Download Echinomycin binding to alternating AT

..) 1991 Oxford University Press
Nucleic Acids Research, Vol. 19, No. 24 6725-6730
Echinomycin binding to alternating AT
Keith R.Fox, Jonathan N.Marks and Kerstin Waterloh
Department of Physiology & Pharmacology, University of Southampton, Bassett Crescent East,
Southampton S09 3TU, UK
Received October 18, 1991; Revised and Accepted November 21, 1991
ABSTRACT
We have studied the binding of echinomycin to DNA
fragments containing GC-rich regions flanked by blocks
of alternating AT by DNase I footprinting and
diethylpyrocarbonate modification. Regions of
alternating AT flanking the sequences CCCG, CCGC,
CGGC and GG show a four base pair DNase I cleavage
pattern and reaction of alternate adenines with
diethylpyrocarbonate. This pattern is strongest when
the AT-block is immediately adjacent to the CpG ligand
binding site. We explain these phenomena by
suggesting that echinomycin binds to the dinucleotide
step ApT in a cooperative fashion. The cooperative
effects can be transmitted through the dinucleotide
step GC but not CC or AA. No such repetitive patterns
are seen with surrounding regions of (ATT).(AAT).
Evidence is presented for secondary drug binding sites
at CpC and TpG with weaker interaction at the CpG site
within the hexanucleotide TTCGAA.
INTRODUCTION
The bifunctional intercalator echinomycin has long been known
to bind to GC-rich DNAs [1]. More recently footprinting, NMR
and crystallographic studies [2-6] have demonstrated that the
ligand is selective for the dinucleotide step CpG. However a
paradox remains since although its binding constants to natural
DNAs correlate with their gross G+C content, the drug binds
appreciably well to poly(dA-dT) with K(0) =0.3 x 106M- I as
compared with 0.55 x 106M-' for poly(dG-dC) [1]. This
discrepancy is even greater for the related antibiotic triostin A
which binds to poly(dA-dT) better than poly(dG-dC) [7]. Despite
this observation both ligands do not yield footprints at ApT or
TpA. The interaction with poly(dA-dT) is highly cooperative,
possibly explaining the inability to footprint the drugs on shorter
AT-rich sequences. Alternatively the absence of a footprint could
be a kinetic phenomenon since echinomycin has been shown to
dissociate from poly(dA-dT) faster than from poly(dG-dC) [8].
Recent footprinting studies using DNA fragments containing
regions of alternating AT adjacent to CpG sites revealed that
echinomycin caused alternate adenines to become hyperreactive
to diethylpyrocarbonate [9] and induced an unusual four base pair
repeat pattern in DNase I digests [10]. In this paper we have
examined the effects of echinomycin on DNase I digestion and
diethylpyrocarbonate modification of a series of DNA fragments
containing regions of alternating AT positioned at various
distances from CpG sites.
MATERIALS AND METHODS
Drugs and enzymes
Echinomycin was supplied by the Drug Synthesis and Chemistry
Branch, Division of Cancer Treatment, National Cancer Institute.
It was stored as a 1mM stock solution in dimethylsulphoxide and
diluted to working concentrations immediately before use. DNase
I was purchased from Sigma and stored as previously described
[2]. The oligonucleotides (AT)1OSSSS(AT)1O, (S=G or C),
(AT)15SS(AT)15, (ATT)4CG(AAT)4 and (TAA)4CG(TTA)4
were prepared on an Applied Biosystems DNA synthesizer and
used without further purification.
DNA fragments
The self complementary oligonucleotides were cloned into the
SmaI site (CCC/GGG) of pUC 19 and transformed into E. coli
TG2 as previously described [ 1]. The sequences were confirmed
by dideoxy sequencing with a T7 polymerase kit (Pharmacia).
Each of the plasmids was found to contain a single copy of the
synthetic insert except (TAA)4CG(TTA)4 which contained a
dimer. Three different clones were characterised from
oligonucleotide (AT)1OSSSS(AT)1O containing central tetranucleotides CCCG, CCGC and CGGC. A plasmid containing
the insert (AT)15GG(AT)6 was obtained from the oligonucleotide
(AT)15SS(AT)15. PUC13 plasmids containing the inserts (AT)5,
T(AT)6 and (AT)10 were prepared as previously described [12].
