Download Selection of Shigella flexneri candidate virulence genes

Blackwell Science, LtdOxford, UKCMICellular Microbiology 1462-5814Blackwell Science, 20024Original ArticleC. Bartoleschi et al.Shigella genes activated within host cell cytoplasm
Cellular Microbiology (2002) 4(9), 613–626
Selection of Shigella flexneri candidate virulence
genes specifically induced in bacteria resident in
host cell cytoplasm
Cecilia Bartoleschi,1 Maria Chiara Pardini,1
Claudia Scaringi,2 Maria Celeste Martino,2
Carlo Pazzani2† and Maria Lina Bernardini2*
1
Centro Ricerche ENEA-Casaccia, Divisione PRO-TOSS,
S. Maria di Galeria, Roma, Italy.
2
Dipartimento di Biologia Cellulare e dello Sviluppo,
Sezione di Scienze Microbiologiche, and Istituto Pasteur
Fondazione Cenci Bolognetti, Università ‘La Sapienza’,
00185 Rome, Italy.
Summary
We describe an in vivo expression technology (IVET)like approach, which uses antibiotic resistance for
selection, to identify Shigella flexneri genes specifically activated in bacteria resident in host cell cytoplasm. This procedure required construction of a
promoter-trap vector containing a synthetic operon
between the promoterless chloramphenicol acetyl
transferase (cat) and lacZ genes and construction
of a library of plasmids carrying transcriptional
fusions between S. flexneri genomic fragments and
the cat–lacZ operon. Clones exhibiting low levels
(<10 µg ml−1) of chloramphenicol (Cm) resistance on
laboratory media were analysed for their ability to
induce a cytophatic effect – plaque – on a cell monolayer, in the presence of Cm. These clones were
assumed to carry a plasmid in which the cloned fragment acted as a promoter/gene which is poorly
expressed under laboratory conditions. Therefore,
only strains harbouring fusion-plasmids in which the
cloned promoter was specifically activated within
host cytoplasm could survive within the cell monolayer in the presence of Cm and give a positive result
in the plaque assay. Pai (plaque assay induced)
clones, selected following this procedure, were analysed for intracellular (i) β-galactosidase activity, (ii)
proliferation in the presence of Cm, and (iii) Cm resistance. Sequence analysis of Pai plasmids revealed
Received 28 January, 2002; revised 19 June, 2002; accepted
19 June, 2002. *For correspondence. E-mail MariaLina.
Fax
[email protected];
Tel.
(+39) 6 49917579;
(+39) 6 49917594. †Present address: Dipartimento di Anatomia
Patologica e di Genetica, Università di Bari, Via Amendola 165/a,
70100 Bari, Italy.
© 2002 Blackwell Science Ltd
genes encoding proteins of three functional classes:
external layer recycling, adaptation to microaerophilic
environment and gene regulation. Sequences encoding unknown functions were also trapped and
selected by this new IVET-based protocol.
Introduction
Shigella spp. are the causative agent of bacillary dysentery in humans, claiming over one million deaths annually
(Kotloff et al., 1999). Shigella infection is characterized by
bacterial invasion of the colonic mucosa, which is a critical
step in pathogenesis. In cultured cell lines, invasion of
S. flexneri is a multistep process (for a review, see
Sansonetti and Egile, 1998) consisting of bacterial internalization by micropinocytosis, escape into the cytoplasm
and expression of a motility phenotype by polar assembly
of actin on bacterial surface. This latter mechanism, which
involves eukaryotic cell proteins such as profilin, the ARP2/3 complex, N-WASP, etc., allows bacterial passage to
adjacent cells through protrusions from the cell surface
(for a review, see Pantaloni et al., 2001). The intraintercellular movement is assessed by the plaque assay
(Oaks et al., 1986) in which virulent shigellae induce a
cytophatic effect – plaque – on a confluent HeLa cell
monolayer.
The loci encoding entry into epithelial cells as well as
intra-intercellular movement are located on a 220-kb virulence plasmid (Sansonetti et al., 1982; Buchrieser et al.,
2000). IpaB, IpaC and IpaD (invasion plasmid antigen)
proteins are the effectors of the entry phenotype and are
secreted through the products of the mxi-spa operons (for
a review, see Parsot, 1994; Sansonetti and Egile, 1998)
encoding a type-III secretion apparatus (for a review, see
Hueck, 1998) upon contact with host cells (Watarai et al.,
1995). Chromosomal genes involved in virulence include
determinants encoding metabolic and physiological functions (Cersini et al., 1998; Vokes et al., 1999; Way et al.,
1999) and proteins influencing Ipa stability (Tobe et al.,
1992; Durand et al., 1994) or intra-intercellular movement
(Bernardini et al., 1993; Suzuki et al., 1994). The expression of virulence and housekeeping genes is tightly regulated at the transcriptional level by various environmental
signals such as temperature, osmotic pressure and pH
(for a review, see Dorman et al., 2001).
614 C. Bartoleschi et al.
Shigella spp. survive and proliferate within host cytoplasms in which they induce many biochemical reactions
of cells undergoing metabolic stress (Mantis et al., 1996).
Nevertheless, while much is known about plasmidencoded proteins involved in the secretory machinery,
entry and intra-intercellular movement, there is less information about plasmid and chromosomal genes that play
a role in other steps of pathogenesis such as intracellular
survival and cytotoxicity. The identification and characterization of the bacterial factors that sustain intracellular
proliferation and survival may contribute to define the
complex network of functions necessary to remain in host
tissues and escape host defence.
Several studies on a wide variety of pathogens have
well established that genes involved in virulence share a
unique phenotype: induction in the host. This feature has
been exploited to identify virulence genes expressed in a
host compartment and silent in laboratory media. Different
protocols have been established and among them the in
vivo expression technology (IVET) has been successfully
applied to identify bacterial genes specifically induced
during infection using animals as a selective medium
(Slauch et al., 1994). The IVET protocol is based on a
promoter trap in which the selected promoters/genes
drive the expression of reporter genes necessary for
bacterial survival under specific conditions. The IVET protocol has been modified to adapt this technology to various pathogens and to monitor virulence gene expression
in different host compartments (for a review, see Mahan
et al., 2000).
In this study we address the question of which Shigella
genes are activated during the intracellular phase of the
invasion process, starting from the assumption that genes
specifically expressed within the intracellular compartment may contribute to this step of pathogenesis. With this
aim, we have devised an IVET-based protocol for selecting
genes highly expressed in the cytosol of the host cells
but poorly expressed in laboratory media. We used lacZ
and cat (chloramphenicol acetyl transferase) as reporter
genes and host cell cytoplasm as a selective medium
to trap the genes highly expressed only by intracellular
shigellae.
Results
Construction of pZB338 recombinant plasmids
An IVET approach was adopted to identify Shigella genes
expressed during infection of cell monolayers. The experimental protocol was based on a promoter-trap vector,
pZB338, in which Cm resistance is used as basis for
selection. pZB338 is based on the promoter probe vector
pCB192 (Schneider and Beck, 1986) in which the promoterless cat gene, conferring Cm resistance, was cloned to
create a transcriptional fusion between cat and lacZ
(Fig. 1). In pZB338 two translational stop codons are
present upstream of cat–lacZ to ensure transcriptional
fusions, and not translational fusions, between cat–lacZ
and the cloned sequences.
To obtain a pool of pZB338 plasmids harbouring DNA
fragments potentially acting as promoters, random Sau3A,
BglII and BamHI fragments of S. flexneri genomic DNA
isolated from the S. flexneri 5 wild type, M90T, were size
fractionated and cloned into the unique BglII site 5′- to the
promoterless cat–lacZ genes.
The pZB338 plasmids were transferred into M90T to
generate M90T cat–lacZ fusion-plasmid clones. The activity of sequences cloned in pZB338 as promoters was
evaluated as episomes without integration into the chromosome. This strategy was chosen on the basis of preliminary findings which indicated that about 60% of a
suicide plasmid integration events occur by nonhomologous recombination that would confound the IVET
protocol. The pool of pZB338 fusion-plasmids was
enriched for promoters poorly expressed under laboratory
conditions by pre-screening the clones on medium containing increasing concentrations of Cm. M90T pZB338
clones were screened for Lac phenotype on X-gal plates
and for resistance to Cm (3, 5, 10, 20, 50 µg ml−1) on LB
agar plates. The frequency of clones resistant to Cm
(>20 µg ml−1) was low, 1–2%, whereas that of clones
poorly resistant (<10 µg ml−1) reached up 10–13%. Clones
producing white/pale blue colonies on X-gal plates and
resulting sensitive or poorly resistant to Cm (<10 µg ml−1)
and Crb+ were chosen for further studies. These clones
could carry recombinant plasmids either with no insert or
inserts lacking promoter sequences or containing a
sequence acting as promoter, inactive (white, Cm sensitive
clones) or poorly active (pale-blue, poorly Cm resistant
clones) when bacteria were grown under laboratory conditions. If the cloned sequences were activated by some
intracellular signal found within the infected cytoplasm
these clones could switch to the Cm resistant phenotype.
