Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download The Janus face of immunity : how anti-tumor
Document related concepts
Immune system wikipedia , lookup
Lymphopoiesis wikipedia , lookup
Monoclonal antibody wikipedia , lookup
Psychoneuroimmunology wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Adaptive immune system wikipedia , lookup
Molecular mimicry wikipedia , lookup
Innate immune system wikipedia , lookup
Sjögren syndrome wikipedia , lookup
Immunosuppressive drug wikipedia , lookup
Transcript
The Janus face of immunity : how anti-tumor immunity
leads to autoimmunity in paraneoplastic neurological
diseases
Christina Gebauer
To cite this version:
Christina Gebauer. The Janus face of immunity : how anti-tumor immunity leads to autoimmunity in paraneoplastic neurological diseases. Immunology. Université Paul Sabatier - Toulouse
III, 2016. English. <NNT : 2016TOU30139>. <tel-01492922>
HAL Id: tel-01492922
https://tel.archives-ouvertes.fr/tel-01492922
Submitted on 20 Mar 2017
HAL is a multi-disciplinary open access
archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from
teaching and research institutions in France or
abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est
destinée au dépôt et à la diffusion de documents
scientifiques de niveau recherche, publiés ou non,
émanant des établissements d’enseignement et de
recherche français ou étrangers, des laboratoires
publics ou privés.
5)µ4&
&OWVFEFMPCUFOUJPOEV
%0$503"5%&-6/*7&34*5²%&506-064&
%ÏMJWSÏQBS
Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier)
1SÏTFOUÏFFUTPVUFOVFQBS
Christina GEBAUER
le
15. Novembre 2016
5JUSF
The Janus Face of Immunity
How anti-tumor immunity leads to autoimmunity in
paraneoplastic neurological diseases
²DPMF EPDUPSBMF et discipline ou spécialité ED BSB : Immunologie
6OJUÏEFSFDIFSDIF
UMR 1043 Centre de Physiopathologie Toulouse Purpan
%JSFDUFVSUSJDFT
EFʾÒTF
Prof. Roland LIBLAU
Jury :
Prof.
Prof.
Prof.
Prof.
Prof.
Eliane PIAGGIO
Doron MERKLER
Francois GHIRINGHELLI
Joost VAN MEERWJIK
Jacqueline MARVEL
Rapportrice
Rapporteur
Rapporteur
Président
Examinatrice
5)µ4&
&OWVFEFMPCUFOUJPOEV
%0$503"5%&-6/*7&34*5²%&506-064&
%ÏMJWSÏQBS
Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier)
1SÏTFOUÏFFUTPVUFOVFQBS
Christina GEBAUER
le
15. Novembre 2016
5JUSF
The Janus Face of Immunity
How anti-tumor immunity leads to autoimmunity in
paraneoplastic neurological diseases
²DPMF EPDUPSBMF et discipline ou spécialité ED BSB : Immunologie
6OJUÏEFSFDIFSDIF
UMR 1043 Centre de Physiopathologie Toulouse Purpan
%JSFDUFVSUSJDFT
EFʾÒTF
Prof. Roland LIBLAU
Jury :
Prof.
Prof.
Prof.
Prof.
Prof.
Eliane PIAGGIO
Doron MERKLER
Francois GHIRINGHELLI
Joost VAN MEERWJIK
Jacqueline MARVEL
Rapportrice
Rapporteur
Rapporteur
Président
Examinatrice
!
_$ /.# `
_Q**.1 '/`
_2&$).`
_0-&($N!&*)/# #*- `
_0-&($Ngnj`
"%&.#$%+*
! #1 /* .-$ /# './ !*0- 4 -. 2*0' .4 $/ 2. ) (5$)" #$& Q +./
1'' 4.N#$''.)(*0)/$).N
.2(5$)"/#$)".N#+ -! /2 /# -N"*//#-*0"#
.('')$"./*-(.N#!0)N2.*- N2.))*4 N#(4*2).)0+.0/
"*/'24.(*/$1/ 2# )
- # )*/# -/*+*!(*0)/$)Q
2.#++4N.N
# *0/.N ! '/ ./-*)" ) $) ./-0/$' Q *2 1 -N 2*0' )*/ .* !- . (
-$"#/ )*2 $) (4 #$& *! '$! 2$/#*0/ '' /# + *+' -*0) ( ) 2. '0&4 /*
( /'*/*!(5$)")"- /+ *+' /#/
2)//*/#)&2$/#''(4# -/Q# . + *+' "$1 ( 2/ -)!**2# )
#1 )* ) -"4)4(*- Q# 4- /# -*+ /#/ +-*/ /. ( 2# ) #1 /* +.. )" -*0. .$/0/$*).Q # 4 - / #$)" ( #*2 /* ()" $!!$0'/$ . ) ' -) '*/ /#/ 2$'' # '+!0' /* *)/$)0 (4
24Q
(- ''4'0&42$/#''/# . + *+' -*0)( )
2*0')*/ # - 2 - (2$/#*0//# (Q$"XY!*- 1 -4*4/#/
( /0-$)"/#$.'./!*0-
4 -. ) .+ $' /#)& 4*0 !*- '' /# .0++*-/ "*/ /# './ (*)/# !*- (4
! ). Q#/2.- ''42 .*( )"1 ( '*/*! ) -"4QTTTT
) # % &8 ) &)&% )"#)8 ) )%& * ) %## 8 /#)&
4*0!*-/# - 1$.$*))4*0-+*.$/$1 *(( )/.*)(4()0.-$+/)!*-*($)"
/**0'*0. !*-(4# ! ). /* +-/*!(4%0-4Q
) (,# % )-#8 /#)& 4*0 !*- +/$)" /* %0-4 ( ( - *! (4 #
*(($// )'.*!*-4*0-# '+!*-/# '*24/*( /-4./$)$)"- "-$)"n
''.Q
) &&*+ %;).! "8 /#)&4*0!*- +/$)"/* /# +- .$ )/*!(4#
%0-4Q
2)//*/#)&'*//# < $ % #*& + +$* 8 % N/# 0-- )/( ( -.)/# W.0/'.*/# ( ( -./#/'- 4' !/Q
/2."- //*
2*-& 2$/# '' *! 4*0 ) ( #++4 /#/ # /# *++*-/0)$/4 /* ( / .* ()4
"- / + -.*).N '' 2$/# /# $- *2) #-/ - ) #$/.Q * )*/ 2)/ /* ($.. /# 3+ -$ ) /*2*-&$).0#$""-*0+ 1 )$!$/2.)*/ .4''/# /$( O`Q#)&
4*0!*-''/# !0))/# .0++*-/T
)&#%N
&)*22 #*0-$!!$0'/$ .)0+)*2).Q
(.0- N
2.)*/
/# .$ ./ # ./0 )/ /* #)' ) *0- $!! - )/ 24. *! /#$)&$)" 2 - )*/
# '+$)" $/# -$).*( .$/0/$*).Q
(#++4/#/2 ()" /*!$)24$)/# ) ) ( *).$*0. ) "-/ !0' *0/ /# /#$)". /#/ 4*0 #1 *) !*- )
2#/*++*-/0)$/$ .4*0"1 /*( Q#)&4*0'*//#/4*0'24./**&/# /$( /*
$.0..N)/#/4*0'24../4 +*.$/$1 )+/$ )/N
- ''4++- $/ /#/Q
' -) '*/ 0-$)" /# . !*0- 4 -.N .$ )/$!$''4 0/ '.* + -.*)''4 ) #*+ /#/!$)''4N
*0'*)1$) 4*0/#/ 1 )$!
'0"#'*/)'*0
(. -$*0.)
#-2*-&$)"+ -.*)O`Q
)#N/#)&4*0.*(0#!*-4*0-.0++*-/ .+ $''4/# './(*)/#._!*-/# */*-'.#**'`Q
- ''4++- $/ /#/
*0''24.*( ).&4*0 1 )/# (*././0+$,0 ./$*).)/#/4*02 - '24.+/$ )/2$/#( Q
) % # =,% >N -$ 0*0+ +*0- </- (*) +--$) +*0- ' . /-*$.
-)$:- .)); . /+*0-( .*0/ )$-+ ))/' .*($/;.0/#:. / .-;0)$*).Q
W++-;$ .;)*-(;( )//'W*% /$1$/;.0- .#*. .Q -$0..$+*0-*--$" -' -;.0(; ) !-)9$. / .0-/*0/ +*0- </- (*) !*0-)$.. 0- 0 !; + ))/ ' .
-)$ -./-*$.).T
) 8 *)*/&)*2#*2/*/#)&4*0!*- 1 -4/#$)"4*0#1 *) !*-( Q
#)& 4*0 !*- '' /# .$ )/$!$ ) + -.*)' $.0..$*). /# # '+ !*- /# 3+ -$( )/.N/# ( )/'.0++*-/N/# !0))4)./#$)".2 .#- ) .+ $''4
4*0-!-$ ).#$+Q
(#++4/#/2 ()" /*"*/#-*0"#''/#$./*" /# -Q*0- (4*'' " N04)/# (*./$(+*-/)/N(4!-$ )Q
('**&$)"!*-2-!*-
4*0-1$.$/$)0./-$)/*1$.$/4*0$)-.$'_*-
.- 'UO``$"#0"T
)38/#)&4*0!*-$)/ "-/$)"( $)/*/# / (/#/2 ''$)/# "$))$)")
!*- $)/-*0$)" ( $)/* /# +-*% / ) /# / #)$,0 .Q / 2. +' .0- /* 2*-&
/*" /# -2$/#4*0)
(1 -4#++4/#/
"*/4*0..0+ -1$.*-!*-(4./ -
$)/ -).#$+Q#)&4*0/#/4*0/-0./ ( !-*(/# "$))$)"*))/#/4*02 - '24./# - !*-).2 -$)",0 ./$*).*-/*.#*2( .*( ./0!!*)'*2*Q
(1 -4
#++4/#/2 !$)''4()" /*+0'$.#/*" /# -T☺
2)$ # 82))8( -$ 0*0++*0-/*0/TTTT*/- /-1$'N1*/- $ /
1*0.(<( *(( + -.*)) .;/$/.0+ -$(+*-/)/+*0-,0 % +0$.. -;0..$-!$- ( /#:. Q -$ 0*0+ +*0- /*0/ ' . .N /*0/ ' . " )*/4+" . .)"N +*0-
'W$ +*0-' .()$+._(<( l#0(/$)*0+*0- ./-0.+./-:."- ' .R`N
1*/- )"" ( )/ ). ' '* ($. 0..$ ( -$ +*0- ' . + /$/. +0. !;N +*0-
()" - ). (' N +*0- $.0/ -N +*0- -$- N +*0- -7' -N +*0- !$- . *)) -$ .R
( -$N( -$N( -$T☺
2)3# %8W;/$/0)+'$.$-+-/" -' 0- 01 /*$+ ))/ 03).Q -$
+*0-/*0.' .*0/. #**'/N' .*)) -$ .N' .-$ 0-. // .'"0 . ^1( (),0 5 0*0+TTT☺
) N( -$ 0*0++*0-/+*.$/$1$/; /+*0-/+..$*)+*0-'.$ ) Q
W;/$/ /*0/ ' . / (+. ";)$' $.0/ - 1 /*$ . -;.0'//. / ' .$ ) )
";);-'N )W$(+*-/ *0 _'W)$(' -$ + ))/ !$- . $)% /$*).` / )W$(+*-/ ,0 '' # 0- _l#0(/$)+-:.( ) -0) .;($)-$./ 'W;-*+*-/`Q1( /-*+(),0 -T
2) %% =:>8 ( -$ +*0- / *)) #0( 0-N . ) */ . ,0W;/$ )/ .0+ -
-B' #,0 !*$. /+*0-( *(+") -+*0-*0-$- )/- ($$ / 03T☺
2) )!&) N /-*+ ";)$' ,0 /0 . 1 )0 +*0- ( /#:. T <( .$ *) +.