Plasmids were purified using Qiagen columns according to the
manufacturers instructions.
Radiolabelled DNA fragments containing the synthetic inserts
were prepared by digesting with HindIll, labelling at the 3'-end
with [a-32P]dATP using reverse transcriptase and cutting again
with either EcoRl or KpnI. The labelled fragments of interest
(about 75 base pairs) were separated on 7 % polyacrylamide gels.
Footprinting and gel electrophoresis
Footprinting experiments with DNase I and diethylpyrocarbonate
were performed as previously described [2,9 - 14]. The products
of digestion were resolved on denaturing polyacrylamide gels
(8% for fragments labelled at the HindHI end, 12% for fragments
labelled at the EcoRl end) containing 8M urea. These were then
6726 Nucleic Acids Research, Vol. 19, No. 24
fixed in 10% (v/v) acetic acid, transferred to Whatman 3MM
paper, dried under vacuum at 80°C, and subjected to
autoradiography at -70°C with an intensifying screen.
Autoradiographs were scanned with a Joyce-Loebl Chromoscan
3 microdensitometer.
RESULTS
(AT). regions surrounding CpG sites
Figure 1 presents DNase I digestion patterns in the presence and
absence of echinomycin for DNA fragments containing the inserts
(AT) IOCCCG(AT)lo, (AT)IOCCGC(AT),O and (AT)1OCGGC
(AT)1O (henceforth known as CCCG, CCGC and CGGC
respectively). In each case cleavage in the control consists of an
alternating pattern of bands in which cleavage of ApT is much
better than TpA; products from the latter are barely visible. This
alternation is interrupted around the four central CG base pairs.
In each case a clear footprint is formed in the central GC-rich
region. The position of the CpG step is different for the three
fragments; protections extend into the second ApT step on the
3'-(lower) side for CCCG, but only the first ApT for CCGC and
CGGC. Protection to the 5'-(upper) side of the CG follows the
same trend; no ApT bonds on the 5'-side of CCCG and CCGC
are protected; though when the drug binding site is shifted by
one more base in the 5'-direction, in CGGC, the first ApT bond
is protected.
As well as producing footprints around the central GC-rich
region echinomycin induces unusual cleavage patterns in the
surrounding blocks of alternating AT, dramatically increasing the
cleavage of some, but not all, the intervening TpA steps. These
results are qualitatively similar to those reported in the preceding
paper for T(AT)8CG(AT),5 [10]. This can be seen more clearly
in the cleavage histograms presented in Figure 2. Looking first
at the results for CCCG we see a distinct four base pair repeat
pattern on the 3'-side in which every other TpA step is cut well,
the other TpA steps remain poorly cleaved as in the control.
Alternate ApT bonds are also cut with different efficiencies. On
the 5'-side, further from the drug binding site, the pattern is more
even with each TpA step enhanced to a similar extent. The unusual
four base pair repeat pattern is again evident with CCGC. nTe
pattern on the 3'-side is out of phase with that seen with CCCG.
With CCCG the 4th, 6th and 8th ApT steps are cut best, whereas
for CCGC it is the 3rd, 5th, 7th and 9th. With CCGC a four base
pair pattern is also evident on the 5'-side. This is most clearly
seen as an alternating cleavage pattern of adjacent TpA bonds;
the uneven cleavage pattern of ApT fades out towards the end
of the fragment. A similar pattem is evident on both sides of
CGGC, though the first two bonds on the 3'-side do not fit with
the rest of the fourfold repeat. The fourfold pattern on the 3'-side
is in phase with CCGC, but out of phase with CCCG.
Figure 3 presents the results of diethylpyrocarbonate
modification of these DNA fragments in the presence of
A
:::!" .-"':':
ILhLJI
:,:;f
4;--t
'I.:
7-
::----
1,
,,I.
