Download Expression of Human 21-Hydroxylase (P450c21) in Bacterial and

Expression of Human 21Hydroxylase (P450c21) in Bacterial
and Mammalian Cells: A System to
Characterize Normal and Mutant
Enzymes
Meng-Chun Hu and Bon-chu Chung
Institute of Molecular Biology
Academia Sinica
Nankang, Taipei
Taiwan, 11529 Republic of China
Cytochrome P450c21 (steroid 21-hydroxylase) is a
key enzyme in the synthesis of cortisol, whose deficiency is the cause of a common genetic disease,
congenital adrenal hyperplasia. We have expressed
P450c21 (steroid 21-hydroxylase) in E. coll and
mammalian cells. In E. coli, P450c21 cDNA was
cloned into a T7 expression vector to produce a
large amount of P450c21 fusion protein, which enabled antiserum production. In mammalian cells, a
plasmid containing full-length P450c21 cDNA
(phc21) was constructed and transfected into COS1 cells to produce active P450c21, which was detected by immunoblotting and 21-hydroxylase activity assay. This system was used to assay mutations
involved in the disease. He172 of phc21 corresponding to the site of mutation in some cases of the
disease was mutagenized to become Asn, Leu, His,
or Gin. Mutant as well as normal P450c21 was produced when their cDNAs were transfected into COS1 cells. The mutant proteins, however, had greatly
reduced 21-hydroxylase activities. Therefore, missense mutation at Me172 resulted in inactivation of
the enzyme, but not in repression of enzyme synthesis. The Leu for He substitution at amino acid 172
did not result in partial restoration of enzymatic
activity, indicating that hydrophobicity at this residue
may not play a role in its function. (Molecular Endocrinology 4: 893-898, 1990)
one and 11-deoxycortisol, respectively. This enzyme,
located in the smooth endoplasmic reticulum, functions
as a component of the electron transport chain and
requires NADPH as well as NADPH reductase as electron donors (1, 2).
Deficiency of 21-hydroxylase is the major cause of a
common genetic disease, congenital adrenal hyperplasia (CAH). CAH is a recessive disease with a high
occurrence rate (1:15,000). It is presented with many
phenotypes, ranging from mild acne formation, to virilization, to severe salt loss (3,4). Classical CAH is divided
into salt-wasting and simple virilizing forms (3, 4). Two
genes encoding P450c21, CYP21A and CYP21B, are
located on the short arm of human chromosome 6 in
the class III region of the major histocompatibility locus
(5). Among the two genes, CYP21B is the active one,
while CYP21A accumulates multiple mutations and is
functionless (6, 7).
Different mutations in the c21 gene have been identified in 21-hydroxylase deficiency, including gene deletion (9), missense mutations (10-13), nonsense mutation (14), and splicing errors (15). Many of the above
mutations are the results of frequent gene conversion
events (8, 31, 32). The multiplicity of mutations explains
the heterogeneity of the syndrome. The biochemical
nature of the mutations, however, has not been explored because of the difficulty in obtaining normal and
mutant 21 -hydroxylase due to tissue unavailability and
the low abundance of the enzyme in the cell. Human
P450c21 has never been purified; even bovine and
porcine P450c21 are available only in a limited amount
(16-18).
We now report the production of a recombinant
P450c21 fusion protein from E. coli and the development of a P450c21 mammalian expression system
which was originally used by Zuber et al. for P450c17
expression (19). Lorence et al. (30) have used a similar
system for bovine P450c21 expression. Using this system, we were able to assay 21-hydroxylase activity of
normal and mutant P450c21 and begin to understand
INTRODUCTION
Cytochrome P450c21 is an enzyme found in the adrenal
cortex that is used for the synthesis of steroid hormones. It catalyzes 21-hydroxylation of progesterone
and 17-hydroxyprogesterone to form deoxycorticoster0888-8809/90/0893-0898$02.00/0
Molecular Endocrinology
Copyright © 1990 by The Endocrine Society
893
Vol 4 No. 6
MOL ENDO-1990
894
1 2 3 4 5 6 7 8 9 10
the effect of mutations involved in 21-hydroxylase deficiency.
