3 allele lost viability at
37 8C with a half-life of < 3 h (data not shown).
The terminal phenotypes of the pat1-3 mutants at
37 8C for 3.5 h were also examined (Fig. 4) and found to
show great similarity to those obtained in the depletion
experiment, but also revealed several unique phenotypes. For instance, the abnormality of chromatin
structure and nuclear segregation were apparent in
both cases, whereas giant cells and anucleated cells with
large buds were not observed in the pat1-3 mutant. At
37 8C, pat1-3 cells were not arrested at a defined cell
cycle stage, although an increase of large-budded cells
(G2-M phase, 42%) and a decrease of small-budded
cells (S phase, 17%) were observed compared to wildtype controls (23% and 25%, respectively) grown at
37 8C. Many cells were still attached to each other,
forming groups of three, four, or even more cells,
most of which had abnormal nuclei that were either
fragmented or had a threaded appearance (large arrows
in Fig. 4c,d). Nuclear segregation also appears to be
affected and a high percentage of nuclei were either
caught in the junction of two cells or improperly
segregated, resulting in multiple nucleated (open
arrowheads in Fig. 4e,g) or anucleated cells (closed
arrowheads in Fig. 4f,h). It was evident that cytokinesis
occurred prior to the completion of nuclear migration
and segregation, resulting in cut-like phenotypes (small
arrows in Fig. 4c,d,e,g; Hirano et al. 1986; Samejima
et al. 1993). However, cytokinesis of the pat1-3 mutant
was often incomplete, with the mother and daughter
cells connected by a bridge of nuclear material.
The pat1-3 mutant is sensitive to benomyl
Since the above data indicate that Pat1p might be
involved in nuclear segregation, a function in which
tubulin is involved, pat1 mutants were tested for its
sensitivity to an anti-microtubule drug, benomyl. It has
been shown that microtubule-mediated processes, such
as nuclear division, nuclear migration and nuclear
fusion, are inhibited in the presence of benomyl
(Quinlan et al. 1980; Delgado & Conde 1984; Jacobs
et al. 1988) and that many tubulin or tubulin-related
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
Figure 5 Benomyl sensitivity of pat1 mutants. YRL34 (pat1-3/pat1-itDelta2::HIS3, right half of the plate) and YRL37 (PAT1/pat1∆2::HIS3, left half of the plate) were streaked on YPD plates containing various amounts (0, 8, 16, 20 mg/mL) of the anti-tubulin drug,
benomyl. Plates were incubated at either the permissive (23 8C) or semi-permissive (31.5 8C) temperatures.
mutants are supersensitive to benomyl in yeast
(Umesono et al. 1983; Huffaker et al. 1988; Matsuzaki
et al. 1988; Schatz et al. 1988; Stearns et al. 1990). The
level of benomyl sensitivity is temperature dependent;
yeast cells are more sensitive to benomyl at lower
temperatures (Stearns et al. 1990).
If PAT1 is involved in a microtubule-mediated
process, the sensitivity to benomyl in pat1 mutant
cells might be exacerbated at conditions that are suboptimal for growth. In fact, the original pat1-1 mutant
(YRL4) was unable to grow on YPG plates containing
20 mg/mL benomyl at 30 8C. However, its parental
strain YMW1-6/pMW29H1 can grow in the presence
of up to 30 mg/mL benomyl at 30 8C. Introducing
a wild-type PAT1 gene to YRL4 restored its benomyl
resistance to the wild-type level (data not shown),
indicating that the sensitivity to benomyl in YRL4 is
associated with the pat1-1 mutation. We also examined
the benomyl sensitivity of the Ts – pat1-3 strain
(YRL34) at a semi-permissive temperature (31.5 8C,
Fig. 5). At the permissive temperature (23 8C), both
YRL34 and the Pat1+ control YRL37 show similar
sensitivity to benomyl; neither strain grows in the
presence of 16 mg/mL benomyl. At 31.5 8C, YRL34
grows very poorly at 16 mg/mL and dies at 20 mg/mL of
benomyl, whereas YRL37 grows well at 16 mg/mL
and poorly at 20 mg/mL of benomyl. This result
suggests that under conditions where pat1 mutants are
stressed but still viable, they show increased benomyl
sensitivity compared to wild-type cells. The sensitivity
to benomyl for pat1 is comparable to that for mutants
which are defective in processes involved in nuclear
q Blackwell Science Limited
division (Hoyt et al. 1991; Li & Murray 1991; Ursic
& Culbertson 1991) but is lower than that for
tubulin mutants (Matsuzaki et al. 1988; Schatz et al.
1988). This further suggests that Pat1p functions in
a process where tubulin or related proteins are also
involved.
pat1 mutants have defects in spindle
organization
Immunofluorescence was carried out with anti-tubulin
antibodies to visualize microtubules in the pat1-3
mutant. Figure 6 shows microtubule staining of
the pat1-3 strain at either permissive (23 8C) or nonpermissive (37 8C) temperatures. At 23 8C, the distribution of microtubules in pat1-3 (Fig. 6a–c) is
indistinguishable from that in the wild-type, in which
< 30% cells have elongated spindles (Pringle &
Hartwell 1981; Kilmartin & Adams 1984). After a
shift to 37 8C for 4 h, YRL34 (pat1-3) has very few
(< 3%) cells with elongated spindles; the majority of
cells have short spindles (small arrows in Fig. 6d–i)
which were similar to those observed in cells treated
with hydroxyurea, a DNA synthesis inhibitor (Byers
& Goetsch 1975; Hartwell 1976). However, unlike
spindles seen in hydroxyurea-treated cells that are
usually located between mother cells and their large
buds, spindles in YRL34 are seen even in unbudded and
small budded cells (Fig. 6d–f ). Further examination of
those short spindles revealed that some were in fact two
closely located spindle pole bodies (SPB, see closed
arrowheads in Fig. 6g–i,j,l,n). The intranuclear spindles
Genes to Cells (1996) 1, 923–942 931
R Lin et al.
Figure 6 Aberrant microtubular morphology in pat1-3 mutant cells. YRL34 (pat1-3/pat1-∆2::HIS3) incubated at either 23 8C (a,b,c)
or 37 8C (d-o) were prepared for immunofluorescence using anti-tubulin antibodies (YOL1/34) and FITC-conjugated second
antibodies. Cells were examined by either phase contrast (a,d,g, j,k), FITC-fluorescence (c,f,i,n,o) or DAPI (b,e,h,l,m) fluorescence
microscopy. The small arrows point to the short spindles observed in the pat1-3 mutation (d–i) at the nonpermissive temperature. This is
different from the elongated spindles seen in wild-type or pat1-3 of the same stage at permissive temperatures (large arrows in a–c). The
closed arrowheads indicate cells with two separated SPBs (g–i, j,l,n). The open arrowhead points to a mis-orientated spindle. Panels k,
m, and o show an example of a monopolar spindle in a dividing nucleus. Bar ¼ 20 mm.
typically seen were either missing or greatly reduced
here. Particularly revealing is the example shown in
Fig. 6, panels j, l and n, in which nuclei have already
separated and two SPBs are separated, yet are still at the
proximal ends of the two nuclei. This is distinct from
the wild-type cells at the same stage in which a long
spindle connected by SPBs at distal ends of two nuclei
is usually apparent (see large arrows in Fig. 6a–c). In
panels k, m and o, we show a large-budded cell whose
932 Genes to Cells (1996) 1, 923–942
nucleus begins to migrate toward the daughter cell; only
one SPB (or two but unseparated SPBs) was observed.
Usually in wild-type cells, one SPB is orientated toward
the bud site causing the spindle to orientate itself parallel
to the long axis of the cell. In the pat1-3 mutant,
misoriented spindles are often observed (open arrowheads in Fig. 6d–f ). This result suggests that the spindle
apparatus is affected in the pat1-3 mutant at 37 8C and
is consistent with other observations indicating that
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
pat1-3 is abnormal in nuclear segregation and is more
sensitive to benomyl.