.I...
ILftU
ATATATATATATATATATATCCCGATATATATATATATATATAT
.:
-.1.1.
B
I
I
0
1
11
I I IiI.IiI.II
ATATATA TAT A T AT ATAT ATCCGCATATATATATATATATATA T
C
.1 .1
.1i.1,I
Figure 1. DNase I digestion pattern of DNA fragments containing the inserts
(AT)1OCCCG(AT)IO, (AT)IOCCGC(AT)1O and (AT)1OCGGC(AT)1O in the
presence and absence of echinomycin. The square brackets indicate the position
and length of the inserts. Arrows indicate the position of the CpG sites. Each
pair of lanes corresponds to digestion by the enzyme for 1 and 5 minutes. Drug
concentrations (juM) are shown at the top of each pair of lanes. The tracks labelled
'G' are dimethylsulphate-piperidine markers specific for guanine. CCCG is a
HindIII-EcoRl fragment while CCGC and CGGC were obtained by digesting
with HindHI and Kpnl. All DNA fragments were labelled at the 3'-end of the
HindIII site.
ATATATATATATA TATATATCGGCATATATATATATATATATAT
Figure 2. DNase I cleavage histograms for the fragments containing the inserts
(AT),OCCCG(AT)IO (A), (AT)IOCCGC(AT)IO (B) and (AT)1OCGGC(AT)IO (C)
in the presence of IOOtM echinomycin. Sequences are written in the usual
convention i.e. 5' to 3', reading from left to right. The bars indicate the relative
cleavage at each bond determined from densitometer scans of the data presented
in Figure 1. Only regions outside the footprint have been included.
Nucleic Acids Research, Vol. 19, No. 24 6727
echinomycin. This probe interacts only weakly with native BDNA and produces virtually no cleavage in the control.
Echinomycin has increased the reactivity of adenines throughout
each of the inserts. Looking first at the CCCG fragment the first
adenine on the 3'-side of the CG step is strongly enhanced. This
is followed by an alternating pattern of enhanced cleavage
products so that the first, third and fifth adenines are strongly
enhanced. This alternating pattern fades out towards the 3'-end
of the insert. Adenines on the 5'-side of the CCCG are all
modified with a similar efficiency. DEPC modification of CGGC
shows a similar pattern of cleavage at alternate adenines to both
side of the canonical drug binding site. This pattern of alternation
also fades out towards the ends of the insert. The strongest bands
correspond to modification of the 2nd, 4th, 6th and 8th adenines
on the 3'-side of fragment and the 1st, 3rd, 5th and 7th adenines
on the 5'-side. Similar experiments with CCGC reveal the same
trend as seen with CGGC, although the alternation is less
pronounced. The strongest bands for CCCG are out of phase
with CCGC and CGGC as seen with the DNase I results. In every
case the adenines which are most strongly modified by DEPC
correspond to ApT steps which are cut less well by DNase I.
(AT). surrounding other GC-sites
The simplest explanation for these changes in sensitivity to DNase
I and DEPC is that the echinomycin has bound within the (AT)n
stretches, but that their dissociation kinetics are too fast to yield
DNase I footprints. Echinomycin molecules are held in phase
by strong binding to the central CpG site, possibly by some
cooperative interaction. This will be considered further in the
Discussion.
To check the effect of the central CpG step on the binding to
(AT)n we have performed similar footprinting experiments on
DNA fragments containing central GG steps. Figure 4 presents
DNase I digestion and DEPC modification of a fragment
containing the sequence (AT)15GG(AT)6 in the presence of
echinomycin. Although no footprints are observed a fourfold
repeat pattern for DNase I cleavage and an alternating pattern
of DEPC modification are again evident. Does this mean that
these patterns are always produced for echinomycin interacting
with (AT)n, irrespective of the presence of a central CpG? Not
necessarily since CC (GG) has also been suggested as a secondary
echinomycin binding site. This too could force drug molecules
to bind in phase, though only if binding to GG is stronger than
that to AT. This is confirmed by experiments with fragments
containing regions of (TA)n cloned into the same site (not
shown). In each case echinomycin caused increased cleavage of
all the TpA steps, but no fourfold repeat pattern is evident. In
this instance the flanking sequences (CCC/GGGG) represent two
or three overlapping secondary (GpG) echinomycin binding sites.