RESULTS
Bacterial Overexpression and Purification of
P450c21
We used a bacterial expression system developed by
Rosenberg et al. (25) for the overexpression of
P450c21. A 1.6-kilobase SamHI/EcoRI fragment of
pc21/3c covering about two thirds of the P450c21
cDNA was inserted into vector pET-3b at the 12th
codon of phage gene 10 to form pET-c21, which had
the desired recombinant protein under the control of
the phage T7 promoter (Fig. 1) (25).
We transformed pET-c21 into three bacterial strains,
BL21(DE3), BL21(DE3, pLysS), or BL21(DE3, pLysE),
in order to assess which one would be a better host
for P450c21 expression. BL21(DE3) has the T7 RNA
polymerase gene integrated into its chromosome under
the control of /acUV5 promoter inducible by isopropyl/3-D-thiogalactoside (IPTG) (20). Since /acUV5 pomoter
could be expressed without induction, this basal T7
RNA polymerase might be toxic to the cells. However,
basal T7 RNA polymerase activity can be inhibited by
T7 lysozyme cloned into either pLysS or pLysE plasmid
(26). Plasmid pLysE expressed more T7 lysozyme from
a strong tet promoter than pLysS.
Both BL21(DE3) and BL21(DE3, pLysS) after pETc21 transformation overexpressed a protein of approximately 38 kDa when induced by IPTG (Fig. 2, lanes 4
and 7). There was no overexpression detected without
induction or in cells with no pET-c21 plasmid.
BL21(DE3, pLysE) did not overproduce any protein
even after induction (lane 10) and was not a suitable
host for the production of P450c21. Therefore, strain
010 s10
31-
IPTG
PET-c21
pLys
Fig. 2. Expression of P450c21 Polypeptide in £. coli
Cell lysate was electrophoresed in a 10% SDS-polyacrylamide gel and stained with Coomassie blue. Lane 1, Size
markers; lane 2, BL21(DE3) with induction; lane 3, BL21(DE3,
pET-c21); lane 4, BL21(DE3, pET-c21) with induction; lane 5,
BL21(DE3, pLysS) with induction; lane 6, BL21(DE3, pLysS,
pET-c21); lane 7, BL21(DE3, pLysS, pET-c21) with induction;
lane 8, BL21(DE3, pLysE) with induction; lane 9, BL21(DE3,
pLysE, pET-c21); lane 10, BL21(DE3, pLysE, pET-c21) with
induction. S refers to pLysS; E refers to pLysE.
BL21(DE3, pLysS, pET-c21) was chosen for later experiments. IPTG induced the expression and accumulation of T7 RNA polymerase, which then titrated out
the slight inhibitory effect of lysozyme and, therefore,
lead to overproduction of the target protein. Judging
from the intensity of the protein band in the gel, we
estimated that 10 mg recombinant P450c21 was produced from 1 liter bacterial culture.
The overproduced protein formed an insoluble inclusion body in the cell, which was purified by repeated
precipitation/centrifugation steps (21). This recombinant polypeptide was the major protein component
after the initial precipitation step (Fig. 3A, lane 2). The
protein appeared to be homogenous after electroelution
of the major band from the gel (lane 3). The N-terminal
amino acid sequence of the recombinant protein was
determined to be the following:
1 2 3 4 5 6 7 8 9 10 11 12
Met-Ala-Ser-Met-Thr-Gly-Gly-Gln-Gln-Met-Gly-Arg13 14 15 16 17
Asp-Gln-Phe-Ser-Leu
Fig. 1. Construction of phc21 and pET-c21
The first 11 amino acids were derived from gene 10,
and codons 12-14 were from SamHI linker as predicted. The sequence starting from amino acid 15, PheSer-Leu, was derived from P450c21. Therefore, the
amino acid sequence provided the identity for the pro-
P450c21 Expression System
A
kD
1
a
6 6 - 4flHi -SSSr
895
B
kD 1 2
66-
29-
Fig. 3. Purification of P450c21 Polypeptide from E. coli
A, IPTG-induced BL21(DE3, pLysS, pET-c21) cells were
lysed, and P450c21 polypeptide was partially purified by repeated centrifugation. The pellet was dissolved in cell lysis
buffer and loaded onto 10% polyacrylamide gels (lane 2). The
most prominent band was excised from the gel and electroeluted into electrophoresis buffer. Lane 3 contains 10 ^l of the
eluted protein. Lane 1 is the protein size marker. B, Immunoblot of P450c21 antibody. Protein samples were electrophoresed, transferred to nitrocellulose, and reacted with antiP450c21 antisera at a 1:5000 dilution. The blot was then
detected with [1Z5l]protein-A. Lane 1 contains 50 n\ BL21(DE3,
pLysS, pET-3b) lysate; lane 2 contains 0.01 M' BL21(DE3,
pLysS, pET-c21) lysate.