/-1$'' -/-:.'*)"/ (+. ). (' W;/$/0)+'$.$- /%W .+:- *)1 )*- .*01 )/
!$- '!</ ). (' T☺
2)#&=:>8% .$.,0 % + 03*(+/ -.0-/*$)W$(+*-/ ).,0 '' .$/0/$*)^
/0;/$./*0/' ./ (+.'S( -$ 0*0++*0-T*(+/ 0*0++*0-(*$T
-$ 0*0+/*0/ .' .0/- .( (- . "-*0+] /' +*0-/*0/' !0)
0'*P ));,#+*0-.*)*)#0( 0- /. .'"0 .+*0--$ .O`N0) $+*0-
' .+-*/**' .N' ..*0-$.jkQg /' ./*0/ .' .) */ .N% * % ,%!*-
'24. $)" '( ) +*.$/$1 N , ##,$ => !*- '' /# $.0..$*). )
( $' 1$ .N %% : !*- /# + -.*)' ) .$ )/$!$ $.0..$*). ) ( )/'
.0++*-/N , ##,$ +*0- ' . $.0..$*).N ' . .*$-; . / ' . *0-. . ,0W*) !$/
). (' N * +*0- ,0 % +*01$. / +*. - )W$(+*-/ ,0 '' ,0 ./$*) +*0- .
+-*;0- .N .+-*/**' . /QN *+*0-/" )/$'' .. //*).*0-$- N#& :+*0-
/*) -/:- $- / ,0 %W++-;$ . 0*0+N ) + #$% +*0- /*0/ ' .
/ (+. </- +-</ +*0- .*-/$- / *-")$. - . HN #N %%0N 4+% /
)$0+*0-' .*)1 -./$*). /!0)0'*Q
'.* 2)/ /* /#)& /2* !*-( - ' ( ( -. # %8 &, % %%)+ /#/
# '+ ( '*/0-$)"(4!$-./4 -$)/# '0/'.* ))8)#*8)&8)8
) *+&'%'#Q
.+ $'/#)&./*/# / (( ( -.*!$*'.')#-Q#)&4*0!*-*+/$)"
( $)4*0-/ (Q
#'*/*!!0))/# './/#- 4 -.2*0')*/#1 )/# .( 2$/#*0/"*$)"0+/*/# k/#!'**-(*- '.*))*2/*/# /)O`
) &#*N/#)&4*0!*-''/# .$ )/$!$$.0..$*).)/# # '+).0++*-/
) *! *0-. "$) !*- /# ($-*.*+ !*- /# )$"#/ *! /# - . -# -. ^ - ''4
++- $/ ''/#/'*/Q
) %%8 #*2 /* +0/ $) 2*-. 2#/ 2 #1 "*) /#-*0"# /*" /# - ) #*2
$(+*-/)/ *0- !-$ ).#$+ 2. ) ./$'' $. /* .0-1$1 /# $"" ./ ./*-(.Q # (*./
$(+*-/)/ /#$)" #*2 1 - $. /#/ 2 '24. # !0) )* (// - #*2 $" /# ./*-(
2.Q '+$)"*0/2$/#)/$*$ .N /$)"/*" /# -N-$)&$)"*!! /*" /# -N**&$)"
/*" /# -N '$($)"N #$&$)"N /-1 ''$)"N /'&$)"N (*/$1/$)" ) # '+$)" # */# -N
'0"#$)"N-4$)"N#1$)"!0))(0#(*- (& 4*0/*.+ $'+ -.*)/*( Q*0
- (5$)"_ 1 )$!4*0*)W/ '$ 1 $/O``Q#/2 *0' /# - !*- #*/# -
1 )$!4*02 - *)/# */# -.$ *!/# * )*)!$-( /*( /#/*0-!-$ ).#$+
2$'' ) 1 - )$)")*(// -2# - 2 - Q*0- /# --*/)00( -$)
(4'$! O#)&.!*- 1 -4/#$)"T$"N$"N$"0"TTT
) &&&&&&&%8 '!$'' '+'0.!*'' N";)$' /" )/$'' 0(*) TTT /V($- +- ,0 /0.$.,0V ./ ,0 /01 03N/0+ 03-$- .0-/*$(<( _(*/.';.P.*0-$.N
" O`` /%V$'W$(+- ..$*),0 /0+ 0- -$ )Q0+ 03!$- -$- /*0/' (*) //0-;0..$/#,0 !*$.,0 %W*0'$ /*0/,0 ./#$)/ +*0-' (*( )/*) ./
). (' Q ) 1$. %($. *0'$ ,0 /0 (W. ++-$. ,0 ' /-0 ') ). ' +(+' (*0.. ./ .0+ - *03^ #$#$ O`Q .0$. /- . /- . *)/ )/ /W1*$- *(( ($ T ./ *(( /0 .T /W (-.. Q
2) & N ( *+$) 'W))$1 -.$- ☺Q ( -++ '' /-:. $ ) ,0) *) ++-$. ,0 *) )*/- ))$1 -.$- ' (<( %*0-Q W;/$/ /-*+ *)/ )/ %W;/$/
)*- +'0.*)/ )/,0)*);$;' !</ - ). (' T0) + 03+.$("$) -T
W;/$//*0/' ./ (+.$(+- ..$*)) -*(( //0+ 03- ./ -'( 0*0'*/ /+-:.
,0)*).*-//0 .'[)$)"0 )\ '.*$-; Q
'400) *0/ .' .'$*).
.*)/' .( $'' 0- .TO`
2)% N /0 . 0) ! (( ";)$' T W$ *- ' . *)1 -./$*). 1 /*$Q .
.*$-; .,0W*)+.. ). (' ;/$ )//*0/' ./ (+..0+ --B' Q -$+*0- /
( -$0..$ 0*0++*0-/*).*0/$ ).0-/*0/' . -)$ -(*$.T
)&8
(- ''4#++4/#/
#/# *.$*)/*( /4*0)/*'$1 2$/#
4*0-!*-.*( /$( T
'24.++- $/ *0-$.0..$*) .+ $''4$)/# ($' *!
/# )$"#/!/ -"*$)"*0/*1 -'..*!#$.&4O`Q
2)# 82)) %82)# **8),# %82)$ # N( -$1*0.
0..$(W*+/;).1*/- "-*0+QW$++-;$;. 0*0+/*0/' .+0. .!;.N' .
/$1$/;.)' ..*$-; . ). (' TW;/$//*0%*0-.";)$'T -$T
&)%=>S'- $) *0$)S#$#$☺ .- +. ($$) .*)/+.' .(<( .).
/*$N .). / . + /$/ . ) */ .N #$./*$- .^ (W 1-$( )/ (),0; ' . -)$ -.
(*$.T0.0) !$'' 3/-*-$)$- N/*0/' ./ (+. *)) #0( 0-($..$$'4
./-0.,0 ) 1*)/+.Q ./ *(( T
2)&$ % (,&1+N2)3%3 +% /2)+# )%2*N0)
"-)( -$1*0.+*0-/*0/T*0.;/$ 50)"-)$ +*0-/*0/ 'W($)$./-/$*)N
'W*-")$./$*) / . -;. -1/$*). 'W1$*)N - ./* /Q ^ ( -$ +*0- 1*/- / (+.N
1*/- $ N1*/- +/$ ) T
) # ''8 2) %) %8 2) ,#N( -$ 0*0++*0-!$- -*0' -' (".$) /''1 -$ /)*0.!*0-)$-1 ' .0/$' .+*0-)*/- /-1$'T
2)+ $82)#3) 82)%%;,)8% 1*0.- ( -$ +*0-( !*-( -
.0-'4/*(;/-$ N+*0-!$- /-$1 (*$_(<( #*. ,0 'W$-$(+*..$' ` /
+*0- </- ' +*0- /*0/ ' . ,0 ./$*). ($. 0..$ +*0- . $.0..$*). )*)S
.$ )/$!$,0 .Q -$T
2) + 8 2) &)8 2) #8 ( -$ 0*0+ +*0- .W*0+ - .
( . .*0-$. ' . -)$ - ,0/- ). / +*0- </- +/$ )/ 1 (*$ ,0) %W$ *0'$;
.-$!$ -' ..*0-$.*0,0)%W$!$/ . -- 0-.Q# 'N0)"-)( -$0..$+*0-
(W$ - +*0- ' *($/ ;/$,0 T /% / *-#N 0) "-) ( -$ 1*0. +*0- /- /*0/ ' . / (+. *) #0( 0- / +*0- ( //- 'W($) 'W)$(' -$ T W// ).
)*- '1$;*O`
) "-) ( -$ 0..$ 0 "-*0+ N .0-/*0/ )&# &$&8 ,)0
,) /3# %)&,**&,*NW;/$/0)+'$.$-/-1$'' -1 1*0.Q -$+*0-1*/- *''*-/$*)N 1*/- $ / 1*/- +/$ ) / +*0- "- - ( . .*0-$. + ))/ ' .
-)$ -.,0/- ).Q
) % ,)N /#)& 4*0 !*- 4*0- *''*-/$*) *) (4 +-*% / ) /# "- /
#$./*'*"4+$/0- .Q
(0-$*0.$!*0-24.-*.."$).*( 4N
#*+ .*Q
) ))0N ( -$ 0*0+ +*0- ( .*0/ )$- ). . (*( )/. $!!$$' . /
+*0-)*.+ /$/ .*)1 -./$*).0/*0- 0) /.. 0/#;T .0$..0-*)1-;0..$-
'' -'(*)/") ). (' 0)%*0-T☺
-$;"' ( )//*0/ .' .0/- . )/- 1 ,0$%W1$/' +'$.$-$)/ -"$-N.*$/
+*0- . +-*/**' . *0 . *).$") .N )*/(( )/ &' &%+ +*0- ' . .*0-$.
+jl /' " )*/4+" /# - )&)+*0-'+-*0/$*) .)/$*-+.Q
-$ 0..$ 'W;,0$+ +*0- *-")$. - ' .;($)$- ;/0$)/ P ,)3# 8 ,8
%%8) &%8#' %8 +4+%QW;/$/.0+ -1 1*0.T -$T
)"-)( -$ 8%%8) &%8$ # 8%%+3# %+*0-'+-/$$+/$*)
'0$/ # -# 0-hfgkQW;/$/0) 3+;-$ ) .0+ -";)$' +*0-(*$ /% .0$.