As a result they can not force a unique orientation of echinomycin
molecules throughout the (AT)n blocks. Binding within the
(AT)n stretches is therefore be random and yield an even
enhancement at each TpA step.
(ATT)n and (TAA)n surrounding CpG sites
In order to investigate whether these changes are a general
property of AT-rich regions surrounding echinomycin binding
sites or are restricted to blocks of alternating AT we have
A
B
A TAT ATAT ATAT ATA TATAT GGA TAT ATA TAT AT
A TA T AT ATATATAT ATATATCCGCATATAT A T A TA T A T ATATA T
ii . .I=i
ATATATATATATATATATATCGGCATATATATATATATATATAT
Figure 3. Patterns of diethylpyrocarbonate modification of the fragments containing
the inserts (AT)IOCCCG(AT)IO (A), (AT)IOCCGC(AT)IO (B) and (AT)1OCGGC
(AT)1O (C) in the presence of 1OOyM echinomycin. The bars indicate the relative
cleavage at each bond determined from densitometer scans of the data.
I1111111 111H III
I
A TATAT ATATA TATATATATGGA TA TAT AT A TATT
Figure 4. Patterns of DNase I digestion (A) and diethylpyrocarbonate modification
(B) for the fragment containing the insert (AT)15GG(AT)6 in the presence of
1OOiAM echinomycin. The bars indicate the relative cleavage of each bond. The
first five AT steps are omitted from the 5'-end.
6728 Nucleic Acids Research, Vol. 19, No. 24
performed similar experiments on DNA fragments containing the
inserts (TAA)4CG(TTA)4 and (ATT)4CG(AAT)4. Figure 5A,B
displays the results for the dimeric insert (TAA)4CG(TTA)4 in
the presence and absence of echinomycin. DNase I digestion of
the (TTA) regions in the control gives a pattern in which the
TpT bond is cut best followed by weaker cleavage of TpA and
poor cleavage of ApT (TpT > TpA > ApT). In the (TAA) region
the order is ApT > ApA > TpA. In the presence of echinomycin
clear footprints are visible around both CpG sites, extending over
6-8 base pairs. The triplet pattern in the rest of the insert is
retained though products from the weaker steps (TpA and ApT
in the upper and lower halves respectively) are now clearly
visible. DEPC modification of this fragment shows weak cleavage
of the central adenine in the TAA sequence with no reaction at
TAA or TTA. Echinomycin renders the upper adenine of the
TAA sequence more susceptible to DEPC modification and
induces weak modification at TAA and TTA, the latter is weaker
than the former. Each of the TAA and ATT repeats is affected
to the same extent. There is no evidence of the fourfold pattern
seen with alternating AT.
Figure 5C,D presents the results DNase I digestion and DEPC
modification the fragment containing the insert
(ATT)4CG(AAT)4. DNase I digestion in the control produces
a cleavage in which TpT > TpA > ApT for the (ATT) region and
ApT > ApA > TpA for the (AAT). In both halves the products
of the weakest cleavage reaction are barely visible. In the presence
of echinomycin there is no clear footprint around the TCGA site,
though bands to either side show an enhanced rate of cleavage.
M.
:,-
X
.:;,
"
ii.16
I
V.
a4,4
6-
Figure 5. DNase I (A,C) and diethylpyrocarbonate (B,D) digestion patterns for
fragments containing the dimeric insert of (TAA)4CG(AAT)4 (A,B) and
(ATT)4CG(AAT)4 in the presence and absence of echinomycin. Each pair of
and
lanes in the DNase I digests corresponds to digestion by the enzyme for
5 minutes. Drug concentrations (WL) are shown at the top of the lanes. Square
brackets show the position and length of the inserts. Arrows show the position
of the CpG sites.