steroids and are expected not to contain endogenous
P450c21 (19). Indeed, cells mock-transfected with no
DNA did not produce any protein reactive to antiP450c21 antibodies (Fig. 4, lane 6). Yet they do contain
the flavoprotein necessary for P450c21 function (19).
The absence of endogenous P450c21 makes COS-1
cells a good system for assaying its activity, since no
other steroid conversion will be present. It was also
used for transfection of genomic DNA encoding
P450c21 (15).
Amor et al. and we have identified one of the
causes of 21-hydroxylase deficiency as an lie172 to Asn
mutation (11,13). To explore the possible involvement
of He172 in 21-hydroxylase activity, we mutated phc21
at lie172 to Asn, Leu, Gin, or His individually by in vitro
mutagenesis procedures. Asn is the mutation found in
the patient; Gin and His are both polar amino acids and
therefore resemble Asn in their properties. Leu has a
hydrophobic side-chain and should have similar properties as the normal amino acid He. Comparing the
influence of these amino acids, which possess similar
properties to either the normal or the mutated amino
acid, would give us some indication of the involvement
of lie172 in its enzymatic activity.
Each mutant and normal plasmid was transfected
into COS-1 cells individually and then assayed for
P450c21 production and 21-hydroxylase activity. Fig-
1 2 3 4 5 6
tein whose amino acid sequence corresponds to residues 164-494 of P450c21, with a short fusion peptide
at the N-terminus. The calculated mol wt is 38 kDa.
The gel-purified protein (shown in lane 3 of Fig. 3A)
was used as antigen to raise polyclonal antibodies that
were reactive with the bacterial P450c21 polypeptide,
as shown in an immunoblotting experiment (Fig. 3B,
lane 2). The control bacterial lysate did not have any
immunoreactive substance (Fig. 3B, lane 1).
—66
—45
—36
Mammalian Expression of Normal and Mutant
P450c21
In addition to bacterial expression of P450c21, we
constructed a plasmid in a pCD vector for its mammalian expression (Fig. 1). The pCD-derived plasmids contain the SV40 origin of replication, which can be replicated well in SV40 T-antigen-containing COS-1 cells
(27). Therefore, the expression of 21-hydroxylase was
amplified in this transient transfection system. The original P450c21 cDNA in plasmid pc21/3c was unable to
encode a full-length protein because it lacked 16 nucleotides (nt) at its 5'-end. We, therefore, inserted 16
nt into its 5'-end by site-directed mutagenesis so that
its coding sequence was restored. The resulting plasmid was designated phc21 (Fig. 1).
Plasmid phc21 was transfected into COS-1 cells to
assay for its expression. These cells do not secrete
kD
—29
—24
I N LQ H
-
Fig. 4. Immunoblot of Normal and Mutant Protein
COS-1 cells were transfected with 5 ^g test plasmids and
5 ng pRSV-/?-gal. Lane 1, Normal phc21 (lie); lane 2, Asn
mutant; lane 3, Leu mutant; lane 4, Gin mutant; lane 5, His
mutant; lane 6, no DNA control. Cell lysates containing 0.1 U
/3-galactosidase were electrophoresed, blotted, and reacted
with anti-P450c21 antibody.
Vol 4 No. 6
MOL ENDO-1990
896
ure 4 showed the immunoblots with anti-P450c21 antibodies of COS-1 lysate after transient transfection.