Selection of pZB338 clones carrying promoters/genes
activated within the host cell cytoplasm
The plaque assay was used for selecting M90T pZB338
clones harbouring sequences acting as promoters
activated by the host cell environment. To form plaques on
a cell monolayer intracellular shigellae must move intercellularly, proliferate and survive within the host cell for at
least 48 h. The functions necessary to support these
phenotypes – intracellular proliferation, intra-intercellular
movement and survival in the cytoplasm – are assumed
to be highly expressed in the course of the plaque
assay.
To validate the IVET-like model-system, preliminary
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Shigella genes activated within host cell cytoplasm 615
Fig. 1. Modified IVET-based isolation strategy.
pZB338 was constructed by cloning the promoterless cat from pCM7 upstream of lacZ in
the promoter-trap vector pCB192 to create a
synthetic operon between cat and lacZ. BamHI,
Bgl II and Sau3A fragments from S. flexneri
genome were cloned into the unique BglII site
of pZB338 and the resulting fusion-plasmid
library was transferred in M90T. M90T pZB338
fusion-plasmid clones were assessed for βgalactosidase activity and Cm resistance on
LB X-gal plates and LB plates containing
increasing Cm concentrations (3, 5, 10, 20,
50 µg ml−1) respectively. Clones Cmsensitive or poorly resistant (Cm resistance
< 10 µg ml−1) and producing white or paleblue colonies on X-gal plates were analysed in
the plaque assay in the presence of Cm
(20 µg ml−1). If the cloned sequences were
activated by some intracellular signal found
within the infected cytoplasm these clones
could switch to the Cm resistant phenotype and
produce a positive plaque assay.
experiments were performed. First, a sequence was
cloned into the pZB338 Bgl II site containing the 5′terminus of Shigella dapB gene which is strongly
expressed by intracellular shigellae (unpublished results).
The resulting plasmid, named pZB338.1, was introduced
into M90T. Second, the plasmid pACYC184 (carrying a
constitutively expressed cat gene) was transferred into
M90T. Finally, the Cm concentration able to penetrate into
eukaryotic cells was evaluated to select clones carrying
the promoters/genes activated under this condition and
unable to affect eukaryotic cell metabolism. Therefore,
M90T, M90T pACYC184 and M90T pZB338.1 were
assessed in a standard plaque assay and in a plaque
assay in the presence of varying Cm concentrations.
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Twenty µg ml−1 of Cm added to cell medium did not prevent M90T pACYC184 and M90T pZB338.1 from forming
plaques similar to those of M90T. As expected, at this Cm
concentration M90T gave a negative result in the plaque
assay. Furthermore, pools of cultures containing nine
independent M90T pZB338 clones and one culture of
M90T pZB338.1 or M90T pACYC184 gave a positive
plaque assay. On the basis of these preliminary results
about 6000 (600 pools) M90T pZB338 clones were
assessed in the plaque assay in the presence of Cm at a
concentration of 20 µg ml−1. The selection procedure is
shown in Fig. 1. Twenty-three M90T pZB338 fusion-clones
resulted positive were submitted to molecular analysis to
identify the fragments responsible of Cm resistance.
616 C. Bartoleschi et al.
Sequence analysis, genomic localization and
gene identification
Sequence analysis was carried out using primers derived
from the cat and galK genes present on pZB338. Several
pZB338 clones contained DNA rearrangements including
two sequences from different locations on M90T genome,
i.e. from the chromosome and/or from the virulence
plasmid. To reduce the chances of being deceived by
cloning artifacts, several criteria were used in the analysis
of positive clones. (i) Only clones of ∼ 1000 bp were
considered. Where necessary, the cloned fragment was
reduced to this size and re-cloned into pZB338. The new
fusion-plasmids yielded by these manipulations were
introduced into M90T and analysed for cat expression
under laboratory conditions and in the plaque assay.
(ii) Particular attention was paid to the ORFs that were in
the same direction as the cat–lacZ operon and carried
potentially regulatory regions. (iii) The location of the
sequences of interest on the genome was checked by
Southern analysis and PCR. PCR products obtained by
these manipulations were further sequenced and compared with those originally identified through the IVET
protocol. Therefore, only 11 clones harbouring a fragment
driving the expression of the fusion cat–lacZ resulted from
a cloning of a single fragment ∼ 1000-bp long. These
clones were named M90T Pai (plaque assay inducible)
clones. The sequences of Pai clones were analysed in the
nucleotide databanks. Results of these experiments are
summarized in Fig. 2. Seven sequences belong to the
chromosome and three are located on the virulence
plasmid pWR100. Among them, M90T Pai 43 includes a
large portion of ORF182 (corresponding to sequence AL
391753: 183590–184984), a ORF of unknown function
Fig. 2. Pai genes. Schematic representation of the different DNA inserts (not to scale) carrying sequences acting as promoters activated during
the plaque assay. DNA inserts are indicated as stippled boxes. Location of the inserts on S. flexneri 5 genome was assessed as described in
the text. Genetic nomenclature and relative functions assigned to each Pai clone is based on the identity (97–100% over a minimum of 200
nucleotides) with the corresponding genes in E. coli at the cat–lacZ fusion juncture, with the exception of Pai 29, where only 87.6% identity was
found. Transcription and translation of the inserts have the same polarity as cat–lacZ synthetic operon (white arrow), as determined by sequence
identity. Arrowheads indicate the presence of promoters (or putative promoters). DNA sequence analysis was determined by comparison of
sequences and ORFs within the EMBL and NCBI database using BLAST, BLASTX and FASTA network services. The primers used are: 5′GCTCCTGAAAATCTCGTCG-3′, for cat; and 5′-GCCTGAATGGTGTGATG-3′ for galK (thick lane) present on pZB338.
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Shigella genes activated within host cell cytoplasm 617
and a short fragment upstream of this (Buchrieser et al.,
2000). M90T Pai 33 was first selected as producing
low levels of cat on laboratory medium and inducing
Cm resistance to intracellular shigellae. The size of the
fragment – 2.4 kb – was reduced to 1343 bp as above
described to select a new fusion-clone conferring Cm
resistance. The resulting cloned fragment is internal to
the 3′ terminus of ipaA and included a short ORF, acp,
between ipaA and virB, encoding a putative acyl carrier
protein and the 5′-terminus of virB (corresponding to
sequence AL 391753: 101839–103193). M90T Pai 34
harbours a 787 bp fragment internal to ISSfl4, a new
insertion sequence recently identified on pWR100
(sequence AL 391753: 95800–96999). Sequences
located on the chromosome and carried by M90T Pai 28,
M90T Pai 56, M90T Pai 35, M90T Pai 46, M90T Pai 48,
and M90T Pai 58 have 97% to 99% identity with corresponding E. coli sequences. In E. coli these genes encode
products already characterized (hemB, ppC, accB, sltY,
trpR) or only putative (yrbH ). Two clones, M90T Pai 48
and M90T Pai 62 (plasmids pZB338.48 and pZB338.62)
carried a fragment from the same region and covered the
same ORF. Therefore, only one of them, M90T Pai 48,
carrying the shorter sequence (443 bp) was further analysed. M90T Pai 35 and M90T Pai 46 mapped on two
contiguous regions on the E. coli chromosome (99.6–
99.7 min). M90T Pai 35 exhibits 99% identity with E. coli
trpR (corresponding to nucleotides 5–638 of AN:J01715).
In E. coli and Salmonella trpR encodes the central regulator TrpR that regulates the expression of several operons according to the presence of tryptophan (Gunsalus
and Yanofsky, 1980).
To assess whether trpR cloned into M90T Pai 35 was
regulated by tryptophan, this strain was grown on M9
added or not with tryptophan, and β-galactosidase
expression evaluated. Beta-galactosidase activity increased fourfold when bacteria were grown in the absence
of tryptophan. This indicates that the promoter was active
and the expression of the fusion is regulated also by
tryptophan under laboratory conditions.
In M90T Pai 46 the 770-bp cloned fragment had 99%
identity with the E. coli sltY gene mapping at 99.7 min
on the chromosome and including the regulatory
regions (corresponding to nucleotides 320670–321628 of
U14003). This gene encodes soluble lytic transglycosylase 70 (Slt70).
Analysis of the sequence of M90T Pai 48 revealed that
this clone harboured the accB gene which in E. coli
encodes the biotin carboxyl carrier protein (BCCP), a
component of the acetyl-CoA carboxylase (ACC) complex
(corresponding to nucleotides 9101–9544 of AE000404)
(Li and Cronan, 1992). In E. coli accB is co-transcribed
with accC and maps at min 72. The promoter sequence
was included in plasmid pZB338.48.
