Download subunits of succinyl CoA ligase of tomato

Plant Molecular Biology (2005) 59:781–791
DOI 10.1007/s11103-005-1004-1
Springer 2005
Identification and characterisation of the a and b subunits of succinyl CoA
ligase of tomato
Claudia Studart-Guimarães1, Yves Gibon1, Nicolás Frankel2, Craig C. Wood3, Marı́a
Inés Zanor1, Alisdair R. Fernie1,* and Fernando Carrari1,4
1
Max-Planck Institute for Molecular Plant Physiology, Am Mühlenberg 1, 14476 Golm, Germany (*author
for correspondence; e-mail [email protected]); 2Laboratorio de Fisiologı´a y Biologı´a Molecular,
Facultad de Ciencias Exactas y NaturalesUniversidad de Buenos Aires, Argentina; 3CSIRO-Plant Industry,
P.O. Box 2601, Canberra, ACT, Australia; 4Present Address: CICV-INTA, Instituto de Biotecnologı´a, Las
Cabañas y Los Reseros, B1712 WAA, Buenos Aires, Argentina
Received 10 May 2005; accepted in revised form 16 July 2005
Key words: mitochondrial metabolism, Solanum lycopersicum, Succinyl CoA ligase, Saccharomyces cerevisiae, Tricarboxylic acid cycle
Abstract
Despite the central importance of the TCA cycle in plant metabolism not all of the genes encoding its
constituent enzymes have been functionally identified. In yeast, the heterodimeric protein succinyl CoA
ligase is encoded for by two single-copy genes. Here we report the isolation of two tomato cDNAs coding
for a- and one coding for the b-subunit of succinyl CoA ligase. These three cDNAs were used to complement the respective Saccharomyces cerevisiae mutants deficient in the a- and b-subunit, demonstrating
that they encode functionally active polypeptides. The genes encoding for the subunits were expressed in all
tissues, but most strongly in floral and leaf tissues, with equivalent expression of the two a-subunit genes
being expressed to equivalent levels in all tissues. In all instances GFP fusion expression studies confirmed
an expected mitochondrial location of the proteins encoded. Following the development of a novel assay to
measure succinyl CoA ligase activity, in the direction of succinate formation, the evaluation of the maximal
catalytic activities of the enzyme in a range of tissues revealed that these paralleled those of mRNA levels.
We also utilized this assay to perform a preliminary characterisation of the regulatory properties of the
enzyme suggesting allosteric control of this enzyme which may regulate flux through the TCA cycle in a
manner consistent with its position therein.
Abbreviations: DAF, days after flowering; DAP, dihydroxyacetonephosphate; EST, expressed sequence tag;
G3P, Glycerol-3-Phosphate; G3POX, Glycerol-3-Phophate Oxidase; G3PDH, Glycerol-3-Phosphate
Dehydrogenase; ScoAL, Succinyl CoA ligase; TCA, tricarboxylic acid
Introduction
Succinyl CoA ligase (SCoAL; E.C. 6.2.1.5) catalyses the interconversion of succinyl CoA, inorganic phosphate and dinucleotide to succinate,
trinucleotide and CoA (Johnson et al., 1998).
Little is known of the plant enzyme; however, all
SCoALs studied consist of two types of subunit a;
with a molecular mass of 29–34 kDa and b with a
molecular mass of 41–45 kDa. Catalysis of all
reactions in which succinyl CoA participates,
proceeds via the intermediate transfer of a phosphoryl group to and from a conserved histidine
residue within the a-subunit (Ryan et al., 1997).
782
There is growing evidence that in mammalian cells
there are two ligases; one specific for ADP, the
other for GDP and that the latter catalyses the
synthesis of succinyl CoA during ketone body
formation (Ryan et al., 1997). Recent evidence
suggests that the b-subunit is important for conferring nucleotide specificity to the mammalian
SCoAL, with relative transcript and polypeptide
levels of the GDP and ADP specific ligases
differing greatly with tissue type in rat (Lambeth
et al., 2004). In contrast Saccharomyces cerevisiae
and Escherichia coli contain only single b-genes
but are able to utilize both GDP and ADP
(Przybyla-Zawislak et al., 1998; Fraser et al.,
1999). In contrast to the microbial and mammalian enzymes which can also, by varying means,
use guanine nucleotides as substrate, the plant
ligase is specific for adenine nucleotides (Palmer
and Wedding, 1966). The plant enzyme has been
purified from spinach (Kaufmann and Alivisatos,
1955), artichoke (Palmer and Wedding, 1966) and
soybean (Wider and Tigier, 1971), however, to
date functional identification of the genes encoding the enzymes is lacking for plant species (Fernie
et al., 2004).
Early purification studies on the plant enzyme
revealed that it was not only highly specific with
regard to nucleotide usage but also with respect to
the other substrates of the reverse reaction succinate and CoA (Kaufmann and Alivisatos, 1955).