Anti-P450c21 antibody recognized a protein band of
50,000 daltons in COS-1 cells after transfection with
phc21 (Fig. 4, lane 1). Mutant protein corresponding to
mutation of He172 to His, Gin, Leu, or Asn was also
produced and detectable by anti-P450c21 antisera after
transfection with each mutant plasmid (Fig. 4, lanes 2 5). Multiple scannings of the intensity of the protein
bands from four blots showed that mutant proteins
were produced, on the average, at 80% (Asn), 86%
(Gin), 84% (His), and 88% (Leu) of the normal protein
level, assuming that antibodies react equally well toward wild-type and mutated polypeptides. Although we
could not assess whether these minor differences in
the amount of protein production were significant mutations of lie172 to His, Gin, Leu, or Asn did not affect
their syntheses.
21-Hydroxylase activity generated by exogenous
plasmids was assayed by incubating radioactive substrates, [14C]progesterone or [14C]17-hydroxyprogesterone, in the culture medium. Steroid products were
then separated by TLC based on the property that
hydroxylated steroids migrate at a slower rate (Fig. 5).
Normal P450c21 could hydroxylate both progesterone
and 17-hydroxyprogesterone into its products deoxycorticosterone (Fig. 5A, lane 2) and 11-deoxycortisol
(Fig. 5B, lane 2), respectively. These experiments demonstrated the usefulness of the transfection system,
where the expressed protein possessed enzyme activity. Mock transfection with no DNA did not convert
substrates into the correct products; instead, some
background steroid conversion was observed (lane 1 in
Fig. 5, A and B). This background conversion did not
affect our assay.
The steroid products produced by mutant proteins
of Asn, Leu, Gin, or His were also separated by TLC.
I
A
B
N LQ H
I N L Q H
* m • «*
Even after prolonged incubation (24 h), most of the
steroid substrates in the medium remained unchanged
(Fig. 5, lanes 3-6). The only exception was the Gin
mutant, where more product could be detected (lane 5
in Fig. 5, A and B).
The relative 21-hydroxylase activity for each transfection was calculated by counting the radioactive spots
on TLC plates after 6-h incubation and dividing this
value by the relative amount of P450c21 produced
based on immunoblotting. As shown in Table 1, Asn,
Leu, and His mutants showed only 3-7% activity of the
wild-type protein. The Gin mutant exhibited 20-38%
and 10-20% activity toward progesterone and 17-hydroxyprogesterone, respectively. Although the specific
activities of the mutant proteins were low, they were
significantly higher than background; therefore, none of
the mutant proteins lost activity completely. These mutations probably did not result in complete unfolding of
the protein, so that mutant proteins could still retain
partial activity.
DISCUSSION
We have used two expression systems for the production of human P450c21. The bacterial system offers a
large amount of protein as antigen; therefore, antibodies against human P450c21 are available for the first
time. Yet this overexpression results in precipitation of
the protein to preclude the study of structure and
activity of P450c21 in bacteria. The mammalian system
provides the advantage of assaying enzyme activity,
although the amount of protein expressed is still limited.
Mutations at He172 of P450c21 were studied using
the mammalian expression system. It was speculated
if He172 was in the membrane-anchoring domain of
Table 1. Quantitation of 21-Hydroxylase Activity in
Transfected COS-1 Cells
% Relative SA
DNA
Progesterone
-P2
Normal (lie
Asn 1 7 2
Leu 1 7 2
Gin 172
His 172
12
3 4
5
6
Fig. 5. TLC Separation of Steroid Products after Transfection
with Plasmids
Lane 1, No DNA in transfection; lane 2, wild-type phc21
(He); lane 3, Asn mutant; lane 4, Leu mutant; lane 5, Gin
mutant; lane 6, His mutant. A, The steroid pattern using [14C]
progesterone as a substrate (S1); its product deoxycorticosterone is indicated as P1. B, 17-[14C]Hydroxyprogesterone is
used as a substrate (S2). Its product 11-deoxycortisol is
designated P2. O, The origin of sample spots.