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
M90T Pai 56 carries a fragment from ppC gene mapped
at 89.5 min in E. coli and encoding phosphoenolpyruvate (PEP) carboxylase (from nucleotides 10661 of
AE000469 to 828 of AE000470) (Fujita et al., 1984). The
ppC cloned in M90T Pai 56 carries also the promoter
sequence. A DNA segment corresponding to hemB gene
was found in M90T Pai 58 (corresponding to nucleotides
15047–15876 of D85613) (Echelard et al., 1988). This
gene, located at 8 min on E. coli genome, produces the
5-aminolevulonic acid dehydratase (syn., porphobilinogen
synthase) (Spencer and Jordan, 1993). Also in this case
the hemB promoter sequence was identified. M90T Pai
28 contained the 3′ end of yrbG and a part of yrbH,
including a short sequence between these genes (corresponding to nucleotides 12350–13187 of AE000399). In
E. coli both sequences, located at 72 min, have only putative functions: yrbG expresses a transmembrane 34.7 kDa
protein showing similarity to mammalian sodium-calcium
exchangers and the 35.2 kDa product of the yrbH is a
sugar isomerase. In this case no sequence was described
acting as a promoter for the yrbH gene. M90T Pai 29
includes a DNA fragment having 87.6% identity with an
IS2-like sequences, named tnpF/tnpG, encoding putative
34.4 and 12 kDa products, respectively, identified on
chromosomes of both S. flexneri 2 (Al-Hasani et al., 2001)
and S. flexneri 5 (Vokes et al., 1999), associated with
two pathogenicity islands (corresponding to nucleotides
8260–8989 of AF141323). These clones were analysed
to evaluate their ability to proliferate intracellularly in the
presence of Cm and to measure β-galactosidase expression within macrophages and epithelial cells.
Intracellular multiplication of Pai clones in the presence
of Cm and Cm resistance of intracellular bacteria
M90T proliferates within infected HeLa cell monolayers
with well-characterized kinetics described in several studies (Sansonetti et al., 1986; Cersini et al., 1998) exhibiting
a peak of intracellular bacteria after 3–4 h of infection at
a multiplicity of infection (MOI) 100. The presence of bacteria within infected cells was still observable between 6
and 8 h after infection. After this time the infected cells
detached and intracellular bacteria are released into the
medium and killed by gentamicin.
HeLa cells were infected at MOI 100 with the Pai fusionplasmid clones and with two random, isogenic, Lac−/+
poorly resistant to Cm (<10 µg ml−1) fusion-clones picked
from the original preselection pool. M90T pZB338.1 and
M90T pACYC184 were used as controls. After an initial
1 h of incubation in the presence of gentamicin to allow
bacterial entry and phagosome escape, Cm was added
to the cell medium and incubation was extended for 5 h
further. The cells were then lysed and bacteria counted.
Intracellular multiplication of Pai clones under these con-
618 C. Bartoleschi et al.
did not form plaques at Cm concentrations higher than
50 µg ml−1.
Beta-galactosidase production within HeLa and J774 cells
Fig. 3. Growth yield of Pai clones in HeLa cells. HeLa cell monolayers were infected with Pai clones and controls at MOI 100. Plates
containing individual strains and cells were incubated for 1 h, washed
and covered with MEM containing gentamicin (50 µg ml−1). After 1 h
of incubation, plates were removed, washed and treated with both
antibiotics gentamicin (60 µg ml−1) and chloramphenicol (30 µg ml−1)
for 5 h. After that, plates were removed, washed and either Giemsastained or lysed with sodium deoxycholate. Dilutions of this suspension were then plated onto Cr-TSA to enumerate viable bacteria.
pZB338.9 (i.e. M90T pZB338.9), pZB338.6 (i.e. M90T pZB338.6),
M90T, pACYC184 (i.e. M90T pACYC184) and pZB338.1 (i.e. M90T
pZB338.1) were used as controls. M90T pZB338.9 and M90T
pZB338.6 are two random isogenic fusion-clones poorly resistant to
Cm (<10 µg ml−1) picked up from the original preselection pool. M90T
pACYC184 constitutively expresses cat and M90T pZB338.1 carries
cat under the control of dapB promoter, strongly expressed in cell
cytoplasm (unpublished results).
ditions demonstrated that Cm resistance increased early
during infection, in this way allowing survival of bacteria
in the presence of the antibiotic. The results are shown in
Fig. 3.
All Pai clones produced plaques in the presence of
80 µg ml−1 of Cm with the exception of M90T Pai 33 that
It was assessed whether the increased cat activity was
associated with a corresponding lacZ expression early
during infection. Beta-galactosidase production from Pai
clones was evaluated after 90 min and 60 min of incubation post infection of HeLa cells and the murine macrophage cell line, J774, respectively. Extracellular bacteria,
unable to penetrate HeLa cells or escape from macrophage phagocytosis, were killed by gentamicin so that βgalactosidase was measured only for intracellular bacteria.
The β-galactosidase expression of M90T pZB338.1 and
M90T Pai pZB338.9, an isogenic Cm sensitive Lac−/+
fusion-clone picked from the original preselection pool,
were used as controls. All Pai clones showed low levels of
β-galactosidase activity when grown in laboratory medium
according to the initial screening on X-gal plates, with
the exception of M90T Pai 33, obtained by subcloning
the original fragment in pZB338, which expressed an
increased level of β-galactosidase when grown in TSB or
MEM or RPMI compared with the original clone. As
expected, the β-galactosidase levels sharply increased for
bacteria recovered in HeLa cells infected at MOI 100.
Beta-galactosidase activity of intracellular bacteria was
6–100-fold higher (depending on the fusion) than that
of bacteria grown in laboratory medium according to Cm
resistance and the positive result in the plaque assay.
Shigella kills macrophages by apoptosis (Zychlinsky
et al., 1992) and it was hypothesized that signals found by
bacteria during the infection of this cell population might
be different from those found within HeLa cells. With J774
we used MOI 50 to minimize cell lysis. All clones examined
showed an increased b-galactosidase production within
J774 cells consistent with the results obtained in HeLa
cells. The results are summarized in Table 1.
Table 1. b-galactosidase activity of intracellular Shigella flexneri Pai clones.
Strain
M90T
M90T
M90T
M90T
M90T
M90T
M90T
M90T
M90T
M90T
M90T
M90T
pZB338.9
pZB338.1
pai 28 (yrbG/yrbH)
pai 29 (tnpF/tnpG)
pai 33 (acp/virB)
pai 34 (issfl4)
pai 35 (trpR)
pai 43 (ORF182)
pai 46 (sltY)
pai 48 (accBC)
pai 56 (ppC)
pai 58 (hemB)
MEM-RPMI
J774
Ratio J774/RPMI
HeLa
Ratio HeLa/MEM
72 ± 13
571 ± 89
38 ± 8
31 ± 10
123 ± 75
58 ± 39
25 ± 12
73 ± 8
62 ± 15
46 ± 12
21 ± 12
49 ± 10
87 ± 32
835 ± 78
1412 ± 231
989 ± 87
835 ± 127
1555 ± 263
375 ± 97
727 ± 118
2314 ± 173
842 ± 141
666 ± 210
723 ± 57
1.20
1.46
37.16
31.90
6.79
26.81
15.00
9.96
37.32
18.30
31.71
14.76
65 ± 27
732 ± 39
933 ± 211
875 ± 199
662 ± 201
1614 ± 218
472 ± 97
755 ± 136
7413 ± 847
631 ± 173
543 ± 65
834 ± 132
<1
1.28
24.55
28.23
5.38
27.83
18.88
10.34
119.56
13.72
25.86
17.02
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Shigella genes activated within host cell cytoplasm 619
We addressed the question of whether the promoter
sequence of virB, contained in pZB338.33, was responsible for driving the expression of cat–lacZ in intracellular
M90T Pai 33. With this aim, we constructed a M90Tderivative, M90T virB::pZB335, harbouring a transcriptional fusion between the virB regulatory sequences
and lacZ, carried on a suicide plasmid, pZB335, integrated in this region of pWR100. M90T virB::pZB335
was analysed for β-galactosidase production in both HeLa
and J774 cells. The activity of lacZ increased up to 3.4
times in bacteria resident within HeLa cells and up to 2.9
times in bacteria resident in J774 macrophages. This
finding suggested that the expression of virB was
modulated by one or more signals present in host cell
cytoplasms.
To confirm that the activity of Pai genes correlates with
the intracellular residence of shigellae, pZB338 fusionplasmids carrying Pai genes were introduced into BS176,
an avirulent variant of M90T, lacking pWR100. The resulting BS176 Pai clones were used to infect J774 monolayers. As BS176 does not carry the ipa genes, it is unable
to escape the phagocytic vacuole and it does not induce
apoptosis in macrophages. Consistently, BS176 Pai
clones recovered by the infected J774 cells after 1 h of
incubation in the presence of gentamicin are assumed to
have been internalized by macrophages and to reside into
the phagocytic vacuole. These bacteria did not show βgalactosidase induction (data not shown) suggesting the
activity of Pai genes was specifically induced by factors
present in host cytoplasm.
encountered by intracellular bacteria during HeLa cell
invasion.