In the reverse direction it has been suggested that
SCoAL is feedback inhibited by intermediates of
the porphyrin pathway which it supplies (Wider
and Tigier, 1971) as well as being competitively
inhibited by malonate (Palmer and Wedding,
1966). Here we describe the first functional identification, by yeast complementation, of three
plant open reading frames encoding subunits of
succinyl CoA ligase. Sequence comparisons,
expression analysis and mapping hybridisations
confirmed the presence of two a- and one
b-subunit of succinyl CoA in tomato. Both bioinformatic analysis and the expression of GFP
fusion constructs suggested that the products of
all three open reading frames are targeted to the
mitochondria in Arabidopsis thaliana. Finally following development of a novel assay to measure
succinyl CoA ligase activity in the forward direction (that of succinate formation), we performed a
preliminary characterisation of regulatory properties of the enzyme.
Material and methods
Material
Solanum lycopersicum cv. Moneymaker was obtained from Meyer Beck (Berlin, Germany). All
enzymes were obtained from Roche Diagnostics
(Mannheim, Germany) with the exception of
glycerol kinase which was obtained from SigmaAldrich (Taufkirchen, Germany). All other chemicals used in biochemical assays were obtained
from Sigma-Aldrich (Taufkirchen, Germany),
with the exception of 5¢,5¢-diadenosinpentaphosphate obtained from Fluka Chemie Gmbh (Buchs,
Switzerland). Putative succinyl CoA ligase ESTs
were obtained from the S. lycopersicum EST
collection of The Clemson University Genomics
Centre (http://www.genome.clemson.edu). Molecular biological reagents and kits were purchased
from Amersham Bioscience (Freiburg, Germany)
or Invitrogen (Karlsruhe, Germany). Yeast mutant strains deficient in either the a- or b-subunit
(DLSC1, DLSC2) of succinyl CoA ligase and the
respective wild type strain (BY4741) were ordered
from the EUROSCARF collection (http://web.unifrankfurt.de/fb15/mikro/euroscarf/index; PrzybylaZawislak et al., 1998).
Cloning of the full length tomato cDNAs a1, a2,
and b succinyl CoA ligase
ESTs with high homology to the functionally
characterised succinyl CoA ligase genes of yeast
were selected. Full-length coding regions of the
SCoAL a1, a2 and b genes (corresponding to ESTs
cLES12N15, cLEY17J6 and cTOF2K12) were
identified and subsequently cloned into the
pENTR Directional TOPO vector (Invitrogen,
Karlsruhe, Germany) using the following
primers: a1F 5¢CACCATGGCTCGCCAAGCG;
a1R 5¢TTTCACAAGACCCCTCTGTTTGAAC;
a2F 5¢CACCATGGCTCGCCAAGCC; a2R
5¢CGCAAGACCCCTCTGTTTG; bF 5¢CACCATGCTGCGTAAACTTGCCAATC; bR 5¢AGCTAAGGCCTTGACTGCC.
Yeast growth, transformation and selection
The above-mentioned yeast strains were maintained on YPD agar medium supplemented with
200 mg/ml of geneticin. Complementation assays
783
were performed by transforming the mutant yeast
strains with a modified version of the pFL61
vector (Drager et al., 2004). The yeast mutant
DLSC1 was transformed with vectors independently containing SlSCoAL a1 and 2, and the
mutant DLSC2 was transformed with a vector
containing SlSCoAL b. Plasmids were transferred
into yeast using the lithium acetate heat shock
transformation protocol (Schiestl and Gietz,
1989). The transformed colonies were subsequently selected by their ability to grow on uracil
deficient medium. For the complementation test,
transformed colonies were grown in liquid semisynthetic (SS) media (Przybyla-Zawislak et al.,
1998) to an A600 of 0.9. Yeast suspensions were
centrifuged and washed with water to remove
residual glucose. Drops of yeast suspensions were
then plated onto solid SS media, containing 3%
glycerol as the sole carbon source and incubated
for 4–6 days at 30 C.
with a[-32P] dCTP by random priming, using the
Random Prime Labelling System (Amersham Bioscience, Freiburg, Germany). For the differential
expression analysis of SlSCoAL a1 and a2 a semiquantitative RT-PCR approach was followed: 3 lg
of RNA from the same material were used for
cDNA synthesis using SuperScript II reverse transcriptase (Invitrogen, Karlsruhe, Germany). Forward primers were designed on the variable
segment of the SlSCoAL a1 (5¢ GACCAAACTGATCGCAAATCTGTC 3¢) and the SlSCoAL
a2 (5¢ GGCATCAGTATCGCTACTTTGGATC
3¢). The reaction was performed using a common
reverse primer (5¢ CTTGGGTGTCACTCCACCAACC 3¢) at an annealing temperature of 54 C.
The reaction was calibrated by using serial dilutions of the cDNA samples assuming equal efficiency of primer annealing.