172
)
17Hydroxyprogesterone
1 st exp
2nd exp
1 st exp
2nd exp
100
3.5
7.6
38
6.3
100
3.4
3.9
20
3.3
100
3.6
3.4
10
4.8
100
4.4
3.4
20
7.6
Radioactive substrates were added to the culture medium 2
days after transfection and were incubated for 6 h. In this
period of time the reaction kinetics for the wild-type protein
are still at the linear range. The steroids in the medium were
then extracted and separated by TLC. Counts in the product
divided by the sum of counts in the substrate and the product
is the percent conversion. Specific activity is obtained by
dividing the percent conversion by the amount of P450c21
protein present in each transfection. The specific activity of
the normal protein is taken as 100%.
P450c21 Expression System
P450c21, then mutations in this region would result in
reduced enzyme activity due to disruption of membrane
retention signal (11). All four mutants we tested (Asn,
Leu, Gin, and His) had decreased enyzme activity,
demonstrating the importance of the residue lie172. Hydrophobicity was believed to be important for this membrane-anchoring domain (29). Our result, on the contrary, indicated that hydrophobicity at He172 may not be
the only property to be considered. The Leu172 mutant
that retained a hydrophobic residue had only a low
residual activity (3-7% that of the wild type). Yet the
Gin172 mutant, which received a polar residue substitution, had the highest residual activity among all four
mutants (10-38% of the wild type activity). Since none
of the mutants lost activity completely, mutations at
He172 affected protein structure and function in a subtle
way. The involvement of this residue in P450c21 structure and enzymatic function as well as the role of its
mutation in 21-hydroxylase deficiency are currently under investigation.
897
10% polyacrylamide gel. After staining, the overexpressed
protein was cut out of the gel and electroeluted.
Antibody Production
About 200 fig of the gel-purified recombinant protein were
injected im into rabbit. The same amounts of booster shots
were given 25 and 40 days later. Antiserum collected 9 days
after the second boost was used in all the studies.
Protein Blotting
Proteins separated by SDS-polyacrylamide gel electrophoresis
were transferred to nitrocellulose for antibody detection according to standard procedures (22, 23). For amino acid sequencing, proteins were transferred to polyvinyldifluoride
membrane using a semidry electroblotting procedure (Tarn,
M., personal communication). The desired band was excised
after staining and subjected to automated cycles of Edman
degradation in a gas/liquid phase sequencer with an on-line
PTH amino acid analyzer (Applied Biosystems, Inc., Foster
City, CA) according to the procedure of Hsieh et al. (24).
Acknowledgments
MATERIALS AND METHODS
We would like to thank Dr. Chung Wang for assistance in
antibody production and immunoblotting and Dr. Ming Tarn
for amino acid sequence analysis.
Bacterial and Mammalian Cells
Bacterial strains of BL2i(DE3) series and cloning vector pET3b were supplied by Dr. William Studier (Brookhaven National
Lab). COS-1 cell culture, DNA transfection, and 21-hydroxylase activity assay procedures were described previously (11).
Plasmid Construction
P450c21 cDNA containing plasmid pc21/3c, purchased from
American Type Culture Collection (Rockville, MD), was digested with £coRI/8amHI to isolate a 1.6-kilobase fragment
containing the 3'-portion of the cDNA (7). After filling its ends
with Klenow fragment, this DNA was ligated to pET-3b at the
SamHI site, which was treated the same way. The resulting
plasmid was pET-c21 (Fig. 1).
All DNA fragments to be mutagenized were cloned into
M13mp18 in order to serve as templates for site-directed
mutagenesis using a kit from Amersham (Arlington Heights,
IL). For insertional mutagenesis, a 46-mer oligonucleotide(5'GCTGCAGGGGGGGGGATGCTGCTCCTGGGCC
TGCTGCTGCTGCTGC 3'), which included the 16-nt intended
insert with the 15-nt clamps at both sides, was used as a
primer. To mutagenize phc21 at lie172, mutant primers contained the mutated sequence plus 10- or 14-nt clamps at each
side. The primer sequences were as follows: Asn (21-mer)
5' GAGGTAACAGTTGATGCTGCA, Leu (21-mer) 5'
CTGCAGCATCCTCTGTTACCT,
Gin (31-mer)
5'
TCACCTGCAGCATCCAGTGTTACCTCACCTT, and His (31mer) 5' TCACCTGCAGCATCCACTGTTACCTCACCTT. The
resulting mutant clones were sequenced to verify the points
of mutation and subcloned into a pCD vector (28) for transfection experiments.