/-:.*)/ )/ ,0W*)!$/ ). (' ^( -$N( -$N( -$T☺
-$0..$&$*8 ,# %8 , ##,$8 3# %8 &' 8 %% + ,0$*)/
*0-01 (*$ )/- ($$ / 03T!$/0$ )6#,0 !*$.T☺
#0" /#)&./*/# )10 )#*N))N-$*)N*-") )*$ 2$/#2#*(
#
'24. '*/ *! !0) 0-$)" '0)# ) *0/.$ /# ' ) 2#* .0++*-/ ( $)
()4$!! - )/24.Q
#/2*0'
*2$/#*0/(4-54)'*1 '4 $ #0^/# 4- (4#*( )(4
.0++*-/ 1 )$!
(($' .24!-*(/# (Q# 4- '24./# - )
&)*2
)
*0)/*)/# ()*(// -2#/#++ ).Q#/$..*( /#$)"
(- ''4"-/ !0'*0/
)(& .( - ''4#++4Q#)&4*0/#/4*0'24. '$ 1 $)( T
'*1 4*0
''T
$8 # ) '8 $# 2*''/ 0# $( .+ 5$ '' ) )& )Q #- #/ ($#
$(( -0)/ -./G/5/ "'2.!G-1 --G&/ )$##// 0)2.!G-'D.$))$#
)" ./ ''/ # Q #- #/ ($# $(( - ( $) ) " " # ) '.. )N . $./ )$#/
. './1 -./8)'$#0)!G-$)$# 0#0)# $('$#)&-Q)& N..$#-($#
'$ /.*2$ $#$)Q
) +*8 # +) %8 # ) 8 $# $) 0)# $('$# !-*# 0# '.
.#2$./ -50# )0)/*/')&-N..$#$(( -0! 0#58#' )&))Q.
#/($-$ ' /5/ )#- $(( -"-*F )'/" " )Q)& T
## 0#'$ Q
)% 80). - " ( $).( .#$#/ $./.*1 --G&/2$ " )$'QG-($#$./
.()#('$(( -)*#0)"'0'$#N..2$-2$ -50.(( )" !0) )# )Q
$-# ) .0).)$#/' $#/" (#/ - .#/.$#1*''0." 5#'/Q.$./ $)!#
)0- .#D) 0) $# $) /*/' "'G&'$#N .. 2$- '' . .* "0/ 0-#" ./) ) # )Q
0 #./ ($# $ $ ) ' /5/ ) #-$// ) 0! ( " 50 $) ( ( $) -
.#2 -./ ) $+! ' "' $/ /N ($# (*/$1$ -/N $./ 50 ($- " ./) )N #./ ) ($#
" "'0/ ^ '' . #/ ($- -!/ " " ) 0) !G- $) $# $- 0) )'$# )&-Q
#) $#N( $) 8)) -.#)$// N#8// $#.'' .)$#/.*" .#!!/Q
#!- 0($#
.#*). #-0!0). - -)8#./ )" ( $).( ) )/ 0 -T - %0./2 .*( O`
#'$ $#T
$) "-*F . )& .#D) 0# ) , *8 %%# *8 + 8 &$8 $# 8 #& ,%
)%8 .. $#- ($# .* # -5'$# 0!" )*(( ) #/ 0) !G- '' $ .#D) )
*( )/ $ 2$-$.% /5// $' )&*))/ )T
$" '.* /* '' (4 !-$ ). *0/.$ /# ' /#/ - .// - /#-*0"#*0//# 2*-'!*-$./-/$)"( !-*(2*-&) $)"/# - $)''$!! - )/
&$).*!.$/0/$*).P
%*8 2$ " ."/ .$./.#2 -$)*-/ 50!.. )N2.0($-0)0). - - 0).#!/ 0/ /Q 0 #./ ($# $(( - $).+$-$ -/N (*/$1$ -/ 0) ($- " 5 $"/
2.()'' .0.. $) ( )(# )&))Q $) $ ).#!/!G-$ $)" $ 0 " -) (#./ 0) '$ ./ (#/ $# 50 $) ( ")5 .*) - ) ).# )Q
). - " # ).$#*!/" /- ))/ -2$-!$) )$(( -2$ -50.(( )N. $
.$)*)/+ ''$ -N*0'*0. N0)N*-0AN$ )N
)).-0&N -"* -#*!! )/'$#
$) )/$"* #$' 0) . (#/ 0). - - 0).#!/ )*# $)(' 50 /2.
$)5$"-/$" (T0$./.$# -$ -.*)$ '' .1*)($-2 $F0)($#( ./ )
& ))/^$#2G).# ($-1*)")5 ( -5 )N.. ..*' $/0)2$-)*#$) )
)8#./ )gff#- )) )Z- '*)#$''X )& )Q#) $#28- $#)$#/#$ -
2*$#$)Q$#'$ T
&# &*N0#..2$-$)")50-*+1 -./- 0/.$)#'/ /0).)$#/1*)
$(( -$)*)/&/50' $ )0)0)." " ). $/$"500)/ -./G/5 )Q./0$0(
28- $ 2 $/ ( )$#/ .* " )$' " 2 . ) *#) 0). - 1 --G&/ -S-0++ Q
)& !G-$ $ ).#!/$ $#-!G-$ $.. ).#!/0!-$)"/0)$ $#-$)($-
" 2 &/ #/Q #) 0# 28- $# )$#/ .* 2 $/ " &*(( ) 0) #8// $# 0#
.$# -& $) )#0-#" ./) )T
#%80#./($#.#*)$).*1$ ' )1 -.#$ ) ) ).'" ) "' $/ /N
& ))./($#$) )1 -.#$ )./ ) // )0)$/0/$*) )0)$./($-/-*/5 (
)$ 1*) - $/ " 2$# )Q$)$& .N..0($#.*)$((./2$ $#$)
0) $(( - !G- ($# $./Q $) /8-& N ) -"$ 0) */$1/$*) +0.# ) ($#
$(( -2$ -^.$./ $)!#" )$'T)& !G-'' .T0!.0). - - 0).#!/
)*#0). - )8#./ )m )G -0 -/T☺
* ##++8 0). - ) 0) #-&/ - &D)) ) 0)/ -.#$ '$# - )$#/
. $)0)/-*/5 (!0)&/$*)$ -/ . $)!#52$.# )0).Q$-.$)j0)/ -.#$ '$#
" !*-(/ '8// -$ " ( $).( $)20) -.#D) .- 0).#!/.S' '//$' )Q
# )& 0# !G- $ "-*F )/ -./G/50)"N $ " ( $).( ) .#D) )N /-0-$" )N
'0./$" ) 0) .#2$ -$" ) *( )/ )Q #- . $/ $)!# "-*F-/$" -0 ) 0) $#
# -*F .'G& 0#50& )) )T)& !G- 0- ')"%8#-$" - 0).#!/T
) *+&)8 /#)&.!*-''/# -540/'.*. -$*0.(*( )/.)$.0..$*).Q
/
2.'24."- //*'$(2$/#4*0^4*0'24.()" /*" //# ./*0/*!( $) /# '$($)" #'' ) '.* !*- $'4 '$! T *0 - !$)$/ '4 *) *! /# -5$ ./
+ -.*). /#/ ( / $) (4 '$! ) !*- /#/ ( 1 -4 "-/ !0'T #)& 4*0 '.* !*-
- $)" ) *-- /$)" (4 ()0.-$+/N /#/ 2. "- / # '+T / 4*0 .**)
.*( 2# - $)/# 2*-'O`
" N $# $) .* !-*#N .. 2$- 0). - - 0).#!/ 2$ - ) 0 )/ &/
# )0)2$-0).2$ -( #-#D- )Q./0/$(( -1*''"0/($/$-50.&4+ )TTT☺
) , ##,$8 /0 ;/$. ( +- ($ - *))$..) ) (*) +- ($ - 1-$ ($ *0'*0. Q W$ ;*01 -/ 0) )*01 0 !9*) 1$1- 1 /*$ / %W$ +..; .
(*( )/./-:.!*-/*/; /*$1 +' $) .. )/$( )/. /;(*/$*).Q01- ./ -
).(*)E0-/*0/ (1$ Q -$T
2) ,)N,0 '' #) / *))>/- TTT1$ *0'*0. )W ./+.'(<( 1 /*$T -$ 0*0++*0-/+*.$/$1$/;N/;) -"$ N/ .$; . //*) .+-$/Q -$
+*0-(W ./!$- *))>/- ' (*) 0.+ /' '-0 /' (*) .-<1 .N' :- $)-N'W*% /$1 '0) N++40'/0- NR^' (*) 0- T☺$1 ( )/' +-*#$)! ./$1'TTT
2)&% NW ./ )*- $)-*4' ,0W*). - /-*01 -*0'*0. +-:.*-0A
/ )+'0.,0W*)#$/; ). (' Q -$ 0*0+,0 /0;/$.'+*0-(*$.0-/*0/
0;0/*0'*0. QW;/$/";)$',0 /0(W$( ) -+-/*0/ /'+/$ ) ,0 /0
1$. 1 (*$ +*0- ' !-)9$. ($. 0..$ ). ' (*( )/. $!!$$' . +*0- (*$Q .0$. /-:. *)/ )/ ,0 % +0$.. !$- /*0/ . . . 3+;-$ ) . 1 /*$ / 1$1- .
(*( )/.$!!$$' .($.0..$!*0 /$)-*4' 1 /*$_+- 3 (+' 'W$).-$+/$*)
0- /*)/") O``Q)+ 03!$- /01 /*$ /%W*- /*$T$.*0.Q
2) ) +N /*) -$- 1 ( (),0 - / 0..$ /*) ;) -"$ T W /$/ .0+ - #$/ -
). (' 1 /*$T W$ *- 0$.$) - 1 /*$ _ ) +'0. W /$/ /-*+ *) #,0 !*$.TO`` / ()" - ). (' +*0- +-' - +' $) . /-0.Q -$ +*0- /*0/ / 0)
"-)( -$+*0-( .*0/ )$-).' .(*( )/.$!!$$' ..0-/*0/' . -)$ -.(*$.T
$.*0.Q
-$ 0*0+0..$0"-*0+ ). (-$ /1 )- $# 5$#:' -*Q
W;/$/";)$'). - //-1$'' -1 1*0.TTTT
2) 2#N( -$ 0*0++*0-' . -)$ -./-*$.)) .Q .0$..0+ -*)/ )/
,0 /0(W +/ )./*)*0-. ) *)/ (+*-$) QW++-$. 0*0+.0-'
). /.0-(*)*-+. /W /$/0)+'$.$-1*$-/*$*(( +-*! .. 0-($.0..$
*(( ($ Q . *0-. ). / ' . 1 -- . 0 1$) *0 0 2#$.&4 1 )- $ .*$-
1*)/( (),0 -T -$+*0-/*0/T
)"-)N"-)
(*)'0,)+&%+%^0)'0
)/ -)/$*)'O`^ /
/*0/ . .( (- .Q '0 /' ." ).,0$%W$- )*)/-;'6S.(W 0*0+$;
.*-/$- '1$ '* / +- )- 'W$-QW1$.'#) ;*01-$-' .4-;); .