This is similar to the effect of echinomycin on T15CGA15 which
contains the same central hexanucleotide [10]. Although the
relative cleavage pattern remains unchanged products from the
weakest steps are now evident. No fourfold digestion pattern is
induced. DEPC modification of this fragment shows little
cleavage in the drug-free control; only the upper adenine of AAT
is cut. In the presence of echinomycin there is a dramatic increase
in the susceptibility of the adenine distal to the drug binding site
(CGA). In addition echinomycin increases DEPC modification
at both adenines of the AAT portion to a similar extent, but has
little effect on the upper ATT sequence.
DISCUSSION
Interaction at (AT)n
The results presented in this paper provide compelling evidence
for some interaction between echinomycin and (AT)n. In the
preceding paper we suggested that the unusual patterns result from
secondary binding of echinomycin to the dinucleotide step ApT.
This binding is too weak (rapid dissociation?) to yield a footprint
but produces DNA structural changes which are sufficiently longlived to be detected by DNase I and DEPC. The patterns observed
correspond to the 'shadow' left after the drug has dissociated.
Although specific secondary binding to ApT (rather than TpA)
has not been rigorously proven we will argue that this is sufficient
to explain these results.
In order to explain the results we will make several
assumptions. Firstly that binding to AT regions adjacent to the
CG binding site is highly cooperative and promoted by binding
of the ligand to the primary site. Secondly that the neighbour
exclusion principle still holds, i.e. that at least two base pairs
must separate adjacent drug molecules. Thirdly we assume that
the cooperative effects rapidly fade as we move away from the
first drug molecule, i.e binding of the second molecule is strongest
with two intervening bases, weaker with three bases and
effectively non-cooperative with four bases. Fourthly we assume
that hyperreactive adenines are found on the 3'-side of the
sandwiched base pairs i.e at ATA.
Using this model we will first consider the results for DEPC
modification of CCCG, CCGC and CGGC. For CCCG the CpG
step will be occupied by the ligand under all conditions and result
in strong reaction at the first adenine (CGA) on the 3'-side. The
neighbour exclusion principle will forbid drug binding at the first
ApT, but the second ApT is in the correct position for strong
cooperative interaction, rendering the third adenine hyperreactive
to DEPC. This should then forbid binding to the third ApT but
assist binding to the fourth, rendering the fifth adenine
hyperreactive to DEPC, and so on. The same argument applies
to the changes in DEPC modification seen with CGGC; binding
to the CG step prevents binding to the first ApT on the 5'-side
but assists interaction with the second ApT. Similarly binding
to CpG will favour binding to the first ApT on the 3'-side of
CGGC since this is separated from it by only two base pairs.
The situation is less clear on the 5'-side of CCCG since all the
adenines are equally reactive to DEPC, so that binding to each
ApT step is equally likely. This suggests that the intervening CCC
sequence does not participate in the cooperative process, possibly
related to its inability to propagate structural changes. For the
sequence CCGC cooperative effects will be less likely since the
nearest ApT steps are separated from it by either one or three
Nucleic Acids Research, Vol. 19, No. 24 6729
base pairs which are too close and too far respectively to allow
efficient drug binding. With this fragment the alternations in
DEPC modification are much less impressive, suggesting that
the central drug molecule has less influence on the positioning
of the remaining molecules. It is worth emphasising that in this
case, and for the 5'-side of CCCG, the drug is interacting with
the (AT). This is evidenced by the increased cleavage of the TpA
bonds, seen even in the sequences lacking the central CpG step
(see below). However, this interaction is random so that
occupancy of each ApT step is equally probable.
A precise explanation of the DNase I cleavage patterns is less
easy, except to note that the most reactive ApT steps correspond
to adenines which are less sensitive to modification by DEPC.
According to the above model these bases are sandwiched by
the drug molecule, suggesting that they remain in a more normal
B-DNA configuration (they are not reactive to DEPC) and so
are readily cut by DNase I. In contrast the structure of the
intervening ApT steps must be altered by the unwinding caused
by the drug molecule.