Bacterial Expression and Protein Purification
The recombinant protein was purified by modifying existing
procedures (20,21). The cell pellet was lysed and centrifuged,
and the protein in the pellet was dissolved in 6 M guanidine
hydrochloride in R buffer (50 mivi Tris-HCI, pH 8.0; 200 rriM
NaCI; 0.1 rriM EDTA; 0.1 mM dithiothreitol; and 5% glycerol).
The protein was again reprecipitated, redissolved in sodium
dodecyl sulfate (SDS) sample buffer, and electrophoresed in
Received February 22, 1990. Revision received March 16,
1990. Accepted March 16, 1990.
Address requests for reprints to: Bon-chu Chung, Institute
of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan, 11529 Republic of China.
This work was supported by Academia Sinica and National
Science Council, Republic of China (NSC-78-0203-B001 -11).
REFERENCES
1. Ryan KJ, Engel LL 1957 Hydroxylation of steroids at
carbon 21. J Biol Chem 225:103-114
2. Inano H, Inano A, Tamaoki B-l 1969 Submicrosomal distrubution of adrenal enzymes and cytochrome P-450 related to corticoidogenesis. Biochim Biophys Acta
191:257-271
3. Miller WL, Levine LS1987 Molecular and clinical advances
in congenital adrenal hyperplasia. J Pediatr 111:1-17
4. Miller WL, Morel Y 1989 The molecular genetics of 21hydroxylase deficiency. Annu Rev Genet 23:371-393
5. White PC, Grossberger D, Onufer BJ, Chaplin DD, New
Ml, Dupont B, Strominger JL 1985 Two genes encoding
steroid 21-hydroxylase are located near the genes encoding the fourth component of complement in man. Proc
Natl Acad Sci USA 82:1089-1093
6. Higashi Y, Yoshioka H, Yamane M, Gotoh O, Fujii-Kuriyama Y 1986 Complete nucleotide sequence of two steroid 21-hydroxylase genes tandemly arranged in human
chromosome: a pseudogene and a genuine gene. Proc
Natl Acad Sci USA 83:2841-2845
7. White PC, New Ml, Dupont B 1986 Structure of human
steroid 21-hydroxylase genes. Proc Natl Acad Sci USA
83:5111-5115
8. Matteson KJ, Phillips JA III, Miller WL, Chung B-c, Orlando
PJ, Frisch H, Ferrandez A, Burr IM 1987 P450XXI (steroid
21-hydroxylase) gene deletions are not found in family
studies of congenital adrenal hyperplasia. Proc Natl Acad
Sci USA 84:5858-5862
9. White PC, Vitek A, Dupont B, New Ml 1988 Characteriza-
Vol 4 No. 6
MOL ENDO-1990
898
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
tion of frequent deletions causing steroid 21-hydroxylase
deficiency. Proc Natl Acad Sci USA 85:4436-4440
Rodrigues NR, Dunham I, Yu CY, Carroll MC, Porter RR,
Campbell RD 1987 Molecular characterization of the HLAlinked steroid 21-hydroxylase B gene from an individual
with congenital adrenal hyperplasia. EMBO J 6:16531661
Chiou S-H, Hu M-C, Chung B-c 1990 A missense mutation
at lie172—>Asn or Arg3S6-»Trp causes steroid 21 -hydroxylase deficiency. J Biol Chem 265:3549-3552
Speiser PW, New Ml, White PC 1988 Molecular genetic
analysis of nonclassic steroid 21-hydroxylase deficiency
assoicated with HLA-B14.DR1. N Engl J Med 319:19-23
Amor M, Parker KL, Globerman H, New Ml, White PC
1988 Mutation in the CYP21B gene (lle-172—>Asn) causes
steroid 21-hydroxylase deficiency. Proc Natl Acad Sci
USA 85:1600-1604
Globerman H, Amor M, Parker KL, New Ml, White PC
1988 Nonsense mutation causing steroid 21-hydroxylase