Phylogenetic analysis
The full length SlSCoAL a1, a2 and SlSCoAL b
coding regions were cloned into pK7FWG2 vector
(Karimi et al., 2002) and transformed into A.
thaliana cv. Col-0. Young leaves were cut in small
pieces and immediately transferred to a Petri dish
containing 0.5 M mannitol solution for 1 h. The
solution was then replaced by digestion solution
(0.4 M mannitol, 0.33 % Cellulase ‘‘Onozuka’’ R
)10, 0.17 % Macerozyme, 3 mM MES, pH 5.7
and 7 mM CaCl2) and kept in darkness at 37 C
for 5 h. The resultant isolated protoplasts were
treated with 1 lM of the mitochondrial specific
dye MitoTracker Orange CMTMRos (Invitrogen,
Karlsruhe, Germany) for 1 h in the dark and on
ice. Fluorescent signals were analyzed using a
Leica TCS SPII confocal laser scan microscope
(Leica Microsystems AG, Wetzlar, Germany) as
detailed in Carrari et al. (2005).
Protein sequences were retrieved from the GenBank through the BLASTp algorithm using
SlSCoAL a1, a2 and b subunits as query. With
the aim of establishing copy number, we only
selected sequences from eukaryotes and prokaryotes with fully sequenced genomes. We also used
the tBALSTn algorithm to search for non-annotated proteins. Sequences were aligned using the
ClustalW software package (www.ebi.ac.uk/
clustalw) using default parameters. Neighbor Joining trees (Saitou and Nei, 1987) were constructed
with MEGA2 software (Kumar et al., 2001).
Distances were calculated using pair-wise deletion
and Poisson correction for multiple hits, bootstrap
values were obtained with 500 pseudo replicates.
Subcellular localisation experiments
Expression analysis
Succinyl CoA ligase enzyme assay
Total RNA from different tomato organs (root,
stem, leaf and flower) and fruits at different
developmental stages (25, 35, 45, 50, 55, 60, 65
and 70 days after flowering [DAF]) were extracted
using the protocol described by Obiadalla-Ali et al.
(2004). Northern blot analysis was performed
under standard conditions (Sambrook et al.,
1989). The membrane was probed with the specific
PCR fragment of each coding region (0.9 kb for
SlSCoAL a and 1.0 kb for SlSCoAL b), labelled
Yeast isolated mitochondria were yeast/isolated in
0.6 M sorbitol, 2 mM PMSF and 20 mM Hepes–
KOH (pH 7.4), whilst ground plant tissues were
extracted as described in Gibon et al. (2004).
Succinyl CoA ligase was assayed in the forward
direction by measuring the succinyl CoA dependent production of ATP from ADP. Extracts, as
well as ATP standards, freshly prepared in the
extraction buffer, and ranging from 0 to 1 nmol,
784
were incubated in a microplate at 25 C in a
medium containing: 100 mM Tricine/KOH pH 8,
10 mM MgCl2, 100 lM EDTA, 1 u ml)1 glycerokinase, 10 mM phosphate, 2.5 mM ADP (ATP
free), 100 lM 5¢,5¢-diadenosinpentaphosphate,
120 mM glycerol, 0 (blank) or 100 lM (maximal
activity) succinyl CoA. The reaction volume was
set to 50 ll. Preliminary tests established that 5¢,
5¢-diadenosinpentaphosphate exerted no effect on
the activity of succinyl CoA ligase. The reaction
was stopped with 20 ll of 0.5 M HCl. After
neutralisation with 20 ll NaOH, G3P (Glycerol3-Phosphate) was measured as described in Gibon et al. (2002), in the presence of 1.8 u ml)1
G3POX
(Glycerol-3-Phophate
Oxidase),
0.7 u ml)1 G3PDH (Glycerol-3-Phosphate Dehydrogenase), 1 mM NADH, 1.5 mM MgCl2 and
100 mM Tricine/KOH pH 8. The absorbance was
read at 340 nm and at 30 C in a Synergy
microplate reader (Bio-Tek) until the rates were
stabilised. The rates of reactions were calculated
as the decrease of absorbance in mOD min)1
using KC4 software (Bio-Tek). Inhibitors were
added as described in Results and discussion.
full length cDNAs: the 1164-bp SlSCoAL a1
(clone cLES12N15), the 1322-bp SlSCoAL a (clone
cLEY17J6) and the 1427-bp SlSCoAl b (clone
cTOF212). Expression of SlSCoAL a1 or SlSCoAL
a2 complemented growth of yeast DLSC1 on
limiting media and SlSCoAl b complemented
growth of DLSC2 (Figure 1). Dilution drop growth
assay indicates that SlSCoAL a1 complements
DLSC1 slightly better than SlSCoAL a2. In keeping
with this when the enzyme activity of the yeast
strains generated in this study was assayed alongside their respective control strains the total SCoAL
activity, assayed in the direction of succinate
production (see below for details), was intermediate
between the subunit deficient yeasts and the parental strain (data not shown). Furthermore, analysis
of the rate of respiration of the strains analysed here
revealed that the mutants were severely compromised whilst complemented mutants regained wild
type rates of respiration (data not shown).
Oxygen consumption measurements in yeast strains
An aliquot of 500 ll of a yeast culture in exponential growth face was transferred to the measuring chamber of the liquid phase oxygen
electrode (Hansatech, Bachofer, Reutlingen,
Germany) containing 1 ml of YPG and oxygen
consumption was recorded under continuous stirring at 25 C.