A requirement for Pat1p function in G1 and
M phases
The pat1-3 Ts – mutants do not arrest at a defined point
of the cell cycle when shifted to nonpermissive
temperatures. However, there is an increase in the
large-budded cells and a decrease in the small-budded
cells, suggesting that PAT1 might be required for the S
phase in addition to mitosis. We performed FACS
analyses to examine the DNA contents of the pat1-3
mutant arrested at a nonpermissive temperature. When
an asynchronous pat1-3 culture is shifted to 37 8C
for 3.5 h, the majority of cells have DNA contents
either greater than 2C or less than 1C, suggesting the
occurrence of aberrant chromosome segregation (data
not shown). This was consistent with the observation
of ‘cut’ cells. To more precisely determine the defects
at particular cell cycle stages, this analysis was also
performed with cells synchronized with a-factor at
23 8C. After release from a-factor arrest, cells were
either transferred immediately or allowed to recover
at 23 8C for different intervals before transfer to 37 8C
and incubation for 3.5 h. Control strains proceeded
through the cell cycle synchronously after they were
released from the a-factor arrest but gradually lost
the synchrony after the second cycle. Figure 7 shows
the FACS profiles of a wild-type control arrested with
a-factor (a) and released from a-factor to the 37 8C for
3.5 h (b). It was clear that cells are arrested with 1C
DNA content in the presence of a-factor but lost the
synchrony (the majority of cells are still at the G2 of
the third cycle) after release from a-factor and
incubated for 3.5 h at 37 8C. When pat1-3 cells were
transferred to 37 8C immediately after release from the
a-factor arrest, their DNA remained unreplicated
(Fig. 7c,d) and cells were still schmooed after 3.5 h
(data not shown) suggesting that PAT1 is required for
exiting the a-factor block, passage through START, or
the initiation of DNA synthesis. When cells were
allowed to recover at 23 8C for 75 min (they appeared to
be small budded and have initiated DNA synthesis at
this point), they became arrested as large-budded cells,
the majority of which have a G2 DNA content after
3.5 h at 37 8C (Fig. 7n), suggesting that PAT1 is also
required for mitosis. If the recovery time at 23 8C was
shorter than 75 min (Fig. 7e,g,i,k), the majority of cells
showed DNA contents intermediate between 1C and
2C after 3.5 h at 37 8C (Fig. 7f,h,j,l). This result suggests
that PAT1 is also required for the progression of DNA
q Blackwell Science Limited
Figure 7 FACS analyses of a-factor-synchronized pat1-3
mutants. The pat1-3 mutant cells (pat1-3/pat1-∆2::HIS3,
YRL34) were synchronized with a-factor at 23 8C. After release
from a-factor, cells were either transferred immediately to 37 8C
(00 ) or allowed to recover for various periods of time (150 , 300 ,
450 , 600 and 750 ) at 23 8C before transfer to 37 8C (a,c,e,g,i,k,m).
After transfer to 37 8C, cells were incubated for 3.5 h
(b,d,f,h, j,l,n) and prepared for FACS analyses. y-axis indicates
cell count. x-axis indicates fluorescence obtained from propidium iodide. At least 10 000 cells were measured in each sample.
synthesis. The FACS analysis of pat1 Ts – mutants
released from a-factor arrest point is consistent with
other analyses suggesting that PAT1 is required for
multiple points of the cell cycle: to exit the a-factor
block, progression of DNA synthesis, and mitosis.
Genes to Cells (1996) 1, 923–942 933
R Lin et al.
Isolation of cold sensitive suppressors for the
pat1-3 Ts – mutation
We have isolated three spontaneous cold sensitive (Cs – )
suppressors to the Ts – pat1-3 mutation (see Experimental procedures). One is a dominant suppressor that
is recessive for the Cs – phenotype. The other two
(YRL40 and YRL41) belong to the same complementation group and are recessive for both Cs – and
suppression phenotypes. We isolate genomic clones that
complement the Cs – phenotype of YRL40 and show
that the gene responsible for the complementation is
a previously identified gene SAC1 (suppressor of actin,
Novick et al. 1989). SAC1 encodes an integral
membrane protein that localizes to the yeast Golgi
complex and ER (Whitters et al. 1993). It was shown by
gene disruption that the function of SAC1 is only
essential at temperatures below 17 8C (Novick et al.
1989). Although sac1 was originally isolated as an allelespecific Cs – suppressor to act1-1 Ts – mutation it was
also later shown to be capable of suppressing three
mutations that are in the secretory pathway, sec14, sec6
and sec9 (Cleves et al. 1989). We have generated a
sac1 deletion allele and shown that it is cold sensitive
as described by Novick et al. (1989), and that it fails
to suppress the pat1-3 temperature sensitivity at 37 8C
(Experimental procedures). sac1 null mutations also fail
to suppress act1-1 mutants. The isolation of sac1 as a
suppressor of pat1 potentially links Pat1p to actin and to
secretory-mediated processes.
Discussion
In this study, we have isolated a yeast mutation in the
gene PAT1 using a colony-colour-sectoring assay
for mutations whose growth depends on the expression
of a vertebrate histone H1. pat1-1 can be partially
suppressed by the presence of a plasmid expressing H1,
although we cannot explain how this suppression
occurs. We have shown that PAT1 is essential for
mitotic growth and that it encodes a small novel protein
which shares homology with several acetyltransferases.
Mutant cells depleted of Pat1p show aberrant cellular
and nuclear morphology. We have also shown using a
temperature sensitive mutation (pat1-3) that PAT1
functions at multiple steps in the cell cycle.
PAT1 is required at multiple steps in the cell
cycle
Our analysis of pat1 mutants suggests that PAT1 is
934 Genes to Cells (1996) 1, 923–942
required at multiple points in the cell cycle: to exit the
a-factor block, the progression of DNA synthesis, and
proper mitosis. pat1-3 mutant cells do not undergo
DNA replication and remain schmooed if transferred
immediately to 37 8C after release from a-factor. DNA
replication can occur and be completed, however, if
the pat1-3 mutant cells are allowed to recover at
permissive temperatures for 75 min before being shifted
to 37 8C. At 75 min, DNA synthesis is already initiated.
Nevertheless, the initiation of DNA synthesis is not
sufficient, because pat1-3 mutant cells recovered at
permissive temperatures for 60 min show a similar
extent of DNA synthesis but fail to complete DNA
synthesis when transferred to 37 8C. Both microscopic
examination using DAPI and FACS analyses suggest
that Pat1p is also required at mitosis for chromosome
segregation and nuclear division. The pleiotrophic
phenotype of the pat1 mutant is superficially similar to
the phenotypes caused by defects in protein synthesis
(Burke & Church 1991). Treatment with cycloheximide suggests that protein synthesis is required at
multiple steps in the cell cycle, including completion of
G1, initiation of DNA synthesis, progression from the
end of DNA synthesis to nuclear division, completion
of cytokinesis and cell separation. However, the nuclear
catastrophe observed during mitosis and chromosome
segregation defects indicated by FACS analyses in the
pat1-3 mutant are not observed in cycloheximide
treated yeast cells. Therefore, although PAT1 is involved
in multiple steps in the cell cycle, it is unlikely that
PAT1 functions by affecting protein synthesis.
Several mutants in S. pombe show a ‘cut’ phenotype
like that observed in pat1-3 Ts – mutants. These include
those defective in sister chromatid separation such as
topoisomerase II mutants (Goto & Wang 1985; Uemura
& Yanagida 1986) and those that produce premature or
inappropriate mitosis such as severe wee mutants (Enoch
& Nurse 1990) and certain checkpoint defective
mutants when DNA replication is delayed (Enoch
et al. 1991; Al-khodairy & Carr 1992; Rowley et al.
1992). Presumably, S. cerevisiae topoisomerases activate
a checkpoint that normally prevents cut phenotypes.
pat1 mutants on the other hand are defective in some
aspect of coordination of chromosome separation and
nuclear division with cytokinesis. While some checkpoints may be defective, the S phase checkpoint appears
to be intact because pat1 mutants are not sensitive
to hydroxyurea which blocks DNA replication. It
is curious that in a subset of cells observed using a Pat1p
depletion protocol there appears to be reduced
cytokinesis, with groups of cells connected to each
other while others in the Ts – pat1 mutants show this
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
Cut – phenotype. Clearly this points to a very
complicated set of defects in pat1 mutants.