/' .+*-/ (*)/") !*)1 03QW$++-$. 0*0+.0-' ./ #)$,0 .N.0-
' . (*)/") . / 0..$ +*0- (*$Q -$ +*0- /*0/ . ' . 3+;-$ ) .N ' *)) #0( 0- /+*0-(W +/ -*(( % .0$.T
2) ) % 8 ) +8W .//-*+";)$'1 1*0.T*0/' ..*-/$ .W .' N
'+$)$.( N -)*)); .N ' . - +. ' ($.*)N ' -0; !.NR % .$. ,0 + 03
*(+/ - .0- 1*0. )W$(+*-/ ). ,0 '' .$/0/$*) S ( -$ 0*0+ +*0- 1*/- ($/$;T
) %%+ :8 ( -$ 0*0++*0-( (*)/- -' +'$.$- 'W .' /+*0-
( +*0.. - 0S ..0. ( . '$($/ .T . .*-/$ . W .' ;/$/ /*0%*0-. ";)$' /
0..$ .+ /$/ .*) -/'($.*)1 *)$T -$+*0-/*0/T
) %8( -$ 0*0++*0-'W$).-$+/$*)'W--# 0- /*)/") TW;/$/
'( $'' 0- #*. ,0 +*01$.--$1 -T -$0..$+*0-/*0/' .-)*)); . //*)
;) -"$ /,0W ./ ,0 /0.!$/+*0-' '0T
#&&%+%+*
*+&)- + &%=#'+ #&))>::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
*+&#*::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
*+& ,)*:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
3*,$3::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@
*+)+:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::B
@ %+)&,+ &%:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::D
@:@ $$,%*0*+$::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::E
gQgQg $./*-4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQl
gQgQh # $))/ $((0) - .+*). QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQn
gQgQhQg #)$')# ($'--$ -.QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQo
gQgQhQh ''0'---$ -QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgf
gQgQi # +/$1 $((0) - .+*). QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgh
gQgQiQg # #0(*-'$((0) - .+*). QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgj
gQgQiQh # ''0'-$((0) - .+*). QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgk
gQgQiQhQg .].^/# & 4$)$/$/*-!*- ''/$1/$*)QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgk
gQgQiQhQh ''.QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgl
gQgQiQhQi 4) -"4 /2
)jq)nq ''.QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQhf
gQgQiQhQj ((0) # &+*$)/.QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQhg
@:A )%&'#*+ *0%)&$*:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::AD
gQhQg $./*-4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQhk
gQhQh +$ ($*'*"4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQhk
gQhQi '$)$' /0- .QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQhl
gQhQj )/$*4( $/ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQig
gQhQk ''S( $/ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQig
gQhQkQg -) *+'./$ - ''- " ) -/$*)QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQih
gQhQkQh )/$S0.4)-*( QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQij
@:B %+ ;+,$&,) $$,% +0. +$'* *&%
##*:::::::::::::::::::::::::::::::::::::::::::BE
gQiQg $./*-4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQil
gQiQh -$ !*1 -1$ 2*!/# 1 '*+( )/*!) -QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQil
gQiQi # /#- .*!) -$((0)* $/$)"QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQio
gQiQiQg '$($)/$*)QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQio
gQiQiQh ,0$'$-$0(QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQjg
gQiQiQi .+ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQjg
gQiQj - '/ )/$S/0(*0-$((0)$/4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQjj
@:C ,+& $$,% +0:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::CE
gQjQg $./*-4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQjl
gQjQh +$ ($*'*"4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQjl
gQjQi 1 '*+( )/*!0/*$((0) $. . .2$/# (+#.$.*) ''.QQQQQQQQQQQQQQQQjm
gQjQj 0/*$((0) $. . .*!/# QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQkg
gQjQjQg .$((0) +-$1$' " .$/ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQkg
gQjQjQh -*..$)"/# N)_#*-*$+' 30.`QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQkj
A !+ -*:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::DF
A:@ %)+ &%&%% $#$&#$ $ " %%-#,+ &%&+)&#&
##* %:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::DF
A:A $$,%"'& %+ % + &%*+) )&):::::::::::::::::::::::::::::::::::::::::::::::::::DF
B *,#+*:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::DH
B:@ CI%GI##*)&+%+& %,')%&'#*+ %,)&#& #
** %$&,*$&#::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::DH
B:A C#&"# +*')%&'#*+ %,)&#& # ** %$&,*
$&#:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@?B
C *,** &%::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@@F
C:@ 0%)0&CI%GI##* %::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@@G
C:A ;C*"0$&#,# %-#&'$%+::::::::::::::::::::::::::::::::::::::::::::::::::::::::@@H
C:B GI##**$ %+&)* %:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@A?
C:C ')&'&*$&#&+-#&'$%+&:::::::::::::::::::::::::::::::::::::::::::::::::::::::@A@
D &%#,* &%%)*'+ -*:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@AB
E # &)'0::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@AD
F %%/:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@CB
F:@ $$,%&'+&%* *&')%&'#*+ %,)&#& #*0%)&$***& +
. +%+ ;,%+ & *9% #%+ +,$&) $$,%)*'&%*& %.)0:::@CB
F:A )+ &%&%'# +&% G##* %+&+%+)#%)-&,**0*+$ *
C @; %+) %::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@DD
'%%+&%+
F:B ,)&%*%##*9%)*+% %+ * %+)+ &%&) %#$$+&)0
%,)&#& # ***:::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::@EH
*+&)- + &%=#'+ #&))>
R( -$)0/*$((0) '/ $. . ..*$/$*)
R0/*$((0) $. . R0/*$((0) $. . **-$)/$)"*(($// R0/*S$)!'((/*-4$. . SgR/4+ )/$S) 0-*)')0' -)/$*4
R)/$" )S+- . )/$)" ''
R'**-$)--$ -
R'**S--$ -
bS"'RbS"'/*.$. R'**' +/*( )$)" '--$ -
hR - ''- " ) -/$*)S- '/ +-*/ $)h
hR - ''- " ) -/$*)S- '/ +-*/ $)hS'$& R )/-') -1*0..4./ (
R4/*/*3$'4(+#*4/ .
SjR4/*/*3$'4(+#*4/ ..*$/ +-*/ $)j
R - -*.+$)'!'0$
R(" S..*$/ +// -)
R )-$/$ ''
R*-.'-**/")"'$
R 3+ -$( )/'0/*$((0) ) +#'*(4 '$/$.
R(-4*)$ /#'N)*-('$.$*)
R+-*/ $)S*0+' - +/*-
R# (""'0/$)$)
"R$((0)*"'*0'$)
R$)/ -! -*)
R$)/ -' 0&$)
R
)!'((/*-4*2 '$. . $R$)0$' )$/-$*3$ .4)/#. $-.R$((0) S- '/ 1 -. 1 )/.
R$)/ - ''0'-# .$*)(*' 0' R$((0) .4./ (
R%0)/$*)'# .$*)(*' 0' R( -/S/*)(4./# )$.4)-*( R'4(+#*4/ !0)/$*)S..*$/ )/$" )
R'4(+#)* R'4(+#)* ./-*(' ''.
R(0*.'1.0'-- ..$) ''# .$*)(*' 0' R(%*-#$./**(+/$$'$/4*(+' 3
R0'/$+' ' -*.$.
R/$*)'
)./$/0/ *! '/#
R)/0-'&$'' - ''
RS'$& - +/*-
RS( /#4'SS.+-// R)0' */$ S$)$)"*'$"*( -$5/$*)*($)
R)$/-*" )*34" )
R+/#*" )S..*$/ (*' 0'-+// -)
SgRS/4+ /$*)S/-).+*-/$)". R+-) *+'./$ - ''-$. . SgR+-*"-(( '' /#+-*/ $)g
SgR+-*"-(( '' /#+-*/ $)'$")g
R+-) *+'./$ ) +#'*(4 '*+/#4
R+-) *+'./$) 0-*'*"$'$. . R+-) *+'./$*+.*'*)0.S(4*'*)0.
R+// -)- *")$/$*)- +/*-
SgRS. ' /$)"'4*+-*/ $)'$")Sg
R+-) *+'./$. ).*-4) 0-*+/#4
R# 0(/*$-/#-$/$.
R- *($)/$*)/$1/$)"" ) R- /$)*$$S$)0$' " ) R
S
S'$& - +/*-
R- /$1 *34" ).+ $ .
gR/4+ g$ / .
R ''- +/*-
/R/*' -*" )$ )-$/$ ''
!! ''R !! /*- ''
# ''R# '+ - ''
R*''S'$& - +/*-
R/0(*-) -*.$.!/*-
- " ''R- "0'/*-4 ''
R1.0'- ''# .$*)+-*/ $)
R1*'/" "/ '$0(#)) '
*+&#*
' gQ)/$S) 0-*)'S)/$*4S..*$/ +-) *+'./$$.*- -.QQQQQQQQQQQQQQQQQQQQQQQQQQhn
' hQ$")*./$-$/ -$*!$)/# QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQho
' iQQ
((0) ''.*. -1 $)/# *!+/$ )/.2$/#/# 0.4)-*( *-
QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQho
*+& ,)*
$"0- gQ$( '$) *!$))/ )+/$1 $((0)$/4QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQn
$"0- hQ1 -1$ 2*!/# !! /*-!0)/$*).*!/# +/$1 $((0) .4./ (QQQQQQQQQQQQQgi
$"0- iQ/$1/$*)) !! /*-!0)/$*).*! ''.QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgj
$"0- jQ.+-*1$ )$(+*-/)/'$)& /2 )$))/ )+/$1 $((0)$/4QQQQgl
$"0- kQ$!! - )/jq ''..0. /.QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgo
$"0- lQ!! /*-0)/$*)*!.QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQgo
$"0- mQ#- +-*+*. (* '.*!Sj!0/$*).QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQhj
$"0- nQ0)/$*)*!$((0) # &+*$)/$)#$$/*-(*' 0' .QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQhj
$"0- oQ'$)& 3$./. /2 )) 0-*'*"$'()$! .//$*).N/# 0) -'4$)") -
))/$*$ .$)/# . -0( (*)./-/ $)) 3(+' *!/2*+/$ )/.
QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQif
$"0- gfQ
)!'((/*-4$)!$'/-/ .)'*..*!0-&$)% ''.$)+/$ )/2$/#.0S
0/ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQii
$"0- ggQ/#*'*"4*!-$)!-*(+/$ )/2$/#)/$S0 ) +#'$/$.QQQQQQQQQQQQQQQQQQQQQik
$"0- ghQ 1 '*+( )/*!) -QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQin
$"0- giQ# +-* ..*!) -
((0)* $/$)"QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQji
$"0- gjQ )/-'/*' -) Q*0-.0-$)"/# 1 '*+( )/*! ''.$)/# /#4(0.
QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQkf
$"0- gkQ -$+# -'/*' -) QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQkf
$"0- glQ# $)$/$/$*))+-*"- ..$*)*!jq ''( $/ .)
3(+' !*-/# +/#*" )$. $))0/*$((0) $. . QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQki
$"0- gmQ# +-* ..*! ''($"-/$*)/#-*0"#/# $)/*/# QQQQQQQQQQQQQQQQQQQQQkl
$"0- gnQ* '*!/# 1 '*+( )/*!..*$/ 2$/#)/$*$ ."$)./
$)/- ''0'-)/$" ).QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQghh
3*,$3
. .4)-*( . ) 0-*'*"$,0 . +-);*+'.$,0 . _` .*)/ . ('$ .