Construction of ZB310 (M90T trpR::pZB333) and
ZB311 (M90T sltY::pZB334) and intracellular
β-galactosidase expression
Discussion
In order to assess the role of the functions encoded by
trpR and sltY in Shigella virulence, these genes were
disrupted in M90T. The two mutants, ZB310 (M90T
trpR::pZB333) and ZB311 (M90T sltY::pZB334), were
constructed through the insertion of a suicide plasmid,
pLAC1, carrying an internal fragment of each gene, into
M90T chromosome. The introduction of pZB333 (pLAC1trpR) and pZB334 (pLAC1-sltY) into the Shigella genome
placed lacZ under the control of trpR and sltY promoters
in ZB310 and ZB311 respectively. Expression of trpR-lacZ
and sltY-lacZ was analysed in ZB310 pZB217 (pSTBlue1-trpR) and ZB311 pZB218 (pSTBlue-1-sltY ) grown in
laboratory medium and within HeLa cell monolayers, as
described above. The activity of trpR-lacZ was five- to
eightfold higher in intracellular ZB310 and that of sltY-lacZ
was 80–100-fold higher in intracellular ZB311 than in
bacteria grown in vitro. These findings showed that the
activity of these genes was induced by one/more signals
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Virulence of ZB310 (M90T trpR::pZB333) and ZB311
(M90T sltY::pZB334) is slightly attenuated
The virulence of ZB310 (M90T trpR::pZB333) and ZB311
(M90T sltY::pZB334) was analysed by standard procedures aimed at evaluating their ability to enter and
proliferate into and to induce a cytophatic effect on a
HeLa cell monolayer. Likewise, the inflammatory
potential of ZB310 (M90T trpR::pZB333) and ZB311
(M90T sltY::pZB334) was investigated using the Sereny
test that assesses the capacity of virulent shigellae to elicit
keratoconjunctivitis in guinea pigs when inoculated into
the conjunctival sac.
ZB310 (M90T trpR::pZB333) did not show a significant
reduction of virulence and all virulence parameters proved
similar to those of M90T. ZB311 (M90T sltY::pZB334) was
mildly attenuated as demonstrated by the low inflammatory reaction induced in guinea pigs. Intracellular multiplication and cytophatic activity were only slightly
reduced compared with those shown by M90T. The introduction of the mutation in sltY results in the formation of
a certain number of chains of unseparated bacterial cells
as observed in HeLa cells infected with ZB311 at 3 h of
incubation post invasion. The altered ability to disconnect
the two new daughter bacterial cells during cell division
might account for the slight reduction of virulence shown
by ZB311. Table 2 shows the results obtained in this
analysis.
In this study, we used an IVET-like protocol to identify
Shigella genes encoding virulence, metabolic or elusive
functions activated during cultured-cell infections. This
strategy allowed the selection of some genes encoding
functions, such as external layer recycling (accBC, sltY,
yrbH), adaptation to changes in oxygen contents (hemB,
ppC), gene regulation (virB, trpR), preferentially expressed by intracellular shigellae. Moreover, we found that
genes governing functions not yet identified (ORF182) or
involved in maintenance of insertion elements (tnpF,
ISSfl4) were also especially expressed in shigellae
resident in host cytoplasm.
In E. coli the accBC product, ACC, is involved in the
synthesis of malonyl-CoA that is a rate-controlling step
in fatty acid biosynthesis (Li and Cronan, 1992) so that
mutants lacking this enzyme are temperature-sensitive
(Harder et al., 1972). The genetic regulation of this locus
is under control of the growth rate (Li and Cronan,
1993). In Salmonella, a homologue of the E. coli aas
gene, which encodes acyl-acylglycerol phosphatoe-
620 C. Bartoleschi et al.
Table 2. Virulence-associated phenotypes of ZB310 (M90T trpR::pZB333) and ZB311 (M90T sltY::pZB334).
Sereny test
Intracellular proliferation
No. of CFU per monolayer at indicated
time (h) of incubation post-infection
Rating of
keratoconjunctivitis
at the following
inocula (bacteria ml−1)
Plaque formation
No. of plaques
per 106 bacteria
Size of
plaques (mm)
107
108
109
9.4 ± 0.83
335 ± 50
0.86 ± 0.042
3
3
3
11 ± 5.1
7.8 ± 0.42
297 ± 71
0.79 ± 0.051
2
3
3
11 ± 0.12
0.29 ± 0.091
319 ± 57
0.59 ± 0.071
2
2
2
Strain
1 (× 105)
3 (× 105)
M90T
1.1 ± 0.73
13 ± 8.6
ZB310 (M90T trpR::pZB333)
2.4 ± 0.99
ZB311 (M90T sltY::pZB334)
3.7 ± 0.54
6 (× 104)
thanolamine acyl transferase involved in phospholipid
biosynthesis, is induced by the interaction with macrophages (Valdivia and Falkow, 1997). This would confirm
that lipid recycling is a critical factor for intracellular
pathogens.
The soluble lytic transglycosylase Slt70, produced by
sltY (Engel et al., 1991), is associated with the murein
metabolizing proteins PBP3 and PBP7/8, and contributes
to enlarge the murein sacculus during bacterial growth
(Romeis and Höltje, 1994). Genes involved in PG synthesis are activated in the phagosome environment of macrophages in Salmonella (Valdivia and Falkov, 1997) and
several mutants in PG biosynthesis were isolated through
STM or functional genomics on Staphylococcus aureus
and Neisseria meningitidis (Mei et al., 1997; Sun et al.,
2000). Shigella sltY appears to be especially expressed
during HeLa cell infection rather than during macrophage
infection. In E. coli at least six transglycosylases contribute to PG enlargement and how their activities are coordinated during bacterial growth is still unclear (Holtje,
1998). It is therefore conceivable that apoptotic macrophages could produce a factor that negatively influences the
activity of this gene compared with HeLa cells or alternatively that other transglycosylases could contribute to the
survival of bacteria in this environment. However, the
reduction in virulence of a S. flexneri 5 Slt70 mutant suggests that this protein is involved in murein synthesis in
intracellular shigellae. This is also supported by the fact
that these mutants are partially impaired in disconnecting
the daughter cells after division. It must be emphasized
that only the absence of Slt70 among the three lytic transglycoslases involved in murein enlargement/maturation
(Holtje, 1998) attenuates the virulence of Shigella (unpublished results).
The sequence of yrbH encodes a putative isomerase
belonging to the SIS (sugar isomerase) family, GUTQ/
KPSF subfamily. The GUTQ subfamily has a feature of
two C-terminal CBS (cystathionineβ-synthase) (Bateman,
1999). GutQ is a putative ATP-binding sugar phosphate
isomerase, encoded by the gutQ gene in the glucytol utilization operon (Yamada et al., 1990) and involved in capsule formation. Its homologous product, KpsF, encoded by
the kpsF gene present on kps pathogenicity island of E.
coli K1 genome, plays a positive role in the assembly of
the polysialic acid capsule (Cieslewicz and Vimr, 1997).
Shigella dysenteriae produces a polysaccharidic slime
when cultivated in vivo in adult rabbit ileal loops and this
feature was correlated with resistance of serum killing and
phagocytosis (Qadri et al., 1993). These findings suggest
that S. flexneri might produce an external layer similar to
slime under defined conditions.
Porphobilinogen synthase, produced by hemB (Spencer
and Jordan, 1993), governs the synthesis of the first
pyrrole in a pathway whose end-products include haem b
(protohaem), haems o and d. In E. coli the two terminal
cytochrome oxidases bd and o contain distinct prosthetic
groups, haems d and o, respectively, in addition to protohaem. The genetic regulation of this locus is still unclear
even though a feedback regulation of the haem biosynthesis has been postulated (Li et al., 1989). In Salmonella, the hemA locus, encoding another function involved
in the protohaem synthesis, is activated during the
pathogenic process in the murine model of infection
(Heithoff et al., 1997), whereas Staphylococcus aureus
hemB mutants are attenuated (von Eiff et al., 1997). Contribution of cytochrome bd to intracellular survival and
virulence of S. flexneri (Way et al., 1999) is consistent with
the notion that this enzyme is predominantly expressed
under microaerophilic conditions encountered by shigellae
within the human colon. Therefore, upregulation of cytochrome bd in vivo might require an increased production
of haem.
Phosphoenolpyruvate (PEP) carboxylase, encoded by
ppc, converts PEP to four-carbon oxaloacetate, a key step
in the synthesis of oxaloacetate, the precursor of the other
intermediate of the tricarboxylic acid cycle and of major
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Shigella genes activated within host cell cytoplasm 621
families of biosynthetic groups (Fujita et al., 1984). Overexpression of ppc is hypothesized to divert carbon to
oxaloacetate for production of intermediate metabolites
under anaerobic conditions (Gokarn et al., 2000).
Although sequences acting as promoters upstream of
ppc have been identified and their activity reported there
is no information on ppc regulation (Izui et al., 1985).
TrpR is a central regulator of a regulon which includes
several operons, trp (Klig et al., 1988), aroH (Grove and
Gunsalus, 1987), trpR (Gunsalus and Yanofsky, 1980),
aroL (Lawley and Pittard, 1994) and mtr (Heatwole and
Somerville, 1991), whose final products are essentially
aromatic amino acids. Natural isolates of Shigella are
often auxotrophic for tryptophan (Ahmed et al., 1988) and
a S. flexneri tryptophan auxotrophic strain constructed by
inserting Tn10 in trpE locus proved not to be attenuated
in virulence in vitro and in vivo (unpublished results). Our
study suggests that trpR is expressed during pathogenesis but it is not necessary for full virulence.