Results and discussion
Identification of plant succinyl CoA ligase
subunits by functional complementation
of subunit-deficient yeast strains
The Saccharomyces cerevisiae strains DLSC1 and
DLSC2 which carry mutations in the a and b
subunits of succinyl CoA ligase, respectively (but
are otherwise identical to strain BY4741), require
high concentrations of glycerol for efficient growth
(Przybyla-Zawislak et al., 1998). Searching tomato
EST collections (Van der Hoeven et al., 2003), on
the basis of nucleotide structure and fragment
length facilitated the isolation of three putative
Figure 1. Functional complementation of succinyl CoA ligase
subunit deficient yeast strains by the SlSCoAL open reading
frames. Transformants were grown overnight on SSM with
glucose as sole carbon source before being thoroughly
washed. The culture was subjected to ten-fold serial dilutions
and 4 ll of each dilution was spotted onto SSM with glycerol
as sole carbon source. Plates were photographed after incubation at 30 C for 4 days. WT: BY4741 Genotype (strain)
transformed with the empty vector; Dlsc1 (yeast mutant for
the a subunit); Dlsc1)h (mutant transformed with the empty
vector); Dlsc1)a1 (mutant complemented with the tomato
open reading frame SlSCoALa1); Dlsc1)a2 (mutant complemented with the tomato open reading frame SlSCoALa2).
Dlsc2 (yeast mutant for the b subunit); Dlsc2)h (mutant
transformed with the empty vector); Dlsc2)b (mutant complemented with the tomato open reading frame SlSCoALb).
785
Sequence analysis of plant succinyl CoA ligase
subunits
Having identified that the clones encoded functional SCoAL subunits we next carried out
DNA sequence comparison of the subunits with
one another and with functionally characterised
SCoAL subunits from other species. The amino
acid sequence from SlSCoAL a1 and 2 is
conserved in the known domains of SCoAL
alpha from other species (Figure 2). SlSCoAL a1
(deposited in GenBank as AY167586) and SlSCoAL a2 (deposited in GenBank as AY650029)
only shared 87% sequence similarity with one
another suggesting that they are the product of
different genes. In keeping with this, mapping
studies of the cDNAs using a series of tomato
introgression lines (Eshed and Zamir, 1994),
revealed two independent loci on the Northern
arm of chromosome 2 for the SlSCoAL a
subunits. In contrast, a single locus, on the
Southern arm of chromosome 6 was revealed for
the SlSCoAL b subunit (deposited with GenBank as AY180975). SlSCoAL a1 encodes a
protein with an open reading frame of 332
amino acids, whereas SlSCoAL a2 encodes a
Figure 2. Alignment of SCoAL a amino acid sequences. The
His residue located in the active site is indicated by an asterisk (*). The identification of the CoA-Binding domain and the
active His residue is based on Johnson et al. (1998). Alignments were produced using MULTALIN software.
protein of 337 amino acids and SlSCoAL b a
protein of 417 amino acids. At the protein level,
SlSCoAL a1 and SlSCoAL a2 exhibit 90%
identity with the majority of differences being
located in the first 43 amino acids, although the
SlSCoAL a2 also contains additional residues at
positions 27 and 41 of the SlSCoAL a1 gene.
The SlSCoAL b protein is, in contrast, very
distinct from both SlSCoAL a1 and SlSCoAL
a2 exhibiting no significant similarity. SlSCoAL
a1 and SlSCoAL a2 (in parenthesis) exhibit 75
(70), 72 (67), 71 (66) and 70 (66), % identity to
the functionally characterized succinyl CoA ligases a from Dictyostelium discoideum, Rattus
norvegicus, Mus musculus and Sus scrofa, respectively, whereas, SlSCoAL b showed 56, 53, 52
and 51% identity to the functionally characterized succinyl CoA ligase b from D. discoideum,
Gallus gallus, M. musculus and R. norvegicus,
respectively.
Alignment of SlSCoAL a1 and 2 with other
functionally characterized SCoALs revealed regions of high sequence conservation corresponding
to the CoA binding domain and to the regulatory
phosphohistidine residue previously identified via
crystallography studies of the E. coli enzyme
(Wolodko et al., 1994). Furthermore, in silico
modeling of both possible ab hetero-dimers predicted from the sequences suggested very similar
domain structures and folding patterns to those of
the E. coli enzyme (Fraser et al., 1999).
Analysis of all sequences homologous to the
a-subunit of SlSCoAL in GenBank revealed that
A. thaliana, Drosophila melanogaster and Caenorhabditis elegans also contained two homologs of
this gene. Phylogenetic analysis (Figure 3A), however, demonstrates that the four duplications arose
independently in the Arabidopsis, tomato, Drosophila and C. elegans lineages. Analysis of
sequences homologous to the b-subunit of
SlSCoAL (Figure 3B) suggests that a unique
duplication occurred prior to the separation of
Drosophila from vertebrates. Therefore, Drosophila and the vertebrates have two copies of
b-subunit, while the rest of the analyzed genomes,
including plants, bear only a single copy of the
gene. When this fact is taken into consideration
alongside the diverse enzymatic properties
reported below suggests considerable differences
in the metabolic regulation of this enzyme across
species.