The overall phenotypes of the pat1 mutation
resemble the phenotype of the double mutants in type
I (topI) and type II (topII) topoisomerases in yeast. The
complete defect in controlling the superhelical density
can only be observed in the topI-topII double mutants
whose phenotype is strikingly different from those of
either of the single mutant (Uemura & Yanagida 1984;
Goto & Wang 1985). At nonpermissive temperatures,
the Ts – topI-topII double mutant cells have diminished
DNA, RNA and protein synthesis and are quickly
arrested at various stages of the cell cycle with defects in
DNA synthesis, mitosis, nuclear division and chromosome segregation (Uemura & Yanagida 1984, 1986).
On the basis of these similarities between phenotypes of
pat1 mutants and topI-topII double mutants, it is
plausible to suggest that the PAT1 gene may somehow
be involved in the same pathway as topoisomerase I and
II to influence DNA superhelicity.
Does PAT1 encode an acetyltransferase?
PAT1 shows no resemblance to histone H1 in either
amino acid composition or secondary structure. However, we can not rule out the possibility that PAT1
is indirectly performing a role similar to histone H1 in
the regulation of higher order chromatin organization.
In support of a chromatin role, cells in the Pat1p
depletion experiments had chromatin with an unusual
‘threaded’ appearance, indicating a possible role for
Pat1p in higher-order chromatin structure; such a role
could explain the pleotrophic phenotypes associated
with pat1 mutants through modulation of gene
expression in a chromatin environment.
Several lines of evidence suggest that Pat1p is an
acetyltransferase. First, it has significant homology
with the conserved domain of several known acetyltransferases such as Hat1p (Kleff et al. 1995), Ard1p
(Mullen et al. 1989; Lee et al. 1989), Mak3p (Tercero &
Wickner 1992), and several bacterial acetyltransferases.
Secondly, the original pat1-1 mutation has a D99N
change within this conserved domain, suggesting that
this domain is important for Pat1p function. Finally,
an S. pombe gene that was isolated by its ability to
complement the S. cerevisiae pat1 deletion mutant also
contains a high conservation of the putative acetyltransferase domain. However, the spPat1p might have
additional functions or might function in a different
cellular compartment, since its N-terminal third is
homologous to another S. cerevisiae protein, a putative
membrane protein (Chen et al. 1991). Efforts have
q Blackwell Science Limited
been made to detect the acetyltransferase activity with
HA-tagged Pat1p. While the anti-HA antibody was able
to immunoprecipitate HA-Pat1p, no activity was so far
detected using either histones or tubulin as substrates
(data not shown). However, this analysis suffers from an
absence of knowledge of the proper substrate for this
protein and whether the antibody recognizes or inhibits
the active form of Pat1p.
Acetylation has been implicated in a wide variety of
biological processes. Acetylation of the N-terminal
NH2 occurs in almost all proteins co-translationally and
this modification appears to be essential for viability
in S. cerevisiae (Kulkarni & Sherman 1994). Three
N-terminal acetyltransferases have been identified in
S. cerevisiae, ARD1/NAT1, NAT2 and MAK3 (Lee
et al. 1989; Mullen et al. 1989; Park & Szostak 1992;
Tercero & Wickner 1992; Kulkarni & Sherman 1994).
Mutations in nat2 cause lethality whereas mutations in
either nat1 or ard1 activate the silent mating type locus
(HML) and prevent cells from entering into G0
(Whiteway & Szostak 1985; Lee et al. 1989; Mullen
et al. 1989; Kulkarni & Sherman 1994). In addition,
N-terminal acetylation has been shown to be important for the processing of actin protein and the
polymerization of striated alpha tropomyosin as well
as its ability to bind to F-actin (Hitchcock-DeGregori
& Heald 1987; Cook et al. 1991; Urbancikova &
Hitchcock-DeGregori 1994).
A second kind of acetylation occurs posttranslationally on the NH2 group of internal lysines.
One of the better studied examples of internal
acetylation occurs on the N-terminal domains of all
core histones. Strong correlations have been made
between histone acetylation and histone deposition
(Allis et al. 1985; Csordas 1990), transcriptional activity
of certain genes (Hebbes et al. 1988; Csordas 1990;
Wolffe 1994; Brownell et al. 1996; Wolffe & Pruss
1996b), and histone displacement during mammalian
spermatogenesis (Christensen & Dixon 1982). The
lysines (K5, K8, K12, K16) that can be subjected
to acetylation on the N-terminal domain of histone
H4 are highly conserved in evolution. Cells with
substitution of asparagine for all lysines in this domain
are not viable (Megee et al. 1990), whereas substitution
of arginine for these lysines results in either very slow
growing (Durrin et al. 1991) or lethal (Megee et al.
1990) phenotypes. Substituting glutamine for all four
lysines is not lethal, but confers several phenotypes,
including prolonged S and G2+M periods of the
division cycle, mating sterility and temperature sensitive
growth (Megee et al. 1990). Recently, it was shown
that certain patterns of acetylation are essential for the
Genes to Cells (1996) 1, 923–942 935
R Lin et al.
efficient silencing of transcription at the mating type
loci: K16 must be deacetylated and at least K5 or K12
must be acetylated (Park & Szostak 1990; Braunstein
et al. 1996). In addition, heterochromatin in yeast
and flies is enriched in histone H4 that is acetylated at
a specific lysine residue, K12 (Braunstein et al. 1996;
Turner et al. 1992). Taken together, these results
suggest that while the positive charge contained in the
N-terminal domains of H4 (Johnson et al. 1990; Megee
et al. 1990; Park & Szostak 1990) and H3 (Thompson
et al. 1994) contributes to the formation and/or stability
of heterochromatin in yeast, acetylation of specific
lysine residues (K12) also plays an important role.
Presumably acetylation influences heterochromatin
formation through protein–protein interactions that
are only beginning to be defined (Hecht et al. 1995).
Although we have not shown that Pat1p exhibits
acetyltransferase activity, it is possible that Pat1p is a
histone acetyltransferase in S. cerevisiae. To date, none of
the current histone acetyltransferases that have been
cloned are essential. Given the increasingly clear
involvement of histone acetylation/deacetylation in
the activation/repression of at least some yeast genes
(Brownell et al. 1996; Taunton et al. 1996), it is not
difficult to imagine that mutations in histone acetyltransferases can indirectly affect multiple cellular functions through changes in gene expression. We do not
know why the expression of a vertebrate histone H1
suppresses the original pat1-1 (but not pat1-∆2::HIS3
nor pat1-3) mutation, although a link to chromatin
is suggested. Both histone H1 and acetylation on the
core histone amino-terminal domains are thought
to modulate the higher order chromatin organization,
and several studies have shown that H1-mediated
reactions are affected by the core histone aminoterminal domains and their acetylation (Ridsdale et al.
1990; Perry & Annunziato 1991; Juan et al. 1994). An
intriguing possibility is that Pat1p functions in the
acetylation of lysine 12, which appears to be associated
with heterochromatin in yeast (Braunstein et al. 1996).
Inability to acetylate lysine 12 and establish proper
heterochromatin formation might result in the
‘threaded’ and ‘diffused’ chromatin observed in the
pat1 mutants. In this scenario, expression of a vertebrate H1 might help to counteract the compromised
organization of heterochromatin caused by the lack
of acetylation at lysine 12 in H4.
Suppression of the pat1-3 by sac1 mutations
Our suppressor analysis on the pat1-3 Ts – mutation has
identified two sac1 Cs – mutations. sac1 was initially
936 Genes to Cells (1996) 1, 923–942
identified as an allele-specific suppressor to the act1-1
Ts – mutation, and is distinguishable from all other sac
mutations in its capability to suppress some secretion
mutants in addition to act1-1 (Cleves et al. 1989; Novick
et al. 1989). It is an integral membrane protein in
Golgi and ER (Whitters et al. 1993). We do not at
present understand why mutations in SAC1 suppress
the pat1-3 mutation, but would like to speculate on
two possibilities. It was proposed that SAC1 might play
a role in biological events whereby secretory and
cytoskeletal activities are coordinated. Although we
have not detected abnormalities in the actin network in
the pat1-3 mutants, it does affect the microtubule
organization and benomyl sensitivity. It has been shown
in many cases that the actin and microtubule machinery
interact (Schmit & Lambert 1988; Lillie & Brown 1992;
Pedrotti et al. 1994; Ursic et al. 1994), therefore it is
possible that sac1 also suppress some microtubulerelated defects. It has been suggested that acetylation
increases the stability of microtubule and rabbit skeletal
troponin C and also increases the interaction of the
latter with other troponin components (Maruta et al.