VirB is the positive regulator of ipa genes (Adler et al.,
1988). Expression of virB is regulated by temperature
through a positive regulator, virF, and a negative regulator,
the histone-like protein H-NS, and it is sensitive to different
parameters including structural features such as DNA
superhelicity and bents (Tobe et al., 1991; for a review,
see Dorman et al., 2001). Transcription of this gene is also
activated by quorum sensing (Day and Maurelli, 2001).
Here we observed that the activity of virB promoter
appears to be influenced by other cues sensed by intracellular shigellae.
A large ORF, ORF182, located on pWR100 was identified that encodes a putative product of 970 amino acids
of unknown function (Buchrieser et al., 2000). In gapped
BLAST search of GenBank the deduced amino acid
sequence of ORF182 shows 34% identity, 48% similarity
(gaps 48%) and 44% identity and 50% similarity (gaps
35%) with a putative helicase produced by Streptomyces
coelicolor and by Dichelobacter nodosus respectively.
ORF182 belongs to a group of pWR100 genes exhibiting
a G + C content of 50%, similar to that predicted for the
transfer and replication regions, 55%, supporting the
hypothesis that this gene participates in the maintenance
of functions of pWR100.
The sequence of pWR100 highlights that pathogenicity
of Shigella results from the acquisition of blocks of genes
from different origin, basing on their G + C content. The
expression of these acquired genes must be integrated
with that of resident genes encoding physiological functions necessary to proliferate and survive within the host.
Insertion elements and transposable structures may also
contribute towards co-ordinating these expressions
through promoters carried by IS elements themselves or
creating sequences acting as promoters at the site of
insertion. Moreover, pathogenicity islands (PAIs) are often
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
associated with IS at their boundaries. These elements
are assumed to play a role in excision or integration of
PAIs, thus contributing to bacterial adaptation to different
environments. Our IVET protocol allowed the identification
of two sequences belonging to IS.
A Pai sequence, located on the chromosome, is
included in tnpF gene. Proteins encoded by tnpF/tnpG
have 98% amino acid identity with the products of the yi22
genes present on E. coli genome and carried by the IS2like elements and encoding transposon-related functions.
The sequence identified shows only 87.6% identity with
the sequences previously identified at the boundary of PAI
SHI-2 (Vokes et al., 1999) and PAI she (Al-Hasani et al.,
2001). This finding might indicate that the tnpF gene
cloned in the fusion-plasmid might be associated with a
different region on M90T chromosome. In intracellular
shigellae the activity of this sequence in vivo might influence the expression of genes located downstream or
might be correlated with the IS2 activity per se playing a
role in genetic rearrangements.
The last Pai clone, Pai 34, harbours a sequence from
an insertion element identified as ISSfl4. This IS is a new
insertion element identified by Buchrieser on pWR100
(Buchrieser et al., 2000). A short fragment of ISSfl4 shows
100% identity with a sequence contained within a pathogenicity island on the genome of uropathogenic E. coli
and carrying the pap gene cluster encoding the fimbrial
structures known to play a major role in the pathogenic
process of these bacteria (Blyn et al., 1989).
All genes identified by IVET are specifically activated
within the cytoplasm and not in the phagosome of host
cell. This would define an environment, the cytoplasm, in
which peculiar signals sensed by resident shigellae
indicate that a host compartment is reached and the coordinated action of functions necessary to ensure intracellular proliferation and survival must be got under way.
Several studies that have applied IVET-like strategies
described that different pathogens activate genes governing functions similar to those identified in Shigella. Hence,
we may argue that turnover of the external structures, coordination of virulence and housekeeping gene expression, and adaptation to physical cues of the host niches
are the critical processes ensuring a successful bacterial
infection. Nevertheless, the loci identified by the IVET
approaches often make modest individual contribution to
virulence. This may indicate that their contribution to
pathogenesis can be additive or synergistic. Therefore,
genes identified by IVET should be considered as components of a unique complex genetic network modulated
by intracellular/intratissular signals. According to this inference new genetic approaches aimed at analysing the
effects of multiple mutations identified by IVET in a single
strain could definitely clarify the contribution of these loci
to bacterial pathogenesis.
622 C. Bartoleschi et al.
Experimental procedures
Bacterial strains, media and growth conditions
The bacterial strains used in this study are: Shigella flexneri
5 wild type, M90T, harbouring the 220 kb invasion plasmid
pWR100 (Sansonetti et al., 1982), its plasmidless variant BS176
(Sansonetti et al., 1982), and the Escherichia coli strains DH10B
[F′, mcrA ∆-(mrr hsdRMS-mcrBC), φ80 dLacZ∆M15, ∆lacX74,
deoR, recA1, araD139, ∆′ara, leu7697, galU, galK, λ−, rpsL,
endAl, nupG)] and MC4100 [F-araD139 ∆-(argF-lac)U169
rpsL150 relA1 fbB5301 ptsF25 deoC thiA1].
Bacteria were routinely cultured in trypticase soy broth (TSB,
Becton Dickinson, Cockeysville, MD, USA) or agar (TSA), or in
Luria–Bertani (LB) (Miller, 1992) broth or agar (1.5%) (DIFCO
Laboratories, Detroit, MI, USA). M9 salts (Miller, 1992) were used
for preparing minimal medium added with nicotinic acid
(10 µg ml−1) to allow the growth of shigellae. The ability of
Shigella to bind the pigment Congo red (Cr, and Crb phenotype)
was assessed on TSA plates containing 0.01% Cr (Maurelli et al.,
1984). X-gal plates were prepared by adding 40 µg ml−1 of 5bromo-4-chloro-3-indolyl-D-galactoside (Sigma, St Louis, MO,
USA) to LB or M9 agar plates. When necessary, media were
supplemented with antibiotics at the following concentrations:
ampicillin (Ap) at 100 µg ml−1, kanamycin at 30 µg ml−1 and
chloramphenicol (Cm) at 5–100 µg ml−1, as specified below.
Genetic procedures
Transformation of S. flexneri and E. coli was achieved by electrotransformation with a Bio-Rad (Hercules, CA, USA) Gene
pulser apparatus. Beta-galactosidase activity of bacteria grown
in laboratory media was analysed following Miller procedure
(Miller, 1992) and expressed as Miller units.
Recombinant DNA techniques
Genomic DNA was isolated with Qiagen Genomic-Tips (Qiagen
GmbH, Germany) and plasmid DNA extraction was carried out
using a Qiagen plasmid kit. Digestions, ligations and DNA amplifications were performed by standard methods (Sambrook et al.,
1989) with enzymes and buffers supplied by Boehringer
(Boehringer Mannheim, Indianapolis, IN, USA) and according to
the manufacturer's instructions. Southern analysis was carried
out following common procedures and probes were [α-32P]-dCTP
labelled (Random prime labelling with the prime-a-gene system,
Promega).
Construction of plasmids
Plasmid pCM7 (Amersham-Pharmacia-Biotech) was digested
with HindIII and the resulting 0.8 kb fragment carrying the promoterless cat gene, encoding chloramphenicol acetyl transferase, was cloned into the same site of the plasmid pBluescript
SK (Stratagene, USA). The cat sequence was again cut from
pBluescript through BamHI-SalI digestion and inserted 5′- to lacZ
in the promoter-probe vector pCB192 (Schneider and Beck,
1986), resulting in a transcriptional fusion between cat and lacZ
in the selection vector pZB338. The identity of the cat–lacZ
operon was confirmed by sequence analysis.
DNA from M90T was randomly digested with Sau3A, BamHI
and BglII. Sau3A partial digestions were obtained treating the
genomic DNA (1 µg) with 0.5 U of Sau3A for 5, 10 and 15 s at
37°C. The fragments were fractionated by centrifugation in a 10–
40% sucrose gradient and the size of each fraction was determined by agarose gel electrophoresis. Fractions approximately
ranging from 400 to 1000 bp were pooled, dialysed, precipitated
in ethanol, resuspended in ligase buffer and ligated to the unique
BglII site 5′- to the promoterless cat–lacZ gene of pZB338. The
diversity of inserts in the pZB338 plasmid-bank was assessed by
using a selection of inserts as probes in a Southern analysis on
M90T genomic DNA digested with HindIII, SalI and NotI. The
probes hybridized with a great number of HindIII and SalI fragments and with several NotI bands thus confirming the randomness of the bank.
Plasmids obtained by these manipulations were transferred
by electroporation into S. flexneri 5 wild-type M90T to create a
pool of clones harbouring pZB338 plasmids containing the S.
flexneri genomic DNA fused to cat–lacZ. Plasmid pZB338 with
no insertion and pACYC184 carrying the cat gene were also
transferred into M90T and used as controls. A further control was
constructed as follows: a 626 bp fragment was amplified from
BS176 using primers deduced from the E. coli sequence of the
dapB gene including promoter and Bgl II sites at the 5′- and 3′
termini (accession number: M10611). Primers were: for 5′AGATCTCTCTGAAAACGGTCTATGC (nucleotide 94) and for 3′AGATCTGCCTTCACGACTGTAG (nucleotide 720). The amplified
DNA was digested by Bgl II (sites underlined) and ligated into the
same site of pZB338, producing plasmid pZB338.1.