786
Figure 4. Principles of the succinyl CoA ligase assay.
Figure 3. DNA sequence analysis of succinyl-CoA ligase
genes from S. lycopersicum. Phylogenetic tree of the a (A)
and b (B) subunits of succinyl-CoA ligase. The annotated
numbers represent bootstrap values for each node (500 replicates). Independent duplications of the a gene are indicated
with arrows.
Establishment of an assay for succinyl CoA ligase
in the direction of succinate formation
The basis for the new assay is the enzymic cycle
between G3POX and G3PDH (Figure 4). G3POX
catalyses an O2-mediated conversion of G3P into
DAP, and G3PDH converts DAP back into G3P
and simultaneously oxidises NADH and NAD+
(Figure 4B). This cycling system has been thoroughly validated and optimised in previous studies
(Gibon et al., 2002, 2004), here we coupled the
cycling system to the operation of succinyl CoA
ligase in the direction of succinate formation by
the action of glycerokinase (Figure 4A) which
stoichiometrically converts the ATP produced by
succinyl CoA ligase. The amount of plant material
to be included in the assay was optimised to 50 lg
per well (not shown), and a recovery of ATP was
performed with floral extracts and found to be
higher than 90%. Linearity with time was also
checked. The sensitivity of the assay was found to
be at least 50 pmol of ATP in the conditions
described in Materials and Methods, which corresponds to 3–4 lg FW. The activity was found to
range from 50 to 350 pmol per well, which is far
below the linearity range provided by the cycling
assay used (3 orders of magnitude). After determining that the complemented yeast mutants had
elevated activity of succinyl CoA ligase (described
above), we next evaluated the activity of succinyl
CoA ligase in a range of tomato organs. The
highest activity of this enzyme was observed in
floral tissues (383 ± 16 nmol min)1 g FW)1),
however the activity was still relatively high in
leaves (141 ± 4 nmol min)1 g FW)1), whilst green
(62 ± 3 nmol min)1 g FW)1) and red fruits
(28 ± 4 nmol min)1 g FW)1) had relatively low
activities. The activity in all organs is very low
particularly when it is considered that the activities
of aconitase and mitochondrial malate dehydrogenase in the same organs are typically an order of
magnitude faster than this (Carrari et al., 2003;
Nunes-Nesi et al., 2005).
Expression analysis of plant succinyl CoA ligase
subunits
The mRNA levels of the SlSCoAL a1, a2 and b
genes were determined by Northern blots as shown
in Figure 5A. Single bands were observed when
hybridising with SlSCoAL a and SlSCoAL b.
Both genes are highly and equally expressed in
root, stem and flowers, but are also expressed in
leaves and during the whole fruit developmental
process, peaking at 55 DAF coincident with the
onset of fruit ripening. Given that the high degree
of sequence similarity between SlSCoAL a1 and 2
does not allow us to distinguish differential
expression between the two genes we next used
an RT-PCR approach to determine the relative
steady-state mRNA levels of the SlSCoAL a1 and
787
Figure 5. Expression analysis of SlSCoAL a and b subunits. (A) Total RNA of tomato fruit at different developmental stages
(DAF) and tomato plant organs were hybridised with tomato full-length clones of SCoAL a and b subunits. R: Root; S: Stem; Ld:
Leaf collected at day period; Ln: Leaf collected in the night period; F: Flower. Densitometry analysis was performed by using the
Scion Image software package (Maryland, USA). (B) Semi-quantitative RT-PCR analysis of the two SlSCoALa genes. Relative
abundance of a 1 and 2 subunits was measured in tomato plant organs. Values represent the ratios between mean quantifications
of PCR band intensities from single tube amplifications using a common forward primer for both isoforms and two specific reverse
ones. The vertical bar on the left represents the 95% confidence interval of the mean.
2. However, as illustrated in Figure 5B, differences
in the expression of SlSCoAL a1 and 2 are within
the confidence interval (95%), indicating that the
expression of the isoforms is similar across all
organs sampled. This is in agreement with what we
observed when we performed the analysis of the
expression pattern of the genes encoding for the
succinyl CoA ligase alpha and beta subunits in
Arabidopsis thaliana using publically accessible
microarray data (Steinhauser et al., 2004; Zimmermann et al., 2004). The tissue specificity as well
as the patterns of induction/repression of these
genes under abiotic conditions (specially UV-B,
salt and heat stress) follow very similar patterns
meaning that the three genes are also apparently
coexpressed in Arabidopsis.
Subcellular localisation of succinyl CoA ligase
in plants
In order to investigate the cellular localization of
the proteins encoded by the SlSCoAL a1 and 2
and SlSCoAL b genes we first analysed the peptide
sequences by bioinformatic prediction (TargetP,
Emanuelsson et al., 2000; Predotar, Small et al.,
2004; SignalP, Bendtsen et al., 2004). Both SlSCoAL a- and the b-subunits were predicted to be
targeted to the mitochondria. To confirm these
results the complete coding regions were fused at
the carboxyl terminal end, to an enhanced green
fluorescent protein (EGFP, Karimi et al., 2003;
Figure 6) and stably expressed in Arabidopsis
plants. GFP fluorescence was detected in protoplasts prepared from leaves of these plants in
coincidence with the MITOTrack dye
(Figure 6C). These data are in keeping with the
documentation of both succinyl CoA isoforms in
the mitochondrial proteome (Millar et al., 2001;
Sweetlove et al., 2002), and in fact they even
suggest an exclusive mitochondrial localisation of
these proteins.