1986; Grabarek et al. 1995). Perhaps pat1 mutants are
affecting the ability of these two networks to properly
interact. Intriguingly, Smy1 is a microtubule-based
motor protein which was isolated as a multi-copy
suppressor of a mutation in an actin-based motor
protein, Myo2, whose function has been implicated in
the process of polarized secretion in yeast (Lillie &
Brown 1992).
A second possibility is that although Pat1p does not
contain an obvious transmembrane domain, it might
associate with membrane through interaction with a
membrane protein. The interaction might allow
Pat1p to function in a particular cellular compartment
or facilitate the assembly of Pat1p into a complex.
Mutations in pat1-3 might affect the association with
this hypothetical membrane protein and disable Pat1p
from functioning in the proper cellular compartment.
Since mutations in sac1 can suppress—and in some cases
bypass—several mutations in the secretory pathway,
they might suppress pat1-3 by allowing the interaction
between Pat1p and the proper membrane protein or
by allowing Pat1p to be located in the proper cellular
compartment. This notion is supported by the interesting observation that spPat1p consists of two separate
domains, each of which is homologous to a different
S. cerevisiae protein. The N-terminal third is homologous to a putative transmembrane protein, YGL021,
and the C-terminal third is to Pat1p. Nevertheless,
YGL021 deletion does not result in any detectable
phenotype (Chen et al. 1991). If the function of
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
Table 1 Strains used in this study
Strain
YMW1-6
CRY1
CRY1U6
CRY1L
CRY3
YRL4
YRL9
YRL17
YRL18
YRL26
YRL13
YRL30
YRL34
YRL37
YRL40
YRL41
YRL98
YRL101
YRL102
YRL127
YRL130
Plasmid
pUN105
pMW29H1
pRL45
pRL46
pRL57
pRL71
pRL71
pRL58
pUN105
pUN105
pUN105
Genotype
MATa ade2-1 ade3D his3-11,15 leu2-3, 112 ura3-1
MATa can1-100 ade2-1 his3-11, 15 leu2-3, 112 trp1-1 ura3-1
MATa can1-100 ade2-1 his3-11, 15 leu2-3, 112 trp1-1 URA3
MATa can1-100 ade2-1 his3-11, 15 leu2-3, 112 trp1-1 ura3–1 (LEU2)
MATa/MATa can1-100 ade2-1 his3-11, 15 leu2-3, 112 trp1-1 ura3-1
MATa YMW1-6 pat1-1 (URA3 ADE3)
MATa/MATa CRY3 PAT1/pat1-∆2::HIS3
As CRY1 but MATa pat1-∆2::HIS3 (URA3 GAL1-PAT1 †)
As CRY1 but MATa pat1-∆2::HIS3 (URA3 GAL1-PAT1‡)
As CRY1 but MATa pat1-∆2::HIS3 (URA3 PAT1)
As CRY3 but PAT1/PAT1::HIS3
As CRY1 but MATa pat1-∆2::HIS3 (LEU2 pat1-3)
As CRY1 but pat1-∆2::HIS3 (LEU2 pat1-3)
As CRY1 but pat1-∆2::HIS3 (LEU2 PAT1)
As CRY1 but MATa sac1 pat1-∆2::HIS3 (LEU2 pat1-3)
As CRY1 but MATa sac1∆2::HIS3 (LEU2 pat1-3)
MATa/MATa can1-100 ade2-1 his3-11, 15 leu2-3, 112/LEU2 trp1-1 ura3-1/URA3 CS/cs
MATa/MATa can1-100 ade2-1 his3-11, 15 leu2-3, 112/LEU2 trp1-1 ura3-1/URA3 CS/cs::sac1∆
MATa/MATa can1-100 ade2-1 his3-11, 15 leu2-3, 112/LEU2 trp1-1 ura3-1/URA3 CS/cs::sac1∆
As CRY1 but MATa pat1-∆2::HIS3, LEU2::GAL1-PAT1‡
As CRY1 but sac1::URA3
* Zieler et al. 1995.
† PAT1 cDNA.
‡ Shorter version of PAT1 cDNA.
Markers in parentheses reside on the plasmid.
Pat1p was dependent on interaction with a membrane
protein, it would have to be a protein other than
YGL021.
Experimental procedures
Strains, media and microbial techniques
Strains used in this study are listed in Table 1. Yeast media were
prepared as in Sherman et al. (1986). When appropriate, 2%
galactose was used in place of 2% glucose. Unless otherwise
stated, all yeast strains were grown at 30 8C. Benomyl was
dissolved in dimethylsulphoxide (DMSO) as a 30 mg/mL stock.
Yeast transformations were performed by the lithium acetate
method (Ito et al. 1983). JM107 was used as a host for all plasmid
constructions and amplification. XL1Blue was used for the
preparation of single stranded DNA, and LE392 was used as a
host for the l phage (Elledge et al. 1991).
To isolate the pat1-1 allele, YMW1-6 containing plasmid
pMW29H1 was mutagenized with EMS to 60% survival, as
described in Sherman et al. (1986), resuspended in YPG medium
to a density of 2 × 107 cells/mL, incubated for 4 h and plated on
YPG plates at a density of < 700 colonies/150 mm plate, and
q Blackwell Science Limited
allowed to grow at 30 8C for 5–7 days before identifying
homogeneously red colonies.
The pat1-∆2::HIS3 allele was generated by transforming a
pat1 disruption construct, pRL9 (see below) cleaved with SacII,
into the diploid CRY3 and selecting for histidine prototrophy.
Homologous recombinants were verified by Southern analysis.
The resulting strain YRL9 is heterozygous for the disrupted pat1
locus (pat1-∆2::HIS3/PAT1) and was sporulated and examined
for the viability of its progeny by tetrad analyses.
The pat1-3 Ts – allele was isolated by the in vitro mutagenesis of
pRL58 with hydroxylamine and detected using a plasmid shuffle
protocol according to procedures described previously (Rose &
Fink 1987; Sikorski & Boeke 1990). Mutagenized pRL58 was
transformed into YRL26 (pat1-D2::HIS3) carrying PAT1 on a
centromeric URA3 plasmid (pRL57) treated as described
(Sikorski & Boeke 1990). Only one temperature sensitive
clone, pat1-3, was obtained from 20 000 colonies. The plasmid
(pRL71) carrying the pat1-3 mutation was recovered from yeast
and provides temperature sensitivity when reintroduced into a
PAT1 disrupted strain.
Plasmid constructions and DNA manipulation
Plasmids related to this study are listed in Table 2. DNA
Genes to Cells (1996) 1, 923–942 937
R Lin et al.
Table 2 Plasmids used in this study
Plasmids
Yeast marker
Relevant features and comments
pMW29H1
pUN105
pRL45
pRL46
pSS1.5
pRL57
pRL58
pRL55
pRL56
pRL71
pRL9
pRL131
pRL149
URA3
LEU2
URA3
URA3
LEU2
URA3
LEU2
URA3
URA3
LEU2
LEU2
URA3
LEU2
GAL1-chH1, ADE3, CEN4*
CEN4†
GAL1-PAT1‡, CEN4
GAL1-PAT1§, CEN4
1.5 kb SacII fragment containing PAT1, CEN4
0.6 kb XhoI-XbaI fragment containing PAT1, CEN4
0.6 kb XhoI-XbaI fragment containing PAT1, CEN4
GAL-chH1-lacZ, CEN4
similar to pRL55, lacZ was fused out of frame with chH1, CEN4
pat1-3, CEN4
pat1-∆2::HIS3, CEN4
2.4 kb genomic fragment containing SAC1, CEN4
an integration plasmid containing GAL1-PAT1
*
†
‡
§
Provided by Mark Walberg.
Elledge & Davis 1988.
Longer PAT1 cDNA.
Shorter PAT1 cDNA.
manipulations are essentially as described in Maniatis et al. (1982).