deficiency. J Clin Invest 82:139-144
Higashi Y, Tanae A, Inoue H, Hiromasa T, Fujii-Kuriyama
Y 1988 Aberrant splicing and missense mutations cause
steroid 21-hydroxylase [P-450(C21)] deficiency in humans: possible gene conversion products. Proc Natl Acad
Sci USA 85:7486-7490
Kominami S, Ochi H, Kobayashi Y, Takemori S 1980
Studies on the steroid hydroxylation system in adrenal
cortex microsomes. J Biol Chem 255:3386-3394
Yuan P-M, Nakajin S, Haniu M, Shinoda M, Hall PF,
Shively JE 1983 Steroid 21-hydroxylase (cytochrome P450) from porcine adrenocortical microsomes: microsequence analysis of cysteine-containing peptides. Biochemistry 22:143-149
Haniu M, Yanagibashi K, Hall PF, Shively JE 1987 Complete amino acid sequence of 21 -hydroxylase cytochrome
P-450 from porcine adrenal microsomes. Arch Biochem
Biophys 254:380-384
Zuber MX, Simpson ER, Waterman MR 1986 Expression
of bovine 17-hydroxylase cytochrome P-450 cDNA in
nonsteroidogenic (COS 1) cells. Science 234:1258-1261
Studier FW, Moffatt BA 1986 Use of bacteriophage T7
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
RNA polymerase to direct selective high-level expression
of cloned genes. J Mol Biol 189:113-130
Kaplan HB, Greenberg EP 1987 Overproduction and purification of the luxR gene product: transcriptional activator
of the Vibrio fischeri luminescence system. Proc Natl Acad
Sci USA 84:6639-6643
Wang C1987 The D-glucose transporter is tissue-specific.
J Biol Chem 262:15689-15695
Harlow E, Lane D 1988 Antibodies-A Laboratory Manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor
Hsieh J-C, Lin F-P, Tarn MF 1988 Electroblotting onto
glass-fiber filter from an analytical isoelectrofocusing gel:
a preparative method for isolating proteins for N-terminal
microsequencing. Anal Biochem 170:1-8
Rosenberg AH, Lade BN, Chui D-s, Lin S-W, Dunn JJ,
Studier FW 1987 Vectors for selective expression of
cloned DNAs by T7 RNA polymerase. Gene 56:125-135
Moffatt BA, Studier FW 1987 T7 lysozyme inhibits transcription by T7 RNA polymerase. Cell 49:221-227
Gluzman Y 1981 SV40-transformed simian cells support
the replication of early SV40 mutants. Cell 23:175-182
Okayama H, Berg P 1983 A cDNA cloning vector that
permits expression of cDNA inserts in mammalian cells.
Mol Cell Biol 3:280-289
Monier S, Van Luc P, Kreibich G, Sabatini DD, Adesnik M
1988 Signals for the incorporation and orientation of
cytochrome P450 in the endoplasmic reticulum membrane. J Cell Biol 107:457-470
Lorence MC, Trant JM, Mason Jl, Bhasker CR, FujiiKuriyama Y, Estabrook RW, Waterman MR 1989 Expression of a full-length cDNA encoding bovine adrenal cytothrome P450c21. Arch Biochem Biophys 273:79-88
Higashi Y, Tanae A, Inoue H, Fujii-Kuriyama Y 1988
Evidence for frequent gene conversion in the steroid 21 hydroxylase P-450(C21) gene: implications for steroid 21hydroxylase deficiency. Am J Hum Genet 42:17-25
Morel Y, Andre J, Uring-Lambert B, Hauptmann G, Betuel
H, Meo T, Forest MG, David M, Bertrand J, Miller WL
1989 Rearrangements and point mutations of P450c21
genes are distinguished by five restriction endonuclease
haplotypes identified by a new probing strategy in 57
families with congenital adrenal hyperplasia. J Clin Invest
83:527-536