) 0-*'*"$,0 .-- .N..*$;.60) -;+*). $((0)$/$- !!$ *)/- 0)) -
.*0.S% )/ 3+-$()/0))/$":) ;"' ( )/ 3+-$(;+- . ''0' .0.4./:( ) -1 03 )/-' _`Q ) - ;' )# '*-. 0) -;+*). 0/*S$((0) . *)$- ,0$+-*1*,0 ' ./-0/$*) . ''0' .0Q -/$)./-103-; )/.
.0"":- )/ ,0 'e$((0)$/; 6 (;$/$*) ''0'$- ..*$; 6 . 0/*S)/$*-+.
- *))$..)/ . )/$":) . $)/- ''0'$- . +*0--$/ %*0 - 0) -B' (% 0-N $ )
,0e )*- ('*(+-$.N).'+#4.$*+/#*'*"$ .Q
. 3 (+' . ' .+'0.- +-;. )//$!..*)/' .4)-*( 0N,0$*)0$/
6 ' + -/ $1 -. . +*+0'/$*). ) 0-*) . 0 / 'W/3$ ;-; '' 0. .0$"0= _
) )"'$.N +*0- -) *+'./$ - ''- " ) -/$*)`N
-/;-$.; +-'+ -/ .;' /$1 . ''0' . 0-&$)% 0 -1 ' /Q'*-.,0 ' .4)-*( 0. ;1 '*++ )";);-'# 5 .+/$ )/.+-;. )/)/ ./0( 0-.0
+*0(*)6+ /$/ . ''0' .,0$ 3+-$( )/'W)/$":) 0.+;$!$,0 .) 0-*) .N'
(%*-$/; . +/$ )/. .*0!!-)/ +-;. )/ 0) ) - "4);*'*"$,0 ,0$
3+-$( '+-*/;$) hN;"' ( )/ 3+-$(; ).' . ''0' . 0-&$)% Q!$) ($ 03 -) - ' +#4.$*+/#*'*"$ . / / ./ - 'e$(+'$/$*) 'W$((0)$/;
''0'$- N)*/(( )/ .'4(+#*4/ .N)*0.1*).0-)/(/#:. ;1 '*++; /
)'4.; 03(*:' .(0-$).N'W0)+*0-' .4)-*( 0 /'W0/- +*0-'Q
. (*:' . - +*. )/ .0- 'e0/$'$./$*) .*0# . .*0-$. ";);/$,0 ( )/
(*$!$; .P ' .*0-$. (SN ,0$ 3+-$( 'W#;(""'0/$)$) _` 0 1$-0. '
"-$++ ). ' +'0+-/ . . ) 0-*) . 0 / ' .*0-$. mS ). ',0 '' '
+-*/;$) ./ 3+-$(; 3'0.$1 ( )/ +- ' . ''0' . 0-&$)% 0 -1 ' /Q
). ..*0-$.N0) -;+*). )/$S/0(*-' ./+-*1*,0; +-'e$)% /$*) ''0' .
/0(*-' . jg 3+-$()/ _jgS`Q !$) ' !$'$/ - ' .0$1$ . -;+*). .
''0'$- .*)/- 'W)/$":) N)*0.1*).$)% /; .'4(+#*0/ .jq /]*0
g
nq )?!. $.*'; . 6 +-/$- .*0-$. /-).";)$,0 . +*0- . -; +/ 0-. '4(+#*4/ ..+;$!$,0 . Q
*. -;.0'//. (*)/- )/ ,0 . 0' ' /-).! -/ . ''0' . /0(*-' .
jgSN / )*) '0$ . ''0' . jg /;(*$).N + 0/ *)0$- 6 'W/$1/$*)N '
+-*'$!;-/$*) /'$!!;- )/$/$*) . 03/4+ . '4(+#*4/ ..+;$!$,0 .+*0-
'W)/$":) Q +'0.N )*0. 1*). *. -1; ,0 ' . +*+0'/$*). '4(+#*4/ . jq / nq .*)/ /*0/ . 03 - ,0$. .N )*) . 0' ( )/ +*0- 0) -;+*). )/$S
/0(*-' !!$ N ($. 0..$ +*0- ' ;' )# ( )/ W0) -;/$*) 0/*S$((0) *''/;-' # 5'.*0-$.(SQ)!$)N)*0.1*).(*)/-;,0e$';/$/); ..$- e$)% / - ) +-'':' . )/$*-+. *)/- ' -; +/ 0- $)#$$/ 0- Sj # 5 '
.*0-$.mSN!$) + -( //- '($"-/$*) .'4(+#*4/ ..+;$!$,0 . ). ' -1 ' /Q # 5 . .*0-$. mSN )*0. 1*). ) *0/- ;(*)/-; ,0 ' .
'4(+#*4/ .nq4/*/*3$,0 ..*)/' . !! / 0-.+-$)$+03 '('$ Q
. )*01 03 (*:' . (0-$). - +-;. )/ )/ *) . *0/$'. +-;$ 03 +*0-
0) ( $'' 0- *(+-;# ).$*) . (;)$.( . (*';0'$- . - .+*).' . 0
;1 '*++ ( )/ .Q +'0.N$'.+*0--$ )/+ -( //- / ./ - / 1'$ - )*01 '' . ++-*# . /#;-+ 0/$,0 . 1$.)/ 6 '*,0 - ' +;);/-/$*) ). ' e !! / 0-. $((0)$/$- . +*/ )/$ '' ( )/ +/#*":) .N /*0/
'W !!$$/; '-;+*). )/$S/0(*-' )+;-$+#;-$ Q
h ) +-;. -1)/
*+)+
-) *+'./$) 0-*'*"$'$.*- -._.`- -- #0()0/*$((0) $. . .
/#/ (*./'4 !! / /# )/-' ) -1*0. .4./ ( _`Q # 4 - /-$"" - 4 )
!!$$ )/$((0) - .+*). "$)./) 0-'. '!S)/$" )/#/$. /*+$''4 3+- .. $) ) *+'./$ /0(*- ''. ) )/0-''4 3+- .. $) ''.Q 0 /* /#$. .#- )/$" )$ 3+- ..$*)N /# $((0) .4./ ( - /. )*/ *)'4 /* /0(*- ''. 0/ '.* /*
) 0-' ''.- .0'/$)"$)) 0-*'*"$'(" Q-*2$)"/+*$)//*(%*--*' *!
''S( $/ $((0)$/4 $) . ..*$/ /* 0/*)/$*$ . "$)./ $)/- ''0'-
+-*/ $).Q*2 1 -N$/.+- $. *)/-$0/$*)$)/# +/#*" ) .$.- ($).0)' -Q
2* $''0./-/$1 3(+' . *! +*..$'4 ''S( $/ . - /# 0S
.4)-*( N #-/ -$5 4 $)!'((/$*) ) 2$ .+- '*. *! ) 0-*).N )
+-) *+'./$ - ''- " ) -/$*)_`N#-/ -$5 4/# . ' /$1 '*..*!
0-&$)% ''.Q 1 '*+. (*./'4 $) +/$ )/. 2$/# "4) *'*"$ -$)*(. /#/
3+- ../# 0-&$)% ) 0-*)S.+ $!$h+-*/ $)2# - .(*./+/$ )/.2$/#/# 0S.4)-*( #-*- .('' '' '0)" ) - 3+- ..$)" /# ) 0-*)S.+ $!$ +-*/ $)
0Q
) /#$. *)/ 3/N *0- ./04 $( /* $)1 ./$"/ /# $(+/ *! )/$S/0(*-
''0'- $((0) - .+*). . $) /# 1 '*+( )/ *! /# . .Q * /#$. )N 2 1 '*+ /2* )$(' (* '. ($($&$)" /# 0S.4)-*( ) Q 0. /0(*- '' '$) 3+- ..$)" /# # (""'0/$)$) _` *! 1$-0. /* $)0 )
)/$S/0(*-- .+*). $)(S($ N2#$# 3+- ..$)) 0-*).)mS
($ N2#$# 3+- ..*)'4$) - ''-0-&$)% ) 0-*).Q*+-*(*/ )/-&
/# '' - .+*). "$)./ /# )/$" )N )?1 S.+ $!$ nq )]*- jq ''.N*-$"$)/$)"!-*(S/-)." )$)$('.N2 - /-).! -- $)/*/# . ($ Q (*)./-/ /#/ S 3+- ..$)" /0(*-.N 0/ )*/ *)/-*' /0(*-.N $)0 /$1/$*)N +-*'$! -/$*) ) $!! - )/$/$*) *! )?1 S.+ $!$ jq ) nq ''.$)/* !! /*- ''.Q*- *1 -N/# *''*-/$*) /2 )/# . /2* ''.0. /.
2. ) /* *)/-*' /0(*- "-*2/# ) $)0 $)!'((/$*) $) (S
($ Q ) mS ($ /# $/$*)' $)% /$*) *! /# )/$*4 "$)./ /# $)#$$/*-4
i
- +/*- Sj 2. ) ..-4 /* ''*2 ''. /* )/ - /# - ''0( /* 0. $)!'((/$*))/# .0. ,0 )/ ./-0/$*)*!0-&$)% ) 0-*).Q0-/# -(*- N$)
mS ($ 2 (*)./-/ /#/ 4/*/*3$ nq ''. - /# ($) !! /*-.
-$1$)"/# $. . Q
#0.N/# . /2*) 2(*0. (* '.+-*1$ !0-/# -$).$"#/.$)/*/# ''0'-
( #)$.(. *! 2# - 4 +*/ )/ )/$S/0(*- $((0)$/4 /-$"" -. ) -S
..*$/ 0/*$((0) $. . N)(4/# - !*- # '+/* 1 '*+) 2/# -+ 0/$
./-/ "$ ."$)./Q
j @ %+)&,+ &%
0-$)"(4#
2*-& *)$!! - )/.+ /.*!/# $((0) .4./ (_
`Q* 1 '*+
(*0. (* '($($&$)"+-) *+'./$) 0-*'*"$'$. . _`
#/*' -)
*0/ */# )/$S/0(*- $((0)$/4 ) 0/*$((0)$/4Q +/$ )/. .0!! - !-*(
) 0-*'*"$'+-*' (./#/- /#*0"#//* 0 /*)$((0) - .+*). "$)./)
0) -'4$)" /0(*- /#/ 3+- .. . ) )/$" ) '.* !*0) $) /# )/-' ) -1*0.
.4./ ( _`Q *2 1 -N /0(*-. - *!/ ) )*/ .4 /* / / $) /# . +/$ )/.
$)$/$)" /#/ /# )/$S/0(*- $((0)$/4 $. +-/'4 !!$$ )/Q #0.N $. "**
3(+' *!#*2/# $((0) - .+*). ) ) !$$'.2 ''. ' / -$*0.//# .( /$( Q # '$)& /2 ) )/$S/0(*- $((0)$/4 ) 0/*$((0)$/4 ) /# $ )/$!$/$*) *! 2#$# $((0) *(+*) )/. - $(+'$/ $) /# +-* .. *! - ./$''+**-'40) -./**)+-*1$ /# - !*- "**.$.!*-(4#+-*% /Q
( $) /#$.N $/$*)''4 "$) $).$"#/. $)/* /# - "0'/$*) *! /# $((0) - .+*). 0 /* +#4.$*'*"$ $)#$$/*-4 .$")'.Q # $)#$$/*-4 - +/*-
Sj2..#*2)/*+'4& 4-*' $) ''/*' -) )/0(*- .+ .2 ''.