The chicken histone H1 gene 11 L (chH1) contains no intron and
was amplified from chicken genomic DNA by polymerase chain
reaction (PCR) with the following two oligonucleotides:
TCTCCTCGAGCAGCTCCGACATGTC and GCGGGTC
AAGGGAATTCTCCCACAAG (Coles et al. 1987). This
711 bp fragment was digested with XhoI and EcoRI, whose
recognition sites are underlined in the 50 and 30 oligonucleotides,
respectively, and subcloned into XhoI-EcoRI cleaved Bluescript
pBSKSIIþ. The chH1 clone was sequenced to ensure that no
errors were generated by PCR. The chH1 gene was then digested
with XhoI, filled in with dNTPs and Klenow, digested with
XbaI, and cloned into the SmaI-XbaI digested pMW29 (kindly
provided by Mark Walberg, VT Southwestern, Dallas, Zieler et
al. 1995) to make pMW29H1.
The molecular characterization of genomic DNA containing
the PAT1 locus was performed with a genomic clone isolated
from the centromeric-based library. The 1.5 kb SacII fragment
was subcloned into pUN105 (Elledge & Davis 1988) giving rise
to pSS1.5. pRL58 was created by an internal deletion of the XbaI
fragment from pSS1.5 which removes the sequence downstream
of the XbaI site to a XbaI site in the vector. The SacII-XbaI
fragment was subcloned from pRL58 into SacII and XbaI
digested pUN95 (Elledge & Davis 1988), giving pRL57. The
deletion construct, pRL9, was generated by replacing the NcoIBalI fragment on pSS1.5 with a 2.5 kb HIS3 cassette from pJA50
containing the HIS3 and the Tn 5 neo genes (Allen & Elledge
1994).
PAT1 cDNA clones from the yeast cDNA library were
subcloned as XhoI fragments into XhoI-cleaved pBSKSIIþ for
sequencing or XhoI-cleaved pSE936 to place them under GAL1
control.
938 Genes to Cells (1996) 1, 923–942
Sequencing was performed by the generation of a series of
nested deletion clones generated by DNaseI as described in
Maniatis et al. (1982). Single-stranded DNAs were prepared
following the methods of Zagursky & Berman (1984), using the
helper phage R408 (Russel et al. 1986). All sequencing was
performed on both strands by the dideoxy chain termination
method (Sanger et al. 1977).
The GAL1-PAT1 cDNA was purified as a ScaI-XbaI fragment
from pRL46 (lacking the first three amino acids of Pat1p)
and subcloned onto the SmaI and XbaI digested pIClac28, an
integration vector (Gietz & Sugino 1988). The resulting
plasmid pRL149 was digested with EcoRV and transformed the
yeast strain YRL26. The yeast transformant was streaked on
SC-Leu galactose plates, followed by 5-FOA galactose plates to
remove the plasmid pRL57. The resulting strain YRL127
contains a disrupted pat1 gene (pat1-∆2::HIS3) and a GAL1PAT1 cDNA integrated to the LEU2 locus.
Isolation of the PAT1 gene
YRL4 (pat1-1) was transformed with two LEU2 genomic
libraries, one in p366, LEU2 CEN, or YEP13 LEU2 2m
(Nasmyth & Reed 1980) yeast shuttle vectors. Transformants
were selected on SC-leucine glucose plates. Approximately
100 000 transformants were screened from each library. One
PAT1 clone from the p366-based library and nine from the
YEP13 library were isolated, all contained the same gene and
were able to complement all the pat1 phenotypes.
To ensure the phenotype of YRL4 is indeed due to defects in
the PAT1 gene we PCR amplified the PAT1 locus from YRL4
and showed that it fails to complement a pat1 deletion strain to
the wild-type level. The PAT1 locus from either a wild-type
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
strain (YMW1-6) or YRL4 was amplified using oligonucleotides
flanking the PAT1 ORF. These two PCR products were
separately digested with SacI and XbaI and subcloned to SacI
XbaI digested pUN105. Five independent clones were obtained
from each PCR and transformed into YRL26 (pat1-∆2::HIS3,
pRL57). pRL58 and pUN105 were served as positive and
negative controls, respectively. Transformants were selected on
SC-Leu-Ura plates and, from each clone, four transformants
were streaked on 5-FOA plates to test whether the new plasmid
can replace pRL57 and complement pat1 deletion. While all
clones grow equally well on the SC-Leu-Ura plates, only clones
from wild-type DNA and pRL58 can fully substitute pRL57 and
grow well on 5-FOA plates. All clones from YRL4 DNA only
partially substitute pRL57 and grow poorly on 5-FOA plates;
both the number and size of colonies on 5-FOA were greatly
reduced. This result indicates that YRL4 has defects in the PAT1
locus instead of having another mutation that is suppressible by
the PAT1 gene.
Isolation of Schizosaccharomyces pombe PAT1
homologue by functional complementation
YRL127 contains pat1-D2::HIS3 and survives due to the GAL1PAT1 cDNA integrated in LEU2 locus. YRL127 is unable to
grow on glucose plates but grows well on galactose plates. An
S. pombe cDNA library under ADH promoter control in pDB20
(URA3, 2m, Becker et al. 1991) was transformed in YRL127 and
the transformant was selected on SC-Ura glucose plates. From
over 200 000 transformants screened, 180 positive clones were
obtained that suppress the inviability of YRL127 on glucose in
a 5-FOA-dependent manner. Hybridization analysis showed
that all the 185 clones belonged to the same gene. Further
restriction mapping was carried out on nine clones and showed
that they all contain a cDNA insert of < 1.3 kb and all have an
internal HindIII site that is 1 kb from one end. Only one cDNA
clone was sequenced. The sequence was confirmed by the S.
pombe sequencing project from the Sanger Center.
pat1-3 suppressor screen
The spontaneous reversion rate for the pat1-3 Ts – allele (YRL30)
at 37 8C is < 3.5 × 10 –7. Two hundred independent YRL30
colonies grown at 23 8C were inoculated into 200 individual 3 mL
liquid YPD media to a density of around 1 × 107/mL. From each
individual culture, 1 × 107 cells were spun down and plated on to
a 10 mm YPD plate. After 2 days incubation at 37 8C, colonies
grown were replica-plated on to two YPD plates, and grown at
23 and 37 8C, respectively. Colonies that grow at 37 8C, but not
23 8C contain candidate Cs – suppressors of the pat1-3 allele. Only
one clone from each original plate was analysed further. Three
clones that belong to two complementation groups were isolated.
The first group is a dominant suppressor but is recessive for
the Cs – phenotype and was not further characterized. The
second group contains two members and are named YRL40
and YRL41.
q Blackwell Science Limited
Characterization of the SAC clones
Genomic clones complementing the Cs – lethality of YRL40
were isolated from a yeast centromeric genomic library. A 2.4 kb
XbaI fragment was cloned to XbaI-cleaved pUN70 (Elledge &
Davis 1988) resulting in pRL131 which was shown to be
sufficient for the complementation. Partial sequencing analysis
revealed that this genomic clone contains a previously identified
gene, SAC1 (Whitters et al. 1993). A frame shift introduced to
the SAC1 ORF on pRL131 eliminated its ability to complement
YRL40. The sac1 disruption allele was generated by replacing the
1.3 kb XhoI-BclI fragment with a 2.4 kb BamHI-XhoI URA3
cassette from pJA53 (Allen & Elledge 1994). A sac1 deletion
mutant (YRL130) is cold sensitive at temperatures below 17 8C,
consistent with results described by Novick et al. (1989). To
analyse whether a sac1 deletion mutation can suppress the
temperature sensitivity of pat1-3, YRL130 was mated with
YRL30 (pat1-∆2::HIS3/pat1-3) and diploids were selected on
SC-Leu-Ura plates. These diploids were sporulated at 23 8C and
the viable spores that are Uraþ Leuþ Hisþ are tested for their
viability at 37 8C. Of 10 such spores analysed, none were able to
grow at 37 8C, suggesting that a sac1 deletion mutation cannot
suppress the pat1-3 temperature sensitivity. Tetrad analyses were
also performed to ensure that the Cs – phenotype in YRL40 is
linked to the SAC1 locus. YRL40 was mated to CRY1U6 and
the diploid was sporulated. Cs – spores that were His – Leu – Uraþ
were mated to CRY1 L to generate YRL98 (Csþ /Cs – ). YRL98
was then transformed with a sac1 disruption allele which was
generated by replacing the 1.3 kb XhoI-BclI fragment with a
2.5 kb BamHI-SalI HIS3 cassette from pJA50 (Allen & Elledge
1994). His+ transformants were selected and sporulated. Two
Hisþ transformants, YRL101 and YRL102, were sporulated for
tetrad analysis. Since it is not known whether the sac1 disruption
occurs on the wild-type or sac1-2 allele, there were two possible
outcomes of sporulation. If the original Cs – mutant is in the
SAC1 gene, we would obtain either 4:0 or 2:2 Cs – /Csþ
segregation in each tetrad dissected. If the Cs – phenotype is due
to a mutation unlinked to SAC1, then we would observe
both DT, NPT and TT. Twenty tetrads for each strain were
analysed from YRL101 and YRL102 and they all have only two
Cs – spores, which are also always Hisþ , indicating that the Cs –
phenotype in YRL40 is linked to the SAC1 locus.