The effects of echinomycin on (AT)15GG(AT)6 can only be
explained by suggesting that the drug interacts at the central GG
site. This can not be as strong as that at CpG since no clear
DNAse I footprint is produced. However, it must be stronger
than that at ApT since the central GG step is able to orient the
drug molecules on the surrounding (AT)n. In contrast the
fourfold repeat pattern is not produced with blocks of (AT),
remote from canonical echinomycin binding sites, confirming that
the pattern is a direct result of the juxtaposition of two sequences.
Another possible echinomycin binding site at the centre of
(AT)15GG(AT)6 might also be the TpG step. Interaction at TpG
would leave three bases before the first available ApT on both
sides and is therefore less likely to be cooperative, but would
result in strong DEPC modification of the odd numbered
adenines; this is indeed what we observe. Interaction at the
symmetrically disposed GpA step would have the opposite effect,
i.e. DEPC modification of the even adenines. We therefore
suggest that the most likely secondary site for echinomycin on
this fragment is at GG. If echinomycin can bind reasonably well
to GG then why is no phasing observed for the fragments
containing (AT)n blocks within the SmaI site (CCC/GGG), since
these too are flanked by GG steps? In this case several overlapping
GG steps are present; binding to each one will have opposite
effects on the phasing pattern which should cancel each other
out. The DNase I patterns observed for these fragments do
indicate some interaction with echinomycin since cleavage of all
the TpA steps is greatly enhanced. This could be due to either
the drug binding randomly within the (AT)n blocks, or structural
effects propagated by ligand interaction with the GG sites. It
seems likely that both effects are occurring.
Interaction at (ATT)n.(AAT).
Both (ATT)4CG(AAT)4 and (TAA)4CG(TTA)4 showed only the
three base pair cleavage pattern for DEPC or DNase I expected
from the triplet nature of the sequences. No additional phasing
was evident. Looking first at (ATT)4CG(AAT)4 binding to the
central CpG must be weak (witness the poor DNase I footprint)
yet is sufficient to produced strong DEPC modification at the
first adenine (CGA). Four base pairs must separate this central
site from the first available ApT step on both sides with an
additional four base pairs before the next available ApT. It is
therefore not surprising that no cooperative phasing effects are
observed. No enhancements to DEPC modification are found in
the ATT portion since every adenine is either part of the drug
binding site (ApT) or separated from it by two base pairs. In
the AAT portion the lower adenine (AAT) can either be
sandwiched between the quinoxaline chromophores or located
two bases to either side of a drug molecule bound to ApT. The
upper adenine (AAT) is on the 5'-side of each ApT step
(i.e.ATA). For the sequence (TAA)4CG(TTA)4 the first ApT
steps are found two bases on either side of the central CpG.
Although these secondary sites are as close as possible, avoiding
neighbour exclusion, there is no stronger DEPC modification at
these bases, suggesting that cooperative effects are not transmitted
through the intervening AA and TT steps. Each of the available
ApT sites is equally occupied.
Model for binding at ApT
These suggest that echinomycin can bind selectively to the
dinucleotide ApT. The kinetics of this interaction are very
different from that at CpG since no footprints are produced. What
then is the basis of this sequence recognition? A clue to this may
come from studies with the synthetic derivative TANDEM
lacking the four N-methyl groups [16-19]. The crystal structure
of this compound revealed that the peptide backbone adopted a
different conformation due to the presence of two internal
hydrogen bonds between the carbonyls of the alanines and the
NHs of the valines [19]. As a result it was suggested that it could
recognise the dinucleotide ApT by forming hydrogen bonds
between the NHs of the alanines and the 2-keto groups of the
thymines (instead of between the carbonyl group of alanine and
the 2-amino group of guanine responsible for binding to CpG).