0/*$((0)$/4Q
/.$(+'$/$*)$)/0(*-$((0)$/4/0-).$//*+*/ )//-" /!*-)/$S
) - /- /( )/Q / ' /* /# 1 '*+( )/ *! /# -+ 0/$ )/$SSj )/$*4
/#/ 2. .#*2) /* )#) !! /*- '' /$1$/4 "$)./ /0(*- ''.Q *2 1 -N
/# - - - +*-/. *! ) - +/$ )/. /- / 2$/# )/$SSj /#/ 1 '*+ 0/*$((0) S- '/ 1 )/.Q / ./ /# -*' *!/#$.)/$*4$)0/*$((0)$/4$)
(*0. (* '*!+-) *+'./$ - ''-$. . _`N.0/4+ *!Q
)*/# - .+ / 0-$)" (4 /# .$. 2. /* 0) -./) #*2 ''. -*.. /# '**S-$) --$ - _` ) 2#$# (*' 0' . - $(+'$/ $) /#$. +-* ..Q
) -./)$)" /# 3/ ( #)$.( *! $((0) '' )/-4 (4 ' /* /# 1 '*+( )/ *! ) 2 /# -+ 0/$ ./-/ "$ . $) Q # . ./-/ "$ . .#*0'
.+ $!$''4 '*& '' )/-4 $)/* /# 2$/#*0/ !! /$)" /# !!$$ )4 *! /# )/$S/0(*-$((0) - .+*). Q
*-- +- . )/./#0."**(* '$. . /*./04/# '$)& /2 )
/# . !*0-.+ /.*!/# $((0) .4./ (Q
)/#$.()0.-$+/
2$''/-4/*-2'$) k
/2 ) )/$S/0(*- $((0)$/4 ) 0/*$((0)$/4 2$/# .+ $' (+#.$5 *) /# -*' *!ab ''.)*)/# **+ -/$*)*!jq)nq ''.Q/-/$)"2$/#/# $((0) - .+*). / /# .$/ *! /# /0(*- ) $/. ($-* )1$-*)( )/ 2$'' /# )
(*1 /*$)#$$/*-4# &+*$)/.N ''/*' -) N.4) -"4 /2 )jq)nq
''.*1 -/# ($"-/$*)*! ''.$)/*/# N/# $)/ -/$*) /2 ) ''.)
) 0-*).0)/$' ./-0/$1 0/*$((0)$/4Q
) *- - /* +-*1$ !0'' +$/0- *! /# $((0) .4./ ( ) /* // -
0) -./) $/. !0)/$*)'$/4N -$ !'4 .-$ $/. /*-. ) /# $- -*' . 0-$)"
$((0) .0-1 $'') 2$/#.+ $'!*0.*)/# +/$1 ''0'-$((0) - .+*). )ab ''.Q
@:@ $$,%*0*+$
@:@:@ *+&)0
# #$./*-4 *! $((0)*'*"4 $ )*/ !*''*2 .4./ (/$ *- #-*)*'*"$' *- - .
.*( *!/# +- 1$*0.*. -1/$*).*-#4+*/# .$.) !0-/# -+-**! !*- $)"
+/ Q *2 1 -N !*- /# - 1*'0/$*)-4 $ /#/ ($-* .N $)1$.$' !*- /# 4 N - - .+*).$' !*- $. . .N + *+' $) 2 ./ -) 0'/0- . /#*0"#/ /#/ .$&) ..
2. +0)$.#( )/ !-*( "*_.` *- 2$/#-!/gQ / -N 0-$)" /# "- / +'"0 . *!
0-*+ + *+' '( $- /* /# 0. *! /# . +$ ($.gQ ) *)/-./N $)
./ -) 0'/0- .N $. . . 2 - ) - ./$'' /# *0/*( *! ) $(') $) /# ) -"4 #)) ' *! /# *4Q 1 -/# ' ..N .$) jif Q $/ 2. )*/$ /#/ $!
.*( *) .0-1$1 $. . # *-.# (4 *( - .$./)/_X$((0) Y`/*$/gQ# !$-./ 3+')/$*)!*-'*)"'./$)"$((0)$/4!/ -.(''+*3$)! /$*)2."$1 )4/# !(*0.-+#4.$$)0 &-*#(( $)&-$54'S5$_nnfSoih`gQ
. -'4.gmffN/# #$) . 0. ($'$)! /$*)2$/#)0)(*$!$ +/#*" )N
+-* 0- .$($'- /* $((0)$5/$*)N /* +-*/ / + *+' !-*( $. . Q # 4 $). -/ /# -$ 30/ *! .(''+*3 +0./0' . $)/* /# )*. *! + *+' /* 0. $((0)$/4
"$)./ .(''+*3 $)! /$*)Q #$. ( /#* 2. '' 1-$*'$/$*) _!-*( /# 1-$*'
l 1$-0.`)!*0)$/.24/**)./)/$)*+' ).+- !-*(/# - -*0)0-*+ gQ
//# )*!/# gn/# )/0-4_gmon`2- )) -N))"'$.#+#4.$$)N*. -1 /#/($'&($.2 - +-*/ / !-*(.(''+*3$!/# 4#+- 1$*0.'4 )$)! / 2$/# *2+*3Q - 2 /# *)'0.$*) /#/ !*- #0(). $)! /$*) 2$/# *2+*3 $.
#-(' ..)+-*1$ .$((0)$/4/*.(''+*3Q#/2./# "$))$)"*!/# *) +/
*!1$)/$*)_1r'/$)2*-!*-*2`gQ.$/2.(0#.! -/#)1-*'$/$*)
/# ( /#* ( -*'4 +/ $)0-*+ - "-' ..*!$/.-$/$.Q
# 1 '*+( )/ *! /# ($-*.*+ 4 )/*)$ 1) 2 )#* & !$)''4
+-*1 /#/ .(''N $)1$.$' *-")$.( 3$./.Q . *) /#$. - &/#-*0"# *0$.
./ 0-!*-(0'/ #$.X" -(/# *-4*!$. . YQ (*)./-/ /#//# . .(''
*-")$.(.) +/#*" )$)/#/$. . ) /-).($// !-*()$)! / )$('/*)0)$)! / *) gQ*2 1 -N$/2.* -/*#/#/ (*)./-/ /#/
/# " -( /# *-4 ++'$ )*/ *)'4 /* )$('. 0/ '.* /* #0().gQ 2. ' /*
$.*'/ /# +/#*" ).0.$)")/#-3)/0 -0'*.$.).#*2 /#//# 40. /# $. . .' $)"/*/# +0'$/$*)*!/# *#W.+*./0'/ .$)gnofgQ//# .( /$( ($' 1*) #-$)" ) $/./* #$.0-C (*)./-/ )/$*4 /$1$/4
"$)./ $+#/# -$ ) / /)0. /*3$). ) $)$/$/ /# /# *-4 *! #0(*-'
$((0)$/4gQ$34 -.'/ -0' .*- / .-$ !*-/# !$-.//$( /# *(+' ( )/
.4./ (gQ # ''0'- /# *-4 *! $((0)$/4 1*'1 /2 ) gnni ) gofkQ '4
/#)$&*!! +*./0'/ /#/ #0() ''. - '.* ' /* + -!*-( +#"*4/*.$.
_$.*1 - 4-)./ #'$).$)"' ''*-")$.(.`.+-/*!/# #0() ! ). ( #)$.( "$)./ $)1$)" +/#*" ).gQ $) /# hf/# )/0-4 /# !$ ' *!
$((0)*'*"4 -+$'4 1) Q 2 *) +/. #1 ) 1 '*+ _+-$)$+' *!
'*&S& 4 !*- )/$*4S)/$" )` ) ) 2 (*' 0' . $.*1 - _4/*&$) .N
# (*&$) .`Q ) $/$*)N ()4 .$")'$)" +/#24. 2$/#$) $((0) ''. /#/
/ -($) /# $- !0)/$*)'$/4 #1 '.* ) .-$ $)'0$)" /# $- 4.!0)/$*)
/#/)' /*()4$. . .Q
*4 $/ $. &)*2) ) +/ /#/ /# $((0) .4./ ( *).$./. *! /2*S
'$) ! ). P/# $))/ $((0) .4./ ()/# +/$1 $((0) .4./ (Q# ''.
*! /# $))/ $((0) .4./ ( / !$-./N ) *)'4 $! $/ !$'. /* ' - /# $)1$)"
+/#*" )N /# ''. *! /# +/$1 $((0) .4./ ( /& . *1 -Q # 4 2*-& /$"#/'4
m
/*" /# - ) /# - !*- +-*1$ ) !! /$1 ) .*+#$./$/ +-*/ /$*) "$)./
$. . Q
,) @: $# % & %%+ % '+ - $$,% +0 =)&$ * + #:8 ##,#) % &#,#)
$$,%&#&0>:# $))/ $((0)$/4$./# !$-./'$) *! ! ). )/.1 -4-+$/*$)! /$*))'/ - ''.Q
//$1/ ./# +/$1 $((0)$/4/#/ 1 '*+..'*2 -0/+-*1$ .(*- .+ $!$$((0) - .+*). Q
@:@:A %%+ $$,%)*'&%*
# $))/ $((0) - .+*). $./# !$-.//*-*!/# $((0) ! ). $)((('.Q
./# )( X$))/ Y$(+'$ .N$/$./# +-/*!/# $((0) .4./ (/#/2 #1 !-*(
/# !$-./4*)2#$#2 - *-)Q
/.*(+*) )/.- '24.+- . )/$)*-").)
/$..0 .N - 4 /* ! ) /# *4 !-*( ($-* . /#/ /-4 /* )/ - /# *4Q /
- .+*). 1 -4 !./ /* +/#*" ). ) $)%0-$ . _$"0- g` 0/N '..$''4N * . )*/
!*-( ( (*-4 !/ - /# ' -) *! $)! /$*)h^jQ # ''. *! /# $))/ $((0) .4./ ( 3+- ..+// -)- *")$/$*)- +/*-._.`/#/)$./$)"0$.# /2 )
$!! - )/ '.. . *! )" -*0. )/$/$ . 4 - *")$5$)" !$3 ./-0/0-' (*/$!.
n _(*' 0'-+// -).`/#/- .#- 4"-*0+.!-*(- '/ ($-* .*-(" ''.h^jQ# . (*/$!.- '' +/#*" )S..*$/ (*' 0'-+// -)._.`*-
(" S..*$/ +// -). _.`iQ . - " -('$) S )* N #$"#'4
*). -1 )/# $-$1 -.$/4$.'$($/ Q# . - +/*-.- /# - !*- )*)S.+ $!$
)$) + ) )/*!+-$*- 3+*.0- /*+/#*" ).hNiQ1 -4$(+*-/)/! /0- $./# $-
)*)S- /$1$/4 /* . '!S)/$" ). /* 1*$ 0/*$((0) - /$*).Q ) $/$*)N /# 4
+-*1$ 2$ -)" *! !0)/$*). . $)/- ''0'- .$")'$)"N *+.*)$5/$*)N
# (*/3$. ) )*4/*.$.hNiQ * !-N /#- '.. . *! . - &)*2)P *''S'$& - +/*-. _.`N - /$)*$ $S$)0$' " ) _
S
`S'$& - +/*-. _.` )
)0' */$ S$)$)" *'$"*( -$5/$*) *($) _`S'$& - +/*-. _.`iQ # /$1/$*) *! /# . - +/*-.N /#-*0"# $)/ -/$*) 2$/# )*)S. '! (*' 0' .N /-$"" -
$)/- ''0'-.$")'/-).0/$*)+/#24./#/' /*/# +-*0/$*)*!$)/ -! -*)
_
`N /0(*- ) -*.$. !/*- _` ) $)/ -' 0&$)Sg _
Sg` 4/*&$) .iNjQ )/'4N
)*/# -(*' 0' N)( _./$(0'/*-*!$)/ -! -*)" ) `N#. )$ )/$!$ /*+'4 )/-'-*' $) / /$*)*!4/*.*'$.)4'$$)0' */$ .kNlQ
/.