Selection of the strains
About 10 000 M90T pZB338 clones were screened for (i) Lac
phenotype on X-gal plates, (ii) Cm resistance (3-5-10-2050 µg ml−1) on LB medium, and (iii) Congo red binding (Crb)
phenotype, that correlates with the invasion ability of shigellae
(Maurelli et al., 1984). Crb+ strains producing white/pale blue
colonies on X-gal plates and sensitive or poorly resistant to
Cm (Cm resistance <10 µg ml−1) were chosen for further studies.
To select those clones harbouring the M90T DNA fragments
acting as promoters activated within the intracellular compartment, about 600 pools of 10 independent M90T pZB338 strains
were assessed in the plaque assay in the presence of Cm
(20 µg ml−1). The construction of the pZB338 library and the
selection procedure are shown in Fig. 1.
When a pool of M90T pZB338 gave a positive result in the
plaque assay each clone present in the pool was tested separately to identify those responsible for cat activation. Positive
clones were further analysed in a standard intracellular multiplication assay in the presence of Cm (20 µg ml−1) and in a plaque
assay in which Cm was added at increasing concentrations (40,
60, 80, 100 µg ml−1). Positive clones were also tested for βgalactosidase activity in laboratory medium and during HeLa cell
and J774 macrophage infection, and submitted to sequence
analysis.
Sequence analysis and verification of clones.
pZB338 carrying junctional fragments able to confer Cm resistance to intracellular bacteria were sequenced using primers
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Shigella genes activated within host cell cytoplasm 623
derived from the 5′-ends of cat and galK, 5′GCTCCTGAAAATCTCGTCG-3′ and 5′-GCCTGAATGGTGT
GATG-3′ respectively. Sequences were obtained from MWG
Biotech SpA (Ebersberg, Germany) using Licor Technology.
The nucleotide and deduced amino acid sequences were compared in known data-bases by using Fasta3 and Blasta N
and P programs at the NCBI and EMBL websites (http://
www.ncbi.nlm.nih.gov:80/entrez; http://www.embl-heidelberg.de/
services/index.html; http://www.ebi.ac.uk). Identity of 97–100%
was considered of interest starting from a minimum of 200
nucleotides.
The location of genes identified as above was checked on S.
flexneri genome by PCR using synthetic oligonucleotides
designed from both 3′ and 5′-termini of the sequence as primers.
Briefly, genomic DNA was extracted from S. flexneri BS176 and
M90T and E. coli MC4100 and the virulence plasmid (pWR100)
DNA from M90T. The PCR mixture (50 µl) contained 1 ng of the
DNA template, primers (0.4 µM each), dATP, dTTP, dGTP and
dCTP (0.2 mM each), Taq DNA polymerase (2.5 U) and 5 µl of
Taq polymerase 10 × buffer. Thirty-five cycles were performed
and 4 µl of the PCR mixture were loaded on a 2% agarose-gel.
The locations of the sequences were also investigated by
Southern analysis. BamHI, BglII, Sau3A DNA fragments from the
genome of M90T, BS176 and MC4100 and from pWR100 and
the pZB338 of interest were separated on agarose gels, transferred onto nylon membranes and probed with the SmaI-BamHI
fragment containing the sequence cloned in pZB338. Both, PCR
analysis and hybridization pattern identified the chromosomal or
plasmid position of the sequence of interest and revealed
whether this sequence was also present on E. coli genome.
Cell cultures and infection
Beta-galactosidase activity of clones harbouring the plasmids of
interest was evaluated five times in both HeLa cells and J774
murine macrophages by the following procedures. HeLa cells
were maintained in minimal essential medium (MEM) supplemented with glutamine and 10% fetal calf serum (FCS) (all products supplied by Hyclone, UT, USA). Confluent HeLa cells were
trypsinized and plated at a density of 1.3 × 105 cells ml−1 for
infection in 6-well plates. For each strain two multiwell plates
were used in each experiment. After 24 h, monolayers were
infected with exponentially growing bacteria (2 ml per well,
MOI 100), centrifuged and incubated for 50 min at 37°C. Plates
were washed three times with phosphate-buffered saline (PBS)
and incubated for 90 min in MEM with added gentamicin
(60 µg ml−1) to kill extracellular bacteria. Plates were then
washed three times in PBS. Intracellular bacteria were recovered
from a pool of 11 wells by treating HeLa cells with 0.5% deoxycholic acid. The lysate was centrifuged at 4°C and resuspended
in 1 ml TSB for bacterial counting and for β-galactosidase assay.
For bacterial counting 100 µl of this suspension were diluted and
plated on Cr-TSA plates. The remaining bacterial suspension
was used to determine the β-galactosidase activity. One well of
infected cells was fixed in methanol and stained with Giemsa to
evaluate infection efficiency.
J774 macrophages were maintained in RPMI-1640 medium
supplemented with 10% FCS (all products purchased by
Hyclone, UT, USA), decomplemented by heating for 20 min at
65°C. Twenty-four hours before the infection confluent J774 cells
were detached by scraping, washed in PBS, and plated at a
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
density of 5 × 105 cells ml−1 for infection in 6-well plates. For each
strain two multiwell plates were used in each experiment. Cells
were infected with 2 ml per well of bacterial suspension (MOI 50),
centrifuged for 10 min and incubated for 30 min at 37°C. After
washing three times with PBS, cells were incubated for 60 min
in RPMI in the presence of gentamicin (60 µg ml−1) to kill extracellular bacteria and washed three times with PBS. Intracellular
bacteria were recovered from a pool of 11 wells, by lysing J774
cells in 0.5% deoxycholic acid vortexing for 20 s. The suspension
was centrifuged at 4°C and resuspended in 1 ml of TSB. For
bacterial counting 100 µl of the suspension was diluted and
plated on Cr-TSA plates, and the remaining TSB used to measure β-galactosidase activity. One well of infected cells was
fixed in ethanol and stained with Giemsa to evaluate infection
efficiency.
When the avirulent plasmidless variant of M90T, BS176, carrying the pZB338 fusion-plasmid containing Pai genes, was used
to infect J774 macrophages the experimental protocol was
slightly modified to allow recovering of a significant number of
intracellular bacteria. Briefly, MOI was increased to 100 and four
multiwell plates, instead of two, were used per strain. Incubation
and β-galactosidase measures were performed as above.
Intracellular multiplication
Multiplication of bacteria in HeLa cells was assayed as described
previously (Cersini et al., 1998) with minor modifications. Briefly,
non-confluent monolayers of HeLa cells (1 × 105 ml−1) were inoculated with bacteria suspended in 2 ml of MEM at MOI 100,
centrifuged, and incubated for 60 min at 37°C to allow bacterial
entry. Plates were washed three times with PBS and covered
with MEM containing gentamicin (50 µg ml−1). This point was
taken as time 0 (T0). After 1 h of incubation, plates were washed
three times with PBS and covered with MEM with added gentamicin (60 µg ml−1) and Cm (30 µg ml−1). Incubation lasted 5 h.
Then, plates were washed four times with PBS and Giemsastained or lysed with 0.5% sodium deoxycholate in distilled water.
Dilutions of this suspension were plated onto Cr-TSA.
b-galactosidase assay of intracellular bacteria
Aliquots of 1 ml of exponentially growing bacteria (OD600 > 0.4)
used for both HeLa and J774 infections were assessed for βgalactosidase activity to compare data from bacteria grown in
laboratory medium (TSB) and cell media (MEM and RPMI) to
those recovered from infected cells. For bacteria recovered from
infected HeLa cells and J774 macrophages, 0.9 ml of bacterial
suspension, obtained as above described, was centrifuged and
resuspended in 0.9 ml of buffer Z for β-galactosidase assay
(Miller, 1992). Aliquots of 0.5, 0.3 and 0.1 ml of this solution were
processed in the β-galactosidase assay. Enzymatic activity was
expressed as β-galactosidase units following Miller's formula in
which the OD600 values were extrapolated by normalizing the
number of bacteria recovered within the cells to a standard OD600
growth curve of M90T.
Plaque assay
The plaque assay was performed as originally described by Oaks
et al. (1986) with minor modifications. Each well of a 12-well plate
624 C. Bartoleschi et al.
was filled with 5 × 105 HeLa cells. After 48 h each well containing
a HeLa cell confluent monolayer was infected with a pool of
10 M90T pZB338 clones selected as described above. In each
experiment, infecting bacteria had grown in TSB to an OD600 of
0.6–0.8. The pools were assessed in triplicate. Two wells were
infected at MOI 1 and 10 and the incubation was carried out in
the presence of Cm (20 µg ml−1) and gentamicin, whereas the
third well underwent standard conditions at MOI 10. After infection, plates were incubated for 90 min at 37°C, washed five times
with PBS and overlaid with MEM supplemented with 0.5% agarose, 50 µg ml−1 gentamicin and 20 µg ml−1 Cm, then incubated
for 48 h. In the experiments aimed at defining the activity of
the promoters selected through the first screening the Cm concentration was increased (40, 60, 80 and 100 µg ml−1). The
cytophatic effect was evaluated as the mean of plaques counted
for each dilution normalized to the number of bacteria grown
to the exponential phase, i.e. 108. M90T, M90T pACYC184
and M90T pZB338.1 in the presence of Cm and in standard
conditions were used as controls.