Each of these potential groups is also present in echinomycin,
though the crystal structure of the ligand suggests that they are
in the wrong orientation. Binding to ApT would therefore require
a change in the conformation of echinomycin. The energetics
of such a conformational change are likely to depend on the nature
of the cross-bridge and may explain why triostin A and
echinomycin have different relative affinities for poly(dA-dT) and
poly(dG-dC). This model predicts that a derivative lacking the
NHs of alanine (i.e. [N-MeAla2, N-MeAla61 triostin A) should
be unable to bind to ApT.
Sequence selectivity
As well as confirming the ability of echinomycin to bind
selectively at CpG and demonstrating an additional interaction
at ApT these results reveal the presence of other secondary sites
at GG (CC) and weaker binding to the fragment (ATT)4CG
(AAT)4 containing the central hexanucleotide TTCGAA. The
latter is consistent with the results obtained with T15CGA15 [10]
and suggests that the structure adopted by flanking regions of
oligopyrimidines prevents efficient drug binding. Interaction at
GG (CC) may arise from the formation of one specific hydrogen
bond (to the second guanine) with the second symmetrically
disposed potential bonding site on the molecule left unoccupied.
This is similar to the ability of actinomycin (selective for GpC)
to interact with other sequences of the type GpX (XpC) [20].
ACKNOWLEDGEMENTS
This work was supported by grants from the Cancer Research
Campaign and the Medical Research Council. KRF is a Lister
Institute Research Fellow.
6730 Nucleic Acids Research, Vol. 19, No. 24
REFERENCES
1. Wakelin, L.P.G. & Waring, M.J. (1976) Biochem. J. 157, 721-740.
2. Low, C.M.L., Drew, H.R. & Waring, M.J. (1984) Nucl. Acids Res. 12,
4865 -4879.
3. Van Dyke, M.W. & Dervan, P.B. (1984) Science 225, 1122-1127.
4. Gao, X. & Patel, D.J. (1988) Biochemistry 27, 1744-1751.
5. Ughetto, G., Wang, A.H.J., Quigley, G.J., van der Marel, G., van Boom,
J.H. & Rich, A. (1985) Nucl. Acids. Res. 13, 2305 -2323.
6. Wang, A.H.-J, Ughetto, G., Quigley, G.J., Hakoshima, T., van der Marel,
G.A., van Boom, J.H. & Rich, A. (1984) Science 225, 1115-1121.
7. Lee, J.S. & Waring, M.J. (1978) Biochem. J. 173, 115-128.
8. Fox, K.R., Wakelin, L.P.G. & Waring, M.J. (1981) Biochemistry 20,
5768-5779.
9. Fox, K.R. & Kentebe, E. (1990) Nucl. Acids Res. 18, 1957-1963.
10. Waterloh, K. & Fox, K.R. preceding paper.
11. Waterloh, K. & Fox, K.R. (1991) J. Biol. Chem. 266, 6381-6388.
12. Cons, B.M.G. & Fox, K.R. (1990) FEBS Lett. 264, 100-104.
13. Portugal, J., Fox, K.R., Mclean, M.J., Richenberg, J.L. & Waring, M.J.
(1988) Nucl. Acids Res. 16, 3655-3670.
14. Fox, K.R. & Kentebe, E. (1990) Biochem. J. 269, 217-221.
15. Waterloh, K. & Fox, K.R. (1990) Anti-cancer Drug Design 5, 89-92.
16. Lee, J.S. & Waring, M.J. (1978) Biochem. J. 173, 128-144.
17. Low, C.M.L., Olsen, R.K. & Waring, M.J. (1984) FEBS Lett. 176,
414-419.
18. Low, C.M.L., Fox, K.R., Olsen, R.K. & Waring, M.J. (1986) Nucl. Acids
Res. 14, 2015-2033.
19. Viswamitra, M.A., Kennard, O., Cruse, W.B.T., Egert, E., Sheldrick, G.M.,
Jones, P.G., Waring, M.J., Wakelin, M.J. & Olsen, R.K. (1981) Nature
289, 817-819.
20. Krugh, T.R. (1972) Proc. Natl. Acad. Sci. U.S.A. 69, 1911-1914.
21. Krugh, T.R. & Neely, J.W. (1973) Biochemistry 12, 1775-1782.