/$1/$*) ' . '$& 2$. /* /# $)0/$*) *! /4+ $)/ -! -*). ) *S- "0'/ " ) . $) /# $))/ $((0) - .+*). "$)./ +/#*" ).kNlQ ) - )*-('
*)$/$*).N/# $))/ $((0)$/4)" /-$*!/# (%*-$/4*!($-* .$)1$)"*0-
*4Q / /# .( /$( $/ $. 1 -4 $(+*-/)/ $) /$1/$)" ) - -0$/$)" /# (*./
!! /$1 +/$1 $((0) *(+*) )/. /* ' - /# $)1$)" +/#*" )hNiQ )
$/$*)N .$ . ''.N ( #)$' ) # ($' --$ -. '.* +-*1$ +*/ )/
+-$(-4+-*/ /$*)"$)./$)1$)"+/#*" )._$"0- g`Q
@:@:A:@ % #%$ #)) )*
# !$-./ '$) *! ! ). *! /# $))/ $((0) .4./ ( *).$./. *! ( #)$' )
# ($' --$ -. . /# .&$) *- (0*0. ( (-) . $) /# "./-*$)/ ./$)'N
" )$/*0-$)-4*-- .+$-/*-4/-/iQ# -4)$$.0-! *!/# .&$)N/# . 0(
!-*( #$- !*''$' . /#/ '*2 -. /# +N ) /# '4.*54( . !-*( .2 / - '- 4
!! /$1 +-*/ /$*)."$)./($-*$'"-*2/#iQ# (0'/$+' '4 -.*!/# .&$))
/# *)/$)0''*..*!/# *0/ - '4 -.$/$*)''4- (*1 +*/ )/$'+/#*" ).iQ
o
0-/# -(*- N/$"#/%0)/$*). /2 )/# +$/# '$' ''.)/# 1$.*0.)/0- *!
/# (00._r1$.*0."'4*+-*/ $)/#//-+.($-* .) -$.`- .0!!$$ )//*
'*&/# $)1.$*)*!(*./*!/# +/#*" )./*2#$#2 - 3+*. 4!/ -4iQ
*- *1 -N)/$($-*$'.0./) .*)/# .0-! *!/# +$/# '$0(*-$)/# .(''
$)/ ./$) _+-*0 4) /# ''.`N.0#. ! ).$).)/# '$$$).N#1 )
.#*2) /* $- /'4 /*3$ /* +-/$0'- .+ /-0( *! / -$N !0)"$ ) .*( )1 '*+ 1$-0. .$)1$/-*iNmNnQ# . )/0-')/$$*/$.- .(''N/$*)$+-*/ $).
/#/- ' /*$.-0+/) "/$1 '4#-" *(+*) )/.*!($-*$'( (-) .mNnQ
0-$*0.'4N.*( / -$*)/# .&$)0/'.**0-)*-('"0/!'*-]($-*$*/# '+
/* ! )/# *40 /*$$!4$)"*4.0-! .N+-*0/$*)*!/ -$*$).)
*/# -/*3$).Q# 4(4'.**0/S*(+ / */# -+/#*" ).!*-)0/-$ )/.iQ
)$/$*)N
/# $$ )1$-*)( )/$)/# ./*(#&$''.(*./($-* .iQ
@:@:A:A ##,#))) )
! +/#*" ) $. ) 1 -/# ' .. ' /* -*.. /# . !$-./ ! ). --$ -.N /# ''0'-
*(+*) )/ *! /# $))/ $((0) .4./ ( $. ' -/ Q / *).$./. *! +#"*4/ .N
/0-' $'' - _` ''. ) +'.( +-*/ $). .0# . /# *(+' ( )/ .4./ (iQ
#"*4/ .- ''./#/- ' /*)*)S.+ $!$''4- *")$5 +/#*" )._2$/#/# # '+ *! .` )"0'! /# ( ) # ($''4 ./-*4 /# (Q # ./-0/$*) #++ ).
1$/# !0.$*)*!/# 10*' *)/$)$)"/# +/#*" ))"-)0' .!$'' 2$/#/*3$
( /*'$/ .N )/$($-*$' + +/$ . )]*- . -$) +-*/ . . /#/ $- /'4 ./-*4
/# ($-* iQ )*/# - ( #)$.( 0. 4 +#"*4/ . $) )/$($-*$' ! ). $.
/# +-*0/$*) *! - /$1 *34" ) .+ $ . _` ) - /$1 )$/-*" ) .+ $ .
_`Q # /2* +/#24. - .+*).$' !*- /# +-*0/$*) *! /# . - /$1 .+ $ .
- ( $/ 4/# *3$. " ) -/$)"/# $)/ -( $/ .0+ -*3$ _hS`N
) /# $)0$' )$/-$ *3$ .4)/#. _$` " ) -/$)" /# $)/ -( $/ )$/-$
*3$ _`Q # . $)/ -( $/ .N $) /0-)N .+*)/) *0.'4 - *($) 2$/# */# -
(*' 0' ./*+-*0 - /$1 !- -$'. ./-*4$)"/# )"0'! +/#*" )Qo# 2#*' +-* .. !-*( /# )"0'!( )/ /* /# ./-0/$*) *! /# ($-* $. '' +#"*4/*.$.)*)'4#++ ).$!/# +#"*4/ $.$))/$1/ .// *-- $1 .
gf /$1/$*).$")'.!-*(*/# -$((0) ''.iQ#"*4/*.$.) )#) /#-*0"#
/# $)$)"*!)/$*$ .*-/# *(+' ( )/+-*/ $)i_. '*2`Q# 4$)*)
/# .0-! *! +/#*" ). . .$")' !*- +#"*4/$ ''.Q #$. +-* .. $. '' *+.*)$5/$*))/# +-*/ $)./# - !*- )( *+.*)$).iQ*( +/#*" ).- ' /* .+ +#"*4/*.$. 4 - .$$)" $).$ $)! / ''.Q # . +/#*" ). ) *)'4
&$'' 4 +*+/*.$. *! /# $)! / ''. $)$/$/ 4 )/0-' &$'' - _` ''. *-
*(+*) )/. *! /# +/$1 '$& 4/*/*3$ '4(+#*4/ . _.N . . /$*)
gQgQiQhQh`iQ
''. - ''. /#/ - *")$5 ./- .. ''. ) - ' /* $- /'4 '4. /# ( _4/*'4.$.`Q /- .. ''. - $/# - $)! / ''.N ''. 2$/# (" *-
--)/ ''..0#./0(*- ''.iQ#0./# 4 '$($)/ (" *-('$"))/ ''.
) ''. /#/ - - . -1*$-. *! $)! /$*)Q ''. '.* +-*0 N (*)" */# -
4/*&$) .N
ScN4/*&$) /#/)/$1/ (-*+#" .) ''.*!/# +/$1 $((0) .4./ (iQ
-*+#" . ) /$..0 - .$ )/ ''. _'$& $) '0)"N .&$) /Q` *- -$1 !-*( (*)*4/ . /#/ $!! - )/$/ / /# .$/ *! $)!'((/$*)Q # 4 - #$"#'4
+#"*4/$ ) - '.* ' /* . - / 4/*&$) . /#/ *)/-*' /# $((0) - .+*). iQ*( *!/# . 4/*&$) ../$(0'/ $)!'((/$*)4$)- .$)"/# '**
!'*2)/# ' &$) ..*!/# 1 .. '..2 ''.+$''-4$'/$*)iQ
)$/$*)N/# 4
/ *) */# - $((0) ''. /* $!! - )/$/ ) /$1/ /# (iQ *" /# - 2$/#
)-$/$ ''. _.`N (-*+#" . +-*1$ ) $(+*-/)/ '$)& /* /# +/$1 $((0) - .+*). N . */# - )/$" )S+- . )/$)" ''. _.`iQ *2 1 -N . - /# (%*- '' /4+ /#/ +/0- ) +- . )/ )/$" ). /* ''. _. . /$*)
gQgQiQhQg`iQ
)*/# - /4+ *! +#"*4/ $. '' ) 0/-*+#$': # 4 - $-0'/$)" ''.
- .+*).$' !*- -'4+#"*4/*.$.Q# 4 3$//# '**./- (-+$'4/*/# .$/ *!
$)! /$*) *- (" /* +#"*4/ /# $)1$)" +/#*" ).Q # 4 '.* +'4 -*' $)
$)$/$/$)"/# $)!'((/$*)/#-*0"#/# +-*0/$*)*!+-*S$)!'((/*-44/*&$) .iQ
# *(+' ( )/.4./ (*).$./.*!*1 -if+-*/ $).+-*0 4/# '$1 -Q
# 4 )*-(''4 $-0'/ $) /# '** $) ) $)/$1 .// ) $! /# 4 )*0)/ - +/#*" ) /# *(+' ( )/ . . /. $)/* (*/$*) ) 3 -/ /# $- !! /*-
gg
!0)/$*).iQ#- +/#24.*!*(+' ( )//$1/$*) 3$./P/# '..$'N'/ -)/$1 ) ()))S$)$)" _S` ' /$) +/#24iQ # '..$' +/#24 $. /-$"" - 4
/# $- / $)$)" *! /# *(+' ( )/ *(+*) )/ g, *- 4 /# $)$)" *!
)/$*$ . /* /# .0-! *! /# +/#*" )Q # . -0( *)./$/0 )/ S' /$) $).
.*( )+.0'/ / -$)/# '/ -)/$1 +/#24./-/.2$/#/# $)$)"*!
/# *(+' ( )/*(+*) )/iQ#*!/# . +/#24./-$"" -.. /#/$)
/# ) ' . /* /# '4.$. *! /# X$)1 -YQ ) $/$*)N /# *(+' ( )/ .4./ (
- -0$/. $)!'((/*-4 ''.Q k !*- 3(+' /. . # (*//-/)/ !*-
+#"*4/ . ' $)" /# ( /* /# .$/ *! $)!'((/$*)iQ # $- /#$- ! /0- /#/ 2.