Immunofluorescence and microscopy
The immunofluorescence procedure described by Kilmartin &
Adams (1984) was followed with the exception that cells were
fixed in formaldehyde for 2 h at 30 8C and cell walls were
subsequently removed by treatment with 50 mg/mL Zymolyase
100T for 1 h at 37 8C. Rat monoclonal anti-tubulin antibody
YOL 1/34 and FITC-conjugated goat anti-rat IgG antiserum
were obtained from Accurate Chemical & Scientific Corporation
(Westbury, NY). After incubation with the secondary antibody,
cells were stained with 1 mg/mL DAPI for 5 min. In cases where
only DAPI staining was required, cells were fixed in 95% ethanol,
incubated 1 mg/mL DAPI for 5 min at room temperature. Cells
were then washed five times with water, resuspended in 100%
Genes to Cells (1996) 1, 923–942 939
R Lin et al.
methanol, and applied to poly-lysine coated slides. Preparations
were viewed on a Zeiss Axioscope equipped for epifluorescence
microscopy (Carl Zeiss, Germany).
Cell-cycle synchronization and f low
cytometry
Cells were grown in YPD at pH 3.9 to an OD600 of 0.2 at
23 8C. a-factor was added to a final concentration of 10 mM/mL.
Cells were incubated for 3 h, during which time an additional
10 mM/mL of a-factor was added every hour. When < 90% of
the cells appeared unbudded and schmooed, cells were pelleted,
washed twice with YPD of normal pH, and resuspended in YPD
to a final density of 1 × 106 cells/mL. Cells were then either
shifted to 37 8C immediately or allowed to recover at 23 8C for
various lengths of time (every 15 min up to 75 min) before
shifting to 37 8C. Cells were incubated for 3.5 h at 37 8C and
prepared for cytological examination or for flow cytometry
analyses.
Yeast cells were prepared for flow cytometry as described
by Hutter & Eipel (1979). The flow cytometer used was a
Coulter Epics 753 (Coulter Electronics, Hialeah, FL). The
excitation wavelength was 488 nm. A barrier filter was used to
remove emissions above 590 nm.
Acknowledgements
We thank Mark Walberg for providing materials for our genetic
screen and P. Hieter and F. Spencer, Johns Hopkins University,
for the genomic library. We also thank Z. Chen, R. Gibbs and
W. Schober for advice. This work was supported by grants from
the National Institutes of Health, nos NIH GM44664 to S.J.E.
and NIH GM53512 to C.D.A. S.J.E. is a PEW Scholar in the
Biomedical Sciences and an Investigator of the Howard Hughes
Medical Institute.
References
Al-khodairy, F. & Carr, A.M. (1992) DNA repair mutants
defining G2 checkpoint pathways in Schizosaccharomyces pombe.
EMBO J. 11, 1343–1350.
Allan, J., Cattini, P., Cowling, G.J., Craigie, R., Harborne, N. &
Gould, H. (1981) Regulation of the higher-order structure of
chromatin by histone H1 and H5. J. Cell. Biol. 90, 279–288.
Allan, J., Hartman, P.G., Crane-Robinson, C. & Aviles, F.X.
(1980) The structure of histone H1 and its location in the
chromatin. Nature 288, 675–679.
Allan, J., Rau, D.C., Harborne, N. & Gould, H. (1984) Higher
order structure in a short repeat length chromatin. J. Cell. Biol.
98, 1320–1327.
Allen, J.B. & Elledge, S.J. (1994) A family of vectors that facilitate
transposon and insertional mutagenesis of cloned genes in
yeast. Yeast 10, 1267–1272.
Allfrey, V.G. (1977) Post-synthetic modifications of histone
structure: A mechanism for the control of chromosome
structure by the modulation of histone–DNA interactions. In:
940 Genes to Cells (1996) 1, 923–942
Chromatin and Chromosome Structure (eds J. Li & R. Eckhadt),
pp. 167–191. New York: Academic Press Inc.
Allis, C.D., Chicoine, L.G., Richman, R. & Schulman, I.G.
(1985) Deposition-related histone acetylation in macronuclei
of conjugating Tetrahymena. Proc. Natl. Acad. Sci. USA 82,
8048–8052.
Becker, D.M., Fikes, J.D. & Guarente, L. (1991) A cDNA
encoding a human CCAAT-binding protein cloned by
functional complementation in yeast. Proc. Natl. Acad. Sci.
USA 88, 1968–1972.
Bender, A. & Pringle, J.R. (1991) Use of a screen for synthetic
lethal and multicopy suppressee mutants to identify two new
genes involved in morphogenesis in Saccharomyces cerevisiae.
Mol. Cell. Biol. 11, 1295–1301.
Braunstein, M., Sobel, R.E., Allis, C.D., Turner, B.M. & Broach,
J.R. (1996) Transcriptional silencing in yeast requires a
heterochromatin histone acetylation pattern. Submitted.
Brownell, J. & Allis, C.D. (1996) Special HATs for special
occasions: Linking histone acetylation to chromatin assembly
and gene activation. Curr. Opin. Genet. Dev. 6, 176–184.
Brownell, J.E., Zhou, J. & Ranalli, T., et al. (1996) Tetrahymena
histone acetyltransferase A: a transcriptional co-activator
linking gene expression to histone acetylation. Cell 84, 843–
851.
Burke, D.J. & Church, D. (1991) Protein synthesis requirements
for nuclear division, cytokinesis, and cell separation in
Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 3691–3698.
Byers, B. & Goetsch, L. (1975) Behavior of spindles and spindle
plaques in the cell cycle and conjugation of Saccharomyces
cerevisiae. J. Bacteriol. 124, 511–523.
Certa, U., Colavito-Shepanski, M. & Grunstein, M. (1984) Yeast
may not contain histone H1: the only known ‘histone
H1-like’ protein in Saccharomyces cerevisiae is a mitochondrial
protein. Nucl. Acids Res. 12, 7975–7985.
Chen, W., Capieaux, E., Balzi, E. & Goffeau, A. (1991) The
YGL021 gene encodes a putative membrane protein with a
putative leucine zipper motif. Yeast 7, 301–303.
Christensen, M.E. & Dixon, G.H. (1982) Hyperacetylation of
histone H4 correlates with the terminal, transcriptionally
inactive stages of spermatogenesis in rainbow trout. Dev. Biol.
93, 404–415.
Cleves, A.E., Novick, P.J. & Bankaitis, V.A. (1989) Mutations in
the SAC1 gene suppress defects in yeast Golgi and yeast actin
function. J. Cell. Biol. 109, 2939–2950.
Coles, L.S., Robins, A.J., Madley, L.K. & Wells, J.R.E. (1987)
Characterization of the chicken H1 gene complement:
Generation of a complete set of vertebrate H1 protein
sequences. J. Biol. Chem. 262, 9656–9663.
Cook, R.K., Sheff, D.R. & Rubenstein, P.A. (1991) Unusual
metabolism of the yeast actin amino terminus. J. Biol. Chem.
266, 16825–16833.
Csordas, A. (1990) On the biological role of histone acetylation.