Construction of M90T trpR::pZB333, M90T sltY::pZB334
and M90T virB::pZB335
In order to construct a M90T sltY mutant a fragment of 522 bp
internal to the sltY gene was amplified by PCR using two primers
derived from M90T sltY sequence: CCCGGGACAAATGATGC
CTGGAC
(forward),
CCCGGGCGTATTAGGGTTGTTCG
(reverse). Likewise, to yield a M90T trpR mutant a fragment of
251 bp internal to trpR was amplified using the following primers:
CCCGGGGAACAGCGTCACCAGGAGTGG
(forward)
and
CCCGGGCAGCTCGACGGGCGCGGCTTTC (reverse). Moreover, a 250-bp fragment containing the acp-virB intergenic region
and the 5′ part of virB was amplified from the virulence plasmid
pWR100 by PCR using the two following primers: CCCGGGT
TCTGTAGTCAAAAATAGT
(forward);
CCCGGGCGTTGCA
CAAATCCACCAT (reverse). The three amplified DNA fragments
were digested with SmaI (sites underlined) and cloned in the
same site upstream of the lacZ reporter gene in the suicide
plasmid vector pLAC1 (Allaoui et al., 1992) to yield plasmids
pZB333, pZB334 and pZB335 for trpR, sltY and virB respectively.
pZB333, pZB334 and pZB335 were then introduced into M90T
by conjugation. As these plasmids did not replicate in S. flexneri,
the M90T ApR clones succeeded through homologous recombination between the trpR and sltY and virB carried by pZB333,
pZB334 and pZB335, respectively, and the identical trpR and sltY
and virB sequences on the M90T genome.
To verify the trpR::pZB333, sltY::pZB334 and virB::pZB335
insertion into the M90T genome a DNA fragment was amplified
from M90T trpR::pZB333, M90T sltY::pZB334 and M90T
virB::pZB335 using a primer from bla (ApR) (TTCGGGGC
GAAAACTCTCAA) of pLAC1 as forward, and three primers
corresponding to the 3′ end of trpR (TACGGGTATTGTAGGACG
GATAA), sltY (ACACCAAAAATAAAAGGC) and virB (CGGAAT
TCTTATGAAGACGATAGATG), respectively, as reverse. Southern blot analysis confirmed that only one copy of pZB333,
pZB334 and pZB335 were inserted into M90T trpR::pZB333,
M90T sltY::pZB334 and M90T virB::pZB335 respectively.
The recombinant strain M90T virB::pZB335, in which lacZ
reporter gene was placed under the control of the virB promoter,
contained a wild-type copy of virB located downstream of the
integrated plasmid. Integration of pZB333 (pLAC1-trpR) and
pZB334 (pLAC1-sltY) into the identical genes on M90T chromosome also placed the lacZ gene under the control of trpR and
sltY promoters but, unlike that of pZB335 (pLAC1-virB), led to the
disruption of trpR and sltY respectively.
To clone Shigella sltY and trpR genes they were amplified
using the following couples of primers: GGACTTCGCCTCTATGT
(forward) and CGACAAAACGTAACCAC (reverse), for sltY;
ATGGCCCAACAATCACCCTATTCA (forward) and TACGGGTAT
TGTAGGACGGATAA (reverse), for trpR. The fragments were
cloned into pSTBlue-1 (Perfectly bluntTM cloning kit, Novagen)
generating pZB217 and pZB218 respectively.
Virulence tests
Intracellular multiplication of M90T trpR::pLAC1 and M90T
sltY::pLAC1 was carried out in HeLa cell monolayers, as
described above without addition of chloramphenicol. The plaque
assay was performed following the standard procedure and the
Sereny test as previously described using three infection doses:
107, 108 and 109 CFU. The degree of keratoconjunctivitis in
guinea pigs was rated on the basis of time of development and
severity of symptoms with the following scores (Hartman et al.,
1991): 0, no disease; 1, mild conjunctivitis; 2, keratoconjuncivitis
with no purulence; 3, fully developed keratoconjunctivitis with
purulence.
Acknowledgements
We gratefully acknowledge Christoph Tang for careful reading of
the manuscript and useful comments, and Georgina Pirt for revision of the manuscript. We thank Silvia Coletta for technical
assistance. This work was supported by a grant from the European Union (QLK2-1999–00938).
References
Adler, B., Sasakawa, C., Tobe, T., Makino, S., Komatsu, K.,
and Yoshikawa, M. (1988) A dual transcriptional activationn
system for the 230 kb plasmid genes coding for virulenceassociated antigens of Shigella flexneri. Mol Microbiol 3:
627–635.
Ahmed, Z.U., Sarker, M.R., and Sack, D.A. (1988) Nutritional
requirements of shigellae for growth in a minimal medium.
Infect Immun 56: 1007–1009.
Al-Hasani, K., Rajakumar, K., Bulach, D., Robins-Browne, R.,
Adler, B., and Sakellaria, H. (2001) Genetic organization of
the pathogenicity island in Shigella flexneri 2a. Microb
Pathog 30: 1–8.
Allaoui, A., Mounier, J., Prévost, M.-C., Sansonetti, P.J., and
Parsot, C. (1992) icsB: a Shigella flexneri virulence gene
necessary for the lysis of protrusions during intercellular
spread. Mol Microbiol 6: 1605–1616.
Bateman, A. (1999) The SIS domain: a phosphosugarbinding domain. Trends Biochem Sci 24: 94–95.
Bernardini, M.L., Sanna, M.G., Fontaine, A., and Sansonetti,
P.J. (1993) OmpC is involved in invasion of epithelial cells
by Shigella flexneri. Infect Immun 61: 3625–3635.
Blyn, L.B., Braaten, B.A., White-Ziegler, C.A., Rolfson, D.H.,
and Low, D.A. (1989) Phase-variation of pyelonephritisassociated pili in Escherichia coli: evidence for transcriptional regulation. EMBO J 8: 613–620.
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
Shigella genes activated within host cell cytoplasm 625
Buchrieser, C., Glacer, P., Rusniok, C., Nedjari, H.,
d’Hauteville, H., Kunst, F., Sansonetti, P.J., and Parsot, C.
(2000) The virulence plasmid pWR100 and the repertoire
of proteins secreted by the type III secretion apparatus of
Shigella flexneri. Mol Microbiol 38: 760–771.
Cersini, A., Salvia, A.M., and Bernardini, M.L. (1998) Intracellular multiplication and virulence of Shigella flexneri auxotrophic mutants. Infect Immun 66: 549–557.
Cieslewicz, M., and Vimr, E. (1997) Reduced polysialic acid
capsule expression in Escherichia coli K1 mutants with
chromosomal defects in. Kpsf Mol Microbiol 26: 237–
249.
Day, W.A., and Maurelli, A.T. (2001) Shigella flexneri LuxS
Quorum-Sensing system modulates virB expression but is
not essential for virulence. Infect Immun 69: 15–23.
Dorman, C.J., McKenna, S.S., and Beloin, S. (2001) Regulation of virulence gene expression in Shigella flexneri, a
facultative intracellular pathogen. Int J Med Microbiol 291:
89–96.
Durand, J.M., Okada, N., Tobe, T., Watarai, M., Fukuda, I.,
Suzuki, T., et al. (1994) vacC, a virulence-associated
chromosomal locus of Shigella flexneri, is homologous to
tgt, a gene encoding tRNA-guanine transglycosylase (Tgt)
of Escherichia coli K-12. J Bacteriol 176: 4627–4634.
Echelard, Y., Dymetryszyn, J., Drolet, M., and Sasarman, A.
(1988) Nucleotide sequence of the hemB gene of Escherichia coli K12. Mol General Genet 214: 503–508.
von Eiff, C., Heilmann, C., Proctor, R.A., Woltz, C., Peters,
G., and Götz, F. (1997) A site-directed Staphylococcus
aureus hemB mutant is a small colony variant which persists intracellularly. J Bacteriol 179: 4706–4712.
Engel, H., Kazemier, B., and Keck, W. (1991) Mureinmetabolizing enzymes from Escherichia coli: sequence
analysis and controlled overexpression of the slt gene,
which encodes the soluble lytic transglycosylase. J Bacteriol 173: 6773–6782.
Fujita, N., Miwa, T., Ishijima, S., Izui, K., and Katsuki, H.
(1984) The primary structure of phosphoenolpyruvate carboxylase of Escherichia coli. Nucleotide sequence of the
ppc gene and deduced amino acid sequence. J Biochem
95: 909–916.
Gokarn, R.R., Eiteman, M.A., and Altman, E. (2000) Metabolic analysis of Escherichia coli in the presence and
absence of the carboxylating enzymes phosphoenolpyruvate carboxylase and pyruvate carboxylase. Appl Environ
Microbiol 66: 1844–1850.