Preliminary characterisation of enzymatic
properties of plant succinyl CoA ligase
Given that succinyl CoA ligase seems to be present
at relatively low activities in plant organs, and that
the levels of its transcripts and protein have been
788
Figure 6. Expression of SlSCoALa1 and 2 and SlSCoAL b - GFP fusion in A. thaliana protoplasts. SlSCoAL a1-GFP, SlSCoAL
a2-GFP and SlSCoAL b-GFP transformed protoplasts were used for confocal microscopy. (A) GFP fluorescence; (B) MitoTracker
visualization (fluorescence excitation at 554 nm and emission at 576 nm) and (C) Merged image of A and B. Below each picture
schemes of the constructs used to transform A. thaliana are shown.
observed to be highly variable through development (Urbanczyk-Wochniak et al., 2003), and in
response to biological processes such as oxidative
stress (Sweetlove et al., 2002), suggests that it may
be an important control point of the TCA cycle. In
order to gain preliminary insight into the in vivo
regulation of the succinyl CoA ligase we next
determined Km for succinyl CoA and ADP for
crude extracts from yeast and tomato flower
(Figure 7 and data not shown). These studies
revealed that the Km for both succinyl CoA and
ADP were relatively similar in yeast and tomato,
moreover they were also remarkably similar to
those determined for other plant species (e.g.
potato, data not shown). The fact that these data
are in such close agreement with the data obtained
by Palmer and Wedding (1966) on purified plant
enzyme strongly suggests that our result are a good
reflection of the actual Km. Having determined the
Km of succinyl CoA and ADP we next attempted to
determine the effects of the presence of varying the
concentration of other organic acids, within the
assay mixture, on the reaction rate of the enzyme
operating in the forward direction. Whilst several
early metabolites of the TCA cycle had no effect
such as pyruvate and acetyl CoA (Table 1), the
majority of the TCA cycle intermediates effected
the activity of SCoAL. In contrast, the cytotoxic
product of lipid peroxidation, 4-hydroxy-2-nonenal (HNE), which has previously been demonstrated to inhibit several enzymes of the
mitochondrial TCA cycle (Millar and Leaver,
789
Table 1. I50 values for various metabolites in tomato flower
protein extract.
Compound
I50
Pyruvate
Acetyl CoA
Citrate
Isocitrate
2-Oxoglutarate
Coenzyme A
Succinate
Fumarate
Malate
Oxaloacetate
HNE
Nd
Nd
33.8 mM
41.3 mM
a
307.1 lM
7.1 mM
11.2 mM
151.3 mM
1.8 mM
Nd
Assays were carried out in saturating conditions 100 lM succinyl CoA and 2.5 mM ADP.
Nd: not detected.
a
2-Oxoglutarate activated SCoAL in the range of 0.3 – 10 mM.
Figure 7. Kinetic analysis of the SCoAL in the direction of
succinate formation. (A) Dependence of SCoAL activity from
crude extract of tomato flowers on succinyl CoA concentrations. (B) Dependence of SCoAL activity from crude extract
of tomato flowers on ADP concentrations. The Km where
determined by fitting a rectangular hyperbola curve.
2000), had no effect. The only metabolite that was
capable of activating SCoAL was 2-oxoglutarate,
whereas citrate and isocitrate and all metabolites
downstream of SCoAL apparently inhibit its
activity. However, caution must be taken in interpreting these data since in the majority of cases
inhibition was only observed in concentrations far
in excess of those reported in the literature (generally two orders of magnitude higher, Schauer
et al. [2005], Bender-Machado et al. [2004]). The
exceptions to this statement were the activation by
2-oxoglutarate which occurred even at low physiological concentration, succinate and fumarate
which inhibit at relatively high physiological concentrations and citrate which inhibit at very high
concentrations relative to those reported to be
physiological. When taken together these properties of SCoAL suggest that it is inhibited by
downstream intermediates of the TCA cycle.
In summary, although a more detailed characterisation on purified plant enzymes will be
required to confirm and extend these preliminary
observations they suggest that the in vivo flux
through SCoAL may be subject to allosteric
regulation in a manner that would allow a high
cyclic flux in times when carbon is in rich supply
and a reduced flux in times of carbon deficiency.