Biochem. J. 265, 23–38.
Delgado, M.A. & Conde, J. (1984) Benomyl prevents nuclear
fusion in Saccharomyces cerevisiae. Mol. Gen. Genet. 193, 188–
189.
Durrin, L.K., Mann, R.K., Kayne, P.S. & Grunstein, M. (1991)
Yeast histone H4 N-terminal sequence is required for
promoter activation in vivo. Cell 65, 1023–1031.
Elledge, S.J. & Davis, R.W. (1988) A family of versatile
centromeric vectors designed for use in the sectoring-shuffle
mutagenesis assay in Saccharomyces cerevisiae. Gene 70, 303–312.
q Blackwell Science Limited
An essential yeast acetyltransferase homologue
Elledge, S.J., Mulligan, J.T., Ramer, S.W., Spottswood, M. & Davis,
R.W. (1991) l YES: A multifunctional cDNA expression vector
for the isolation of genes by complementation of Yeast and E. coli
mutations. Proc. Natl. Acad. Sci. USA 88, 1731–1735.
Enoch, T., Gould, K.L. & Nurse, P. (1991) Mitotic checkpoint
control in fission yeast. Cold Spring Harb. Symp. Quant. Biol.
56, 409–416.
Enoch, T. & Nurse, P. (1990) Mutation of fission yeast cell cycle
control genes abolishes dependence of mitosis on DNA
replication. Cell 60, 665–673.
Georgakopoulos, T. & Thireos, G. (1992) Two distinct yeast
transcriptional activators require the function of the GCN5
protein to promote normal levels of transcription. EMBO J.
11, 4145–4152.
Gietz, R.D. & Sugino, A. (1988) New yeast-Escherichia coli shuttle
vectors constructed with in vitro mutagenized yeast genes
lacking six-base pair restriction sites. Gene 74, 527–534.
Goto, T. & Wang, J.C. (1985) Cloning of yeast TOP1, the gene
encoding DNA topoisomerase I, and construction of
mutants defective in both DNA topoisomerase I and DNA
topoisomerase II. Proc. Natl. Acad. Sci. USA 82, 7178–7182.
Grabarek, Z., Mabuchi, Y. & Gergely, J. (1995) Properties of
troponin C acetylated at lysine residues. Biochemistry 34,
11872–11881.
Hartwell, L.H. (1976) Sequential function of gene products
relative to DNA synthesis in the yeast cell cycle. J. Mol. Biol.
104, 803–817.
Hebbes,T.R., Thorne,A.W. & Crane-Robinson, C. (1988) A
direct link between core histone acetylation and transcriptionally active chromatin. EMBO J. 7, 1395–1402.
Hecht, A., Laroche, T., Strahl-Bolsinger, S., Gasser, S.M. &
Grunstein, M. (1995) Histone H3 and H4 N-termini interact
with SIR3 and SIR4 proteins: a molecular model for the
formation of heteochromatin in yeast.
Hirano, T., Funahashi, S., Uemura, T. & Yanagida, M. (1986)
Isolation and characterization of Schizosaccharomyces pombe cut
mutants that block nuclear division but not cytokinesis.
EMBO J. 5, 2973–2979.
Hitchcock-DeGregori, S.E. & Heald, R.W. (1987) Altered actin
and troponin binding of amino-terminal variants of chicken
striated muscle a-tropomyosin expressed in Escherichia coli.
J. Biol. Chem. 262, 9730–9735.
Hoyt, M.A., Totis, L. & Roberts, B.T. (1991) S. cerevisiae genes
required for cell cycle arrest in response to loss of microtubule
function. Cell 66, 507–517.
Huffaker, T.C., Thomas, J.H. & Botstein, D. (1988) Diverse
effects of b-tubulin mutations on microtubule formation and
function. J. Cell. Biol. 106, 1997–2010.
Hutter, K.J. & Eipel, H.E. (1979) Microbial determinations by
flow cytometry. J. Gen. Microbiol. 113, 369–375.
Ito, H., Jukuda, Y., Murata, K. & Kimura, A. (1983)
Transformation of intact yeast cells treated with alkali
cations. J. Bacteriol. 153, 163–168.
Jacobs, C.W., Adams ,A.E.M., Staniszlo, P.J. & Pringle, J.R.
(1988) Functions of microtubules in the Saccharomyces cerevisiae
cell cycle. J. Cell. Biol. 107, 1409–1426.
Johnson, L.M., Fisher-Adams, G. & Grunstein, M. (1990)
Genetic evidence for an interaction between SIR3 and histone
H4 in the repression of the silent mating loci in Saccharomyces
cerevisiae. Proc. Natl. Acad. Sci. USA 87, 6286–6290.
Juan, L.J., Utley, R.T., Adams, C.C., Vettese-Dadey, M. &
Workman, J.L. (1994) Differential repression of transcription
q Blackwell Science Limited
factor binding by histone H1 is regulated by the core histone
amino termini. EMBO J. 13, 6031–40.
Kayne, P.S., Kim, U.-J., Han, M., Mullen, J., Yoshizaki, F. &
Grunstein, M. (1988) Extremely conserved histone H4
N-terminus is dispensable for growth but essential for
repressing the silent mating loci in yeast. Cell 55, 27–39.
Kilmartin, J.V. & Adams, A.E.M. (1984) Structural rearrangements of tubulin and actin during the cell cycle of the yeast
Saccharomyces. J. Cell. Biol. 98, 922–933.
Kleff, S., Andrulis, E.D., Anderson, C.W. & Sternglanz, R.
(1995) Identification of a gene encoding a yeast histone H4
acetyltransferase. J. Cell. Biol. 270, 24674–24677.
Kranz, J.E. & Holm, C. (1990) Cloning by function: an
alternative approach for identifying yeast homologs of genes
from other organisms. Proc. Natl. Acad. Sci. USA 87, 6629–
6633.
Kulkarni, M.S. & Sherman, F. (1994) NAT2, an essential gene
encoding methionine N alpha-acetyltransferase in the yeast
Saccharomyces cerevisiae. J. Biol. Chem. 269, 13141–13147.
Lee, F.J., Lin, L.W. & Smith, J.A. (1989) Molecular cloning and
sequencing of a cDNA encoding N alpha-acetyltransferase
from Saccharomyces cerevisiae. J. Biol. Chem. 264, 12339–12343.
Li, R. & Murray, A.W. (1991) Feedback control of mitosis in
budding yeast. Cell 66, 519–531.
Lillie, S.H. & Brown, S.S. (1992) Suppression of a myosin defect
by a kinesin-related gene. Nature 356, 358–361.
Linder, C. & Thoma, F. (1994) Histone H1 expressed in
Saccharomyces cerevisiae binds to chromatin and affects survival,
growth, transcription, and plasmid stability but does not
change nucleosomal spacing. Mol. Cell Biol. 14, 2822–2835.
Lowary, P.T. & Widom, J. (1989) Higher-order structure of
Saccharomyces cerevisiae chromatin. Proc. Natl. Acad. Sci. USA
86, 8266–8270.
Maniatis, T., Fritsch, E.F. & Sambrook, J. (1982) Molecular
Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
Maruta, H., Greer, K. & Rosenbaum, J.L. (1986) The acetylation
of a-tubulin and its relationship to the assembly and
disassembly of microtubules. J. Cell. Biol. 103, 571–579.
Matsuzaki, F., Matsumoto, S. & Yahara, I. (1988) Truncation of
the carboxy-terminal domain of yeast b-tubulin causes
temperature-sensitive growth and hypersensitivity to antimitotic drugs. J. Cell. Biol. 107, 1427–1435.
McGhee, J.D. & Felsenfeld, G. (1980) Nucleosome structure.
Annu. Rev. Biochem. 49, 1115–1156.
Megee, P.C., Morgan, B.A., Mittman, B.A. & Smith, M.M.
(1990) Genetic analysis of histone H4: essential role of lysines
subject to reversible acetylation. Science 247, 841–845.
Mullen, J.R., Kayne, P.S. & Moerschell, R.P., et al. (1989) Identification and characterization of genes and mutants for an Nterminal acetyltransferase from yeast. EMBO J. 8, 2067–2075.