Grove, C.L., and Gunsalus, R.P. (1987) Regulation of the
aroH operator by the tryptophan repressor. J Bacteriol 169:
2158–2164.
Gunsalus, R.P., and Yanofsky, C. (1980) Nucleotide
sequence and expression of Escherichia coli trpR, the
structural gene for the trp aporepressor. Proc Natl Acad
Sci USA 77: 7117–7121.
Harder, M.E., Bacham, I.R., Cronan, J.E., Beacham, K.,
Honegger, J.L., and Silbert, D.F. (1972) Temperaturesensitive mutants of Escherichia coli requiring saturated
and unsaturated fatty acids for growth: isolation and properties. Proc Natl Acad Sci USA 69: 3105–3109.
Hartman, A.B., Powell, C., Schultz, C.L., Oaks, E.V., and
Eckels, K.H. (1991) Small animal model to measure efficacy and immunogenicity of Shigella vaccine strains. Infect
Immun 59: 4075–4083.
Heatwole, V.M., and Somerville, R.L. (1991) The tryptophanspecific permease gene, mtr, is differentially regulated by
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626
tryptophan and tyrosine repressor in Escherichia coli K-12.
J Bacteriol 173: 3601–3604.
Heithoff, D.M., Conner, C.P., Hanna, P.C., Julio, S.M.,
Hentschel, U., and Mahan, M.J. (1997) Bacterial infection
as assessed by in vivo gene expression. Proc Natl Acad
Sci USA 94: 934–939.
Holtje, J.-V. (1998) Growth of the stress-bearing and shapemaintaining murein sacculus of Escherichia coli. Microbiol
Mol Biol Rev 62: 181–203.
Hueck, C.J. (1998) Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol
Rev 62: 379–433.
Izui, K., Miwa, T., Kajitani, M., Fujita, N., Sabe, H., Ishihama,
A., and Katsuki, H. (1985) Promoter analysis of the phosphoenolpyruvate carboxylase gene of Escherichia coli.
Nucl Acids Res 13: 59–71.
Klig, L.S., Carey, J., and Yanofsky, C. (1988) trp repressor
interactions with the trp aroH and trpR operators. J Mol Biol
202: 764–777.
Kotloff, K.L., Winickoff, J.P., Ivanoff, B., Clemens, J.D.,
Swerdlow, D.L., Sansonetti, P.J., Adak, G.K., and Levine,
M.M. (1999) Global burden of Shigella infections: implications for vaccine development and implementation. Bull
Wld Hlth Org 77: 651–656.
Lawley, B., and Pittard, A.J. (1994) Regulation of aroL
expression by TyrR protein and TrpR repressor in Escherichia coli K-12. J Bacteriol 176: 6921–6930.
Li, J.-M., Russell, C.S., and Cosloy, S.D. (1989) The structure
of the Escherichia coli hemB gene. Gene 75: 177–184.
Li, S.-J., and Cronan, J.E., Jr (1992) The gene encoding the
biotin carboxylase subunit of Escherichia coli acetyl-CoA
carboxylase. J Biol Chem 267: 855–863.
Li, S.-J., and Cronan, J.E., Jr (1993) Growth rate regulation
of Escherichia coli acetyl coenzyme A carboxylase, which
catalyzes the first committed step of lipid biosynthesis. J
Bacteriol 175: 332–340.
Mahan, M.J., Heithoff, D.M., Sinsheimer, R.I., and Low, D.A.
(2000) Assessment of bacterial pathogenesis by analysis
of gene expression in the host. Annu Rev Genet 34: 139–
164.
Mantis, N., Prevost, M.C., and Sansonetti, P.J. (1996) Analysis of epithelial cell stress response during infection by
Shigella flexneri. Infect Immun 64: 2474–2482.
Maurelli, A.T., Blackmon, B., and Curtiss, R., 3rd (1984) Loss
of pigmentation in Shigella flexneri 2a is correlated with
loss of virulence and virulence-associated plasmid. Infect
Immun 43: 397–401.
Mei, J.-M., Nourbakhsh, F., Ford, C.W., and Holden, D.W.
(1997) Identification of Staphylococcus aureus virulence
genes in a murine model of bacteraemia using signaturetagged mutagenesis. Mol Microbiol 26: 399–407.
Miller, J.H. (1992) A short course in bacterial genetics. In A
Laboratory Manual and Handbook for Escherichia Coli
and related bacteria. Cold Spring Harbor, New York: Cold
Spring Harbor Laboratory Press.
Oaks, E.V., Wingfield, M.E., and Formal, S.B. (1986) Plaque
formation by virulent Shigella flexneri. Infect Immun 48:
124–129.
Pantaloni, D., Le Clainche, C., and Carlier, M.F. (2001)
Mechanism of actin-based motility. Science 292: 1502–
1506.
Parsot, C. (1994) Shigella flexneri: genetics of entry and
intercellular dissemination in epithelial cells. Curr Top
Microbiol Immunol 192: 217–241.
626 C. Bartoleschi et al.
Qadri, F., Haque, M.A., Hossain, A., Azim, T., Alam, K., and
Albert, M.J. (1993) Role of Shigella dysenteriae type 1
slime polysaccharide in resistance to serum killing and
phagocytosis. Microb Pathog 14: 441–449.
Romeis, T., and Höltje, J.-V. (1994) Specific interaction of
penicillin-binding proteins 3 and 7/8 with soluble lytic transglycosylase in Escherichia coli. J Biol Chem 269: 21603–
21607.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, New
York: Cold Spring Harbor Laboratory Press.
Sansonetti, P.J., and Egile, C. (1998) Molecular bases of
epithelial cell invasion by Shigella flexneri. Antonie Van
Leeuwenhoek 74: 191–197.
Sansonetti, P.J., Kopecko, D.J., and Formal, S.B. (1982)
Involvement of a plasmid in the invasive ability of Shigella
flexneri. Infect Immun 35: 852–860.
Sansonetti, P.J., Ryter, A., Clerc, O., Maurelli, A.T., and
Mounier, J. (1986) Multiplication of Shigella flexneri within
HeLa cells: lysis of the phagocytic vacuole and plasmidmediated contact hemolysis. Infect Immun 51: 461–469.
Schneider, K., and Beck, C.F. (1986) Promoter-probe vectors
for the analysis of divergently arranged promoters. Gene
42: 37–48.
Slauch, J.M., Mahan, M.J., and Mekalanos, J.J. (1994) In
vivo expression technology for selection of bacterial genes
specifically induced in host tissues. Meth Enzymol 235:
481–492.
Spencer, P., and Jordan, P. (1993) Purification and characterization of 5-aminolevulinic acid dehydratase from E. coli
and a study of reactive thiols at the metal-binding domain.
Biochem J 290: 279–287.
Sun, Y.-H., Bakshi, S., Chalmers, R., and Tang, C.M. (2000)
Functional genomics of Neisseria meningitidis pathogenesis. Nature Med 6: 1269–1273.
Suzuki, T., Murai, T., Fukuda, I., Tobe, T., Yoshikawa, M., and
Sasakawa, C. (1994) Identification and characterization of
a chromosomal virulence gene, vacJ, required for intracellular spreading of Shigella flexneri. Mol Microbiol 11: 31–41.
Tobe, T., Nagai, S., Okada, N., Adler, B., Yoshikawa, M., and
Sasakawa, C. (1991) Temperature-regulated expression of
invasion genes in Shigella flexneri is controlled through the
transcriptional activation of the virB gene on the large plasmid. Mol Microbiol 5: 877–893.
Tobe, T., Sasakawa, C., Okada, N., Honma, Y., and
Oshikawa, M.Y. (1992) vacB, a novel chromosomal gene
required for expression of virulence genes on the large
plasmid of Shigella flexneri. J Bacteriol 174: 6359–6367.
Valdivia, R.H., and Falkow, S. (1997) Fluorescence-based
isolation of bacterial genes expressed within host cells.
Science 277: 2007–2011.
Vokes, S.A., Reeves, S.A., Torres, A.G., and Payne, S.M.
(1999) The aerobactin iron transport system genes in Shigella flexneri are present within a pathogenicity island. Mol
Microbiol 33: 63–73.
Watarai, M., Tobe, T., Yoshikawa, M., and Sasakawa, C.
(1995) Contact of Shigella with host cells triggers release
of Ipa invasins and is an essential function of invasiveness.
EMBO J 14: 2461–2470.
Way, S.S., Sallustio, S., Magliozzo, R.S., and Goldberg, M.B.
(1999) Impact of either elevated or decreased levels of
cytochrome db expression on Shigella flexneri virulence. J
Bacteriol 181: 1229–1237.
Yamada, M., Yamada, Y., and Saier, M.H. (1990) Nucleotide
sequence and expression of the gutQ gene within the glucitol operon of Escherichia coli. J DNA Seq Map 1: 141–
145.
Zychlinsky, A., Prevost, M.C., and Sansonetti, P.J. (1992)
Shigella flexneri induces apoptosis in infected macrophages. Nature 358: 167–169.
© 2002 Blackwell Science Ltd, Cellular Microbiology, 4, 613–626