Moreover, the low activity of the enzyme, when
considered alongside the observations that the
transcription and protein stability of this enzyme
vary both developmentally and in response to
physiological processes such as oxidative stress
(Sweetlove et al., 2002; Urbanczyk-Wochniak
et al., 2003), suggest that this may be an important
control point of the TCA cycle. Whilst we
identified that there were two different genes
encoding the a-subunit in plants, there appears
to be little functional distinction between them
since they are expressed in the same relative level
in all plant organs tested and as expected are both
targeted to the mitochondria. Our yeast complementation indicates that a- or b-subunits can
operate independently but the presence of both
subunits in all plant organs assayed may indicate a
more complex enzyme structure in planta. Since
this work constitutes the first functional identification of the genes encoding SCoAL in plants it
also opens up the possibility to utilize the reverse
genetic approach in order to characterise the role
of this enzyme in plant metabolism and development.
790
Acknowledgements
We thank Lothar Willmitzer and members of
AG Kramer for support and discussion during
the course of this work and would like to
acknowledge the financial support of the KAS
(Konrad Adenauer Stiftung) to CSG. We thank
Amit Gur and Dani Zamir (Hebrew University
of Jerusalem, Rehovot, Israel) for the information concerning the map position of the genes
described in this report and Joachim Selbig
(same institute) for help with protein structure
predictions. FC is member of conicet.
References
Bendtsen, J.D., Nielsen, H., von Heijne, G. and Brunak, 2004.
Improved prediction of signal peptides: SignalP 3.0 . J. Mol.
Biol. 340: 783–795.
Bender-Machado Bäuerlein, L. M., Carrari, F., Schauer, N.,
Lytovchenko, A., Gibon, Y., Kelly, A.A., Ehlers Loureiro,
M., Müller-Röber, B, Willmitzer, L. and Fernie, A.R. 2004.
Expression of a yeast acetyl CoA hydrolase in the mitochondrion of tobacco plants inhibits growth and restricts
photosynthesis. Plant Mol. Biol. 55: 645–662.
Carrari, F., Coll-Garcı́a, D., Schauer, N., Lytovchenko, A.,
Palacios-Rojas, N., Balbo, I. and Rosso And Fernie, M.
A.R. 2005. Deficiency of a plastidial adenylate kinase in
Arabidopsis results in elevated photosynthetic amino acid
biosynthesis and enhanced growth. Plant Physiol. 137:
70–82.
Carrari, F., Nunes-Nesi, A., Gibon, Y., Lytovchenko, A.,
Loureiro, M.E. and Fernie, A.R. 2003. Reduced expression
of aconitase results in an enhanced rate of photosynthesis
and marked shifts in carbon partitioning in illuminated
leaves of wild species tomato. Plant Physiol. 133: 1322–1335.
Drager, D.B, Debrosses-Fonrouge, A.G, Krach, C., Chardonnens, A.N., Meyer, R.C., Saumitou-Laprade, P. and Kramer,
U. 2004. Two genes encoding Arabidopsis halleri MTP1
metal transport proteins co-segregate with zinc tolerance and
account for high MTP1 transcript levels. Plant J. 39:
425–439.
Emanuelsson, O., Nielsen, H., Brunak, S. and von Heijne, G.
2000. Predicting subcellular localization of proteins based on
their N-terminal amino acid sequence. J. Mol. Biol. 300:
1005–1016.
Eshed, Y. and Zamir, D. 1994. A genomic library of Lycopersicon pennellii in L. esculentum: A tool for fine mapping of
genes. Euphytica 79: 175–179.
Fernie, A.R., Carrari, F. and Sweetlove, L. 2004. Respiratory
metabolism: glycolysis, the TCA cycle and mitochondrial
electron transport chain. Curr. Opin. Plant Biol. 7: 254–261.
Fraser, M.E., James, M.N.G., Bridger, W.A. and Wolodko,
W.T. 1999. A detailed structural description of Escherichia
coli succinyl-CoA synthetase. J. Mol. Biol. 285: 1633–1653.
Gibon, Y., Blaesing, O.E., Hannemann, J., Carillo, P., Höhne,
M., Hendricks, J.H.M., Palacios, N., Cross, J., Selbig, J. and
Stitt, M. 2004. A robot-based platform to measure multiple
enzyme activities in Arabidopsis using a set of cycling assays:
comparison of changes of enzyme activities and transcript
levels during diurnal cycles and in prolonged darkness. Plant
Cell 16: 3304–3325.
Gibon, Y., Vigeolas, H., Tiessen, A., Geigenberger, P. and Stitt,
M. 2002. Sensitive and high throughput metabolite assays
for inorganic pyrophosphate, ADPGlc, nucleotide phosphates, and glycolytic intermediates based on a novel cycling
system. Plant J. 30: 221–235.
Johnson, J.D., Mehus, J.G., Tews, K., Milavetz, B.I. and
Lambeth, D.O. 1998. Genetic evidence for the expression
of ATP- and GTP-specific succinyl-CoA synthetase in
multicellular eucaryotes. J. Biol. Chem. 273: 27580–
27586.
Karimi, M., Inze, D. and Depicker, A. 2002. GATEWAY
vectors for Agrobacterium-mediated plant transformation.
Trends Plant Sci. 7: 193–195.
Kaufman, S. and Alivisatos, S.G.A. 1955. Purification and
properties of the phosphorylating enzyme from spinach.