Nasmyth, K.A. & Reed, S.I. (1980) Isolation of genes by
complementation in yeast. Proc. Natl. Acad. Sci. USA 77,
2119–2123.
Novick, P., Osmond, B.C. & Botstein, D. (1989) Suppressors of
yeast actin mutations. Genetics 121, 659–674.
Park, E.C. & Szostak, J.W. (1990) Tl Point mutations in the yeast
histone H4 gene prevent silencing of the silent mating type
locus HML. Mol. Cell. Biol. 10, 4932–4934.
Park, E.C. & Szostak, J.W. (1992) ARD1 and NAT1 proteins
form a complex that has N-terminal acetyltransferase activity.
EMBO J. 11, 2087–2093.
Genes to Cells (1996) 1, 923–942 941
R Lin et al.
Pedrotti, B., Colombo, R. & Islam, K. (1994) Microtubule
associated protein MAP1A is an actin-binding and crosslinking
protein. Cell Motil. Cytoskeleton 29, 110–116.
Perry, C.A. & Annunziato, A.T. (1991) Histone acetylation
reduces H1-mediated nucleosome interactions during chromatin assembly. Exp. Cell Res. 196, 337–345.
Pringle, J.R. & Hartwell, L.H. (1981) The Saccharomyces cerevisiae
cell cycle. In: The Molecular Biology of the Yeast Saccharomyces,
Life Cycle and Inheritance (eds J.N. Strathern, E.W. Jones &
J.R. Broach), pp. 97–143. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
Quinlan, R.A., Pogson, C.I. & Gull, K. (1980) The influence of
the microtubule inhibitor, methyl benzimidazol-2-ylcarbamate (MBC) on nuclear division and the cell cycle in
Saccharomyces cerevisiae. J. Cell Sci. 46, 341–352.
Ridsdale, J.A., Hendzel, M.J., Delcuve, G.P. & Davie, J.R.
(1990) Histone acetylation alters the capacity of the H1
histones to condense transcriptionally active/competent
chromatin. J. Biol. Chem. 265, 5150–5156.
Rose, M.D. & Fink, G.R. (1987) KAR1, a gene required for
function of both intranuclear and extranuclear microtubules
in yeast. Cell 48, 1047–1060.
Rowley, R., Subramani, S. & Young, P.G. (1992) Checkpoint controls in Schizosaccharomyces pombe: rad1. EMBO J. 11, 1335–
1342.
Russel, M., Kidd, S. & Kelly, M.R. (1986) An improved
filamentous helper phage for generating single-stranded
plasmid DNA. Gene 45, 333–338.
Samejima, I., Beach, D., Matsumoto, T., Yanagida, M. &
Nakaseko, Y. (1993) Identification of seven new cut genes
involved in Schizosaccharomyces pombe mitosis. J. Cell Sci. 105,
135–143.
Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA
74, 5463–5467.
Schatz, P.J., Solomon, F. & Botstein, D. (1988) Isolation and
characterization of conditional-lethal mutations in the TUB1
a-tubulin gene of the yeast Saccharomyces cerevisiae. Genetics
120, 681–695.
Schmit, A.C. & Lambert, A.M. (1988) Plant actin filament and
microtubule interactions during anaphase–telophase transition: effects of antagonist drugs. Biol. Cell 64, 309–319.
Schuster, T., Han, M. & Grunstein, M. (1986) Yeast histone H2A
and H2B amino-termini have interchangeable functions. Cell
45, 445–451.
Sherman, F., Fink, G.R. & Hick, J.B. (1986) Methods in Yeast
Genetics. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Sikorski, R.S. & Boeke, J.D. (1990) In vitro mutagenesis and
plasmid shuffling: from cloned gene to mutant yeast. Meth.
Enzymol. 194, 302–318.
Smith, M.M. (1991) Histone structure and function. Curr. Opin.
Cell Biol. 3, 429–437.
Srebreva, L., Zlatanova, J., Miloshev, G. & Tsanev, R. (1987)
Immunological evidence for the existence of H1-like histone
in yeast. Eur. J. Biochem. 165, 449–454.
Stearns, T., Hoyt, M.A. & Botstein, D. (1990) Yeast mutants
sensitive to antimicrotubule drug define three genes that affect
microtubule function. Genetics 124, 251–262.
Taunton, J., Hassug, C.A. & Schreiber, S.L. (1996) A mammalian
histone deacetylase related to the yeast transcriptional regulator
Rpd3p. Science 272, 408–272.
942 Genes to Cells (1996) 1, 923–942
Tercero, J.C. & Wickner, R.B. (1992) MAK3 encodes an
N-acetyltransferase whose modification of the L-A gag NH2
terminus is necessary for virus particle assembly. J. Biol. Chem.
267, 20277–20281.
Thompson, J.S., Ling, X. & Grunstein, M. (1994) Histone H3
amino terminus is required for telomeric and silent mating
locus repression in yeast. Nature 369, 245–247.
Turner, B.M., Birley, A.J. & Lavender, J. (1992) Histone H4
isoforms acetylated at specific lysine residues define individual
chromosomes and chromatin domains in Drosophila polytene
nuclei. Cell 69, 375–384.
Uemura, T. & Yanagida, M. (1984) Isolation of type I and II
DNA polymerase mutants from fission yeast: single and double
mutants show different phenotypes in cell growth and
chromatin organization. EMBO J. 3, 1737–1744.
Uemura, T. & Yanagida, M. (1986) Mitotic spindle pulls but fails
to separate chromosomes in type II DNA topoisomerase
mutants: uncoordinated mitosis. EMBO J. 5, 1003–1010.
Umesono, K.T., Toda, T., Hayashi, S. & Yanagida, M. (1983)
Two cell division cycle genes NDA2 and NDA3 of the fission
yeast Schizosaccharomyces pombe control microtubular organization and sensitivity to anti-mitotic benzimidazol compounds.
J. Mol. Biol. 168, 271–284.
Urbancikova, M. & Hitchcock-DeGregori, S.E. (1994) Requirement of amino-terminal modification for striated muscle
a-tropomyosin function. J. Biol. Chem. 269, 24310–24315.
Ursic, D. & Culbertson, M.R. (1991) The yeast homolog to
mouse TOP-1 affects microtubule-mediated processes. Mol.
Cell. Biol. 11, 2629–2640.
Ursic, D., Sedbrook, J.C., Himmel, K.L. & Culbertson, M.R.
(1994) The essential yeast Tcp1 protein affects actin and
microtubules. Mol. Biol. Cell 5, 1065–1080.
Wallis, J.W., Rykowski, M. & Grunstein, M. (1983) Yeast histone
H2B containing large amino terminus deletions can function
in vivo. Cell 35, 711–719.
Whiteway, M. & Szostak, J.W. (1985) The ARD1 gene of yeast
functions in the switch between the mitotic cell cycle and
alternative developmental pathways. Cell 43, 483–492.
Whitters, E.A., Cleves, A.E., McGee, T.P., Skinner, H.B. &
Bankaitis V.A. (1993) Sac1p is an integral membrane protein that
influences the cellular requirement for phospholipid transfer
protein function and inositol in yeast. J. Cell. Biol. 122, 79–94.
Wolffe, A.P. (1994) Nucleosome positioning and modification:
chromatin structures that potentiate transcription. Trends Biol.
Sci. 19, 240–244.
Wolffe, A.P. & Pruss, D. (1996a) Deviant nucleosomes: the functional specialization of chromatin. Trends Genet. 12, 58–62.
Wolffe, A.P. & Pruss, D. (1996b) Targeting chromatin disruption:
Transcription regulators that acetylate histones. Cell 84,
817–819.
Zagursky, R.J. & Berman, M.L. (1984) Cloning vectors that
yield high levels of single-stranded DNA for rapid sequencing.
Gene 27, 183–191.
Zieler, H.A., Walberg, M. & Berg, P. (1995) Suppression of
mutations in two Saccharomyces cerevisiae genes by the
adenovirus E1A protein. Mol. Cell Biol. 15, 3227–3237.
Zlatanova, J. (1990) Histone H1 and the regulation of
transcription of eukaryotic genes. TIBS 15, 273–276.
Received: 6 June 1996
Accepted: 11 October 1996
q Blackwell Science Limited