J. Biol. Chem. 216: 141–152.
Kumar, S., Tamura, K., Jakobsen, I.B. and Nei, M. 2001.
MEGA2: molecular evolutionary genetics analysis software.
Bioinformatics 17: 1244–1245.
Lambeth, D.O., Tews, K.N., Adkins, S., Frohlich, D. and
Milavetz, I. 2004. Expression of two Succinyl-CoA synthetases with different nucleotide specificities in mammalian
tissues. J. Biol. Chem. 279: 36621–36624.
Millar, A.H. and Leaver, C.J. 2000. The cytotoxic lipid
peroxidation product, 4-hydroxy-2-nonenal, specifically
inhibits decarboxylating dehydrogenases in the matrix of
plant mitochondria. FEBS Lett. 481: 117–121.
Millar, A.H., Sweetlove, L.J., Giegé, P. and Leaver, C. 2001.
Analysis of the Arabidopsis mitochondrial proteome. Plant
Physiol. 127: 1711–1727.
Nunes-Nesi, A., Carrari, F., Lytovchenko, A., Smith, A.M.O.,
Loureiro, M.E., Ratcliffe, R.G., Sweetlove, L. and Fernie,
A.R. 2005. Enhanced photosynthetic performance and
growth as a consequence of decreasing mitochondrial Malate
dehydrogenase activity in transgenic tomato plants. Plant
Physiol. 137: 611–622.
Obiadalla-Ali, H., Fernie, A.R., Kossmann, J. and Lloyd, J.R.
2004. Developmental analysis of carbohydrate metabolism
in tomato (Lycopersicon esculentum cv. Micro-Tom) fruits.
Physiol. Plant 120: 196–204.
Palmer, J.M. and Wedding, R.T. 1966. Purification and properties of succinyl-CoA synthetase from jerusalem artichoke
mitochondria. Biochim. et Biophys. Acta 113: 167–174.
Przybyla-Zawislak, B., Dennis, R.A., Zakharkin, S.O. and
McCammon, M.T. 1998. Genes of succinyl-CoA ligase
from Saccharomyces cerevisiae. Eur. J. Biochem. 258: 736–
743.
Ryan, D.G., Lin, T., Brownie, E., Bridger, W.A. and Wolodko,
W.T. 1997. Mutually exclusive splicing generates two distinct
isoforms of pig heart succinyl-CoA synthetase. J. Biol.
Chem. 272: 21151–21159.
Saitou, N. and Nei, M. 1987. The neighbor-joining method: A
new method for reconstructing phylogenetic trees. Mol. Biol.
Evol. 4: 406–425.
Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Extraction,
purification, and analysis of messenger RNA from eukaryotic cells. In: N. Ford, C. Nolan and M. Ferguson (Eds.),
Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY,
pp. 7.3–7.83.
791
Schauer, N., Zamir, D. and Fernie, A.R. 2005. Metabolic
profiling of leaves and fruits of wild species tomato: A survey
of the Solanum lycopersicon complex. J. Exp. Bot. 56: 297–307.
Schiestl, R.H. and Gietz, R.D. 1989. High efficiency transformation of intact yeast cells using single stranded nucleic
acids as a carrier. Curr. Genet. 16: 339–346.
Small, I., Peeters, N., Legeai, F. and Lurin, C. 2004. Predotar:
A tool for rapidly screening proteomes for N-terminal
targeting sequences. Proteomics 4: 1581–1590.
Steinhauser, D., Usadel, B., Luedemann, A., Thimm, O. and
Kopka, J. 2004. CSB.DB: A comprehensive systems-biology
database. Bioinformatics 20: 3647–3651.
Sweetlove, L.J., Heazelwood, J.L., Herald, V., Holtzapffel, R.,
Day, D.A., Leaver, C.J. and Millar, A.H. 2002. The impact
of oxidative stress on Arabidopsis mitochondria. Plant J. 32:
891–904.
Urbanczyk-Wochniak, E., Luedemann, A., Kopka, J., Selbig,
J., Roessner-Tunali, U., Willmitzer, L. and Fernie, A.R.
2003. Parallel analysis of a transcript and metabolic
profiles: a new approach in systems biology. EMBO Reports
4: 989–993.
Van der Hoeven, R., Ronning, C., Giovannoni, J., Martin, G.
and Tanksley, S. 2003. Deductions about the number,
organization and evolution of genes in the tomato genome
based on analysis of a large expressed sequence tag collection
and selective genomic sequencing. Plant Cell 14: 1441–1456.
Wider, E.A. and Tigier, H.A. 1971. Porphyrin biosynthesis in
soybean callus tissue. VIII. Isolation, purification and
general properties of Succinyl CoA synthetase. Enzymologia
41: 217–231.
Wolodko, W.T., Fraser, M.E., James, M.N.G. and Bridger,
W.A. 1994. The crystal structure of succinyl-CoA synthetase
from Escherichia coli at 2.5-A resolution. J. Biol. Chem. 269:
10883–10894.
Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and
Gruissem, W. 2004. GENEVESTIGATOR. Arabidopsis
microarray database and analysis toolbox. Plant Physiol.
136: 2621–2632.