'- 4 ( )/$*) *1 $. /# )#) ( )/ *! +#"*4/*.$. _*+.*)$5/$*)`iQ
*- *1 -N /# *(+' ( )/ *(+*) )/. i ) k ) $/$*)''4 $)0 $)!'((/$*) 1$ '$"/$*) /* - +/*-. *! (./ ''. ) /-$"" - /# - ' . *!
#$./($) .iQ
@:@:B '+ - $$,%)*'&%*
! /# $))/ $((0) - .+*). !$'. /* ' - /# +/#*" )N /# +/$1 $((0) - .+*). *( . $)/* +'4 _$"0- g`Q /-0/0- . /#/ - ' /* '$$/ ) +/$1 $((0) - .+*). - '' )/$" ). /#/ - +- . )/ /* ''. *! /# +/$1 $((0)$/44 ''.*!/# $))/ $((0) .4./ (N $/# -//# .$/ *!$)! /$*)*-$)
'4(+#*$ *-").iQ # +/$1 $((0) - .+*). $. #$"#'4 .+ $!$ $) *)/-./ /*
/# $))/ $((0) - .+*). Q / ) $./$)"0$.# /2 ) )/$" ). /#/ - 1 -4
.$($'-/* #*/# -0 /*$"$1 -.$/4*!- +/*-.Q#$.$1 -.$/4$.+-*1$ 4
.*(/$_`- *($)/$*)*! ''- +/*-_`*-
((0)*"'*0'$)_
"`" ) . "( )/. /* !*-( 1-$ /4 *! .+ $!$ . *- .iQ 0-/# -(*- N $/ $. ' /*
$./$)"0$.# /2 )X. '!Y)X!*- $")Y_$Q Q+/#*" )`)X'/ - . '!Y_$Q Q/0(*-`
$) 1 -4 #-/ -$./$ ()) -Q # ''. *! /# +/$1 $((0) .4./ ( #1 /*
0) -"* ) "/$1 ) +*.$/$1 . ' /$*) !*- /# 4 - - ' . /* + -!*-( /# $-
!! /*- !0)/$*).Q #$. #-/ -$./$ $. '' $((0) /*' -)
gfQ
)*/# -
$(+*-/)/! /0- $.'*)' 3+).$*))*)/-/$*))$/.'$)& $((0)*'*"$'
gh ( (*-4Q # 1 '*+( )/ *! ( (*-4 ''. $. -0$' !*- '*)"S'./$)" +-*/ /$*)
!/ - /# !$-./ $)! /$*) 2$/# )*/S4 /S&)*2) +/#*" )iQ # *(+*) )/. *!
+/$1 $((0) .4./ ( - 2#$/ '** ''. /#/ *).$./ *! ''. _. . /$*)
gQgQiQg`) ''._. . /$*)gQgQiQhQh`Q + )$)"*)/# ''/4+ $(+'$/ $/
+-*1$ /2*$!! - )/&$).*!$((0) - .+*). .Q# - .+*). *! ''.$.'' #0(*-' $((0)$/4 2# - . /# - .+*). *! ''. $. '' ''0'- $((0)$/4
_$"0- h`iQ / $. /# $))/ $((0) .4./ ( ) /# ./-0/0- *! /# )/$" ) /#/
/ -($) 2#$#)/0- ).' /# $((0) - .+*). 2$''#1 Q
,)A:-)- .&++&),%+ &%*&+'+ - $$,%*0*+$='+)&$*+#:8
##,#)%&#,#)
$$,%&#&0>
gi
@:@:B:@ ,$&)# $$,%)*'&%*
# $((0) *(+*) )/.*!/# #0(*-'$((0) - .+*). - ''./#/. - / )/$*$ .!/ -/# $-/$1/$*))$!! - )/$/$*)$)/*)/$*4. - /$)"+'.(
''._$"0- i`iQ)/$*$ .- $((0)*"'*0'$)._
"N
"N
"N
"` /#/$-0'/ $)/# '**)+ -( / /# */# -*4!'0$./*$)/*$)1$)"+/#*" ).iQ# $)$)" *! )/$*$ . $)/$1/ . 1$-0. . ) ($-*$' /*3$). 4 '*&$)" /# $-
$)$)"/*#*./ ''._) 0/-'$5/$*)`Q# 4'.*$)/*+/#*" )./*(-&/# (!*-
$((0) ''. /* // - + -!*-( +#"*4/*.$. _*+.*)$5/$*)` *- /* /$1/ /# *(+' ( )/.4./ (i_$"0- i`Q
*/$1/ ''.N/# +-/$$+/$*)*!# '+ -_#` ''.N*(+*) )/*!/# ''0'- $((0)$/4 _. . /$*) gQgQiQh`N $. ) iQ # ''. '.* *)/-*' $.*/4+ .2$/#$)"1$.*(/$- *($)/$*)N+-* ..$)2#$#/# *)./)/- "$*)*!/# . - / )/$*$ . #)" . 0/ /# 1-$' - "$*) - ($). /# .( Q . *). ,0 ) N ''../-//*+-*0 )*/# -'..*!)/$*$ .iQ#$.$.) /*
$)/ -/ 2$/# $!! - )/ $((0) ''.] !! /*- (*' 0' . 2$/#*0/ '**.$)" /# !!$)$/4].+ $!$$/4!*-/# )/$" )Q ''.(4'.*. -1 ..!*- ''.iQ
,)B:+ -+ &%%+&),%+ &%*&##*=)&$+.* +%) %*>
gj @:@:B:A ##,#) $$,%)*'&%*
gQgQiQhQg .].^/# & 4$)$/$/*-!*- ''/$1/$*)
. +-*1$ -0$' '$)& /2 ) $))/ ) +/$1 $((0)$/4Q # 4 +- . )/
)/$" ). /* ''. /* /$1/ /# ( ) $)$/$/ ''0'- $((0) - .+*). _$"0- j`iQ ?1 ''. !*-( ) $((0)*'*"$' .4)+. 2$/# . /* " / /$1/ hNiQ # $((0)*'*"$'.4)+. *).$./*!/# )"" ( )/*!/# ''- +/*-_`2$/#
/# )/$" )S'* *(+' 3)$/.*S./$(0'/*-4(*' 0' .hn*) ''.
2$/# $/. '$"). mSg _nf` ) mSh _nl` *) .ggQ )1 -. '4N jq # ''.
- '.*' /*/$1/ .1$/# $)/ -/$*)*!/# *S./$(0'/*-4(*' 0' jf
_*).`)jf_*)/$1/ ''.`Q/$1/ .$)/0-)/$1/ nq
''./*+ -!*-(/# $- !! /*-!0)/$*)_$"0- j`Q.'- 4( )/$*) N.- /# (*./ !! /$1 .Q# 4- #-/ -$5 4/# $-!0)/$*)'!' 3$$'$/4/*- .+*)
/* $)!'((/*-4 #)" . $) /# $- )1$-*)( )/Q #$. +'./$$/4 $) - .+*). /*
3/-$).$ .$")'. ) /# 3$./ ) *! 1-$*0. .0. /. (& /# ( -0$' /*
- "0'/ ) $)$/$/ /# +/$1 $((0) - .+*). iQ # $))/ $((0) .4./ (
2$'' +-*1$ .$")'. _# (*&$) . ) 4/*&$) .` /* //-/ ) ($)/$) +**' *!
. / /# .$/ *! $)!'((/$*) /#/ $)" ./ !*- $") )/$" ).N /-).+*-/ /# ( /* /# -$)$)" '4(+# )* . ) +- . )/ /# ( /# - /* )/$" )S.+ $!$ ''.iQ 0-$)"
/#$. +-* .. . 0) -"* +# )*/4+$' ) !0)/$*)' #)" .Q #$. $)'0 . /# - . *!)/$" )$)/ -)'$5/$*)N 3+- ..$*)*!(%*-#$./**(+/$$'$/4*(+' 3
_` '.. ) (*' 0' . *) /# '' .0-! N $)- . *! *S./$(0'/*-4
(*' 0' 3+- ..$*)N 3+- ..$*) *! # .$*) (*' 0' . ) # (*&$) - +/*-.N
. - /$*) *! # (*&$) .N 4/*&$) . ) +-*/ . . ) (*-+#*'*"$' #)" . _ Q"Q
!*-(/$*)*! )-$/ .`iQ#0.N. 1*'1 !-*()$((/0- N)/$" )S+/0-$)" ''
/*(/0- N)/$" )S+- . )/$)" ''Q#$..*S'' (/0-/$*)$. .. )/$'!*-/# - "0'/$*) ) /4+ *! /# !*''*2$)" $((0) - .+*). iQ #$. *)1 -.$*) 0/ '.*
/# '$) " $ *0/ ''/*' -) *- ''/$1/$*)]$!! - )/$/$*))
!0-/# - /2 )#g)#h( $/ $((0) - .+*). iQ
gk
,)C:*')&- % $'&)+%+# %"+.% %%+%'+ - $$,% +0=)&$-%+#8A??C>:
. ) " / /$1/ 2$/# /# # '+ *! jq ''. _0++ - '$) ` ) _)*/ (0/0''4 3'0.$1 ) $) !/ /
$!! - )//$( ))/*($'.$/ .`*-/#-*0"#/# $)$)"*!+/#*" ).*)._'*2 -'$) `Q(/0- /# )
/$1/ .nq ''./#/$)/0-)" //$1/ N+-*'$! -/ )"$)./# $- !! /*-!0)/$*).Q
gQgQiQhQh ''.
''.- & 4*(+*) )/.*!/# +/$1 $((0)$/4Q# /2*($) '''$) " .
- ab ''.)cd ''.iQ*" /# -2$/# ''._. . /$*)gQgQiQg`/# 4- /# *)'4 $((0) ''. /#/ 0) -"* _` - *($)/$*)N ) $(+*-/)/ ( #)$.( /*
+-*1$ )/$" )S- +/*- $1 -.$!$/$*)iQ *2 1 -N cd ''. 3+- .. /#/
*).$./.*!cS)dS.00)$/.$)*)/-.//*ab ''./#/0$'/# $-.2$/#aS
) bS .00)$/.ghNgiQ cd . * )*/ #1 .* ()4 $1 -.$/$ . . ab .Q
1 -/# ' ..N cd ''. +-*1$ 0)$,0 )/$" ) .+ $!$$/$ . ) . ( /* +- S
/$1/ N! /0- /#/''*2.1 -4-+$- .+*). .ghNgiQ# 4($)'4- .$ $)/# .&$) ) +$/# '$' /$..0 _$) '0)"N $)/ ./$) /Q` ) *)/-$0/ /* /# $((0) - .+*). "$)./$)! /$*)N ''0'-/-).!*-(/$*)_) -`)/$..0 ("
gl ghNgiQ
)'**)'4(+#*$*-")./# 4*)'4(& 0+.(''+ - )/" *!/*/' ''.Q
# ($) '''$) " *).$./.*!ab ''.iQ
)*)/-.//*cd ''./# 4- *")$5 +-* .. )/$" ). +- . )/ 4 (%*- #$./**(+/$$'$/4 *(+' 3 . _`
(*' 0' . 3+- .. *) .].Q ab ''. $)'0 jq ) nq ''.
#-/ -$5 /#-*0"#/# $-.0-! *S- +/*-j*-nN- .+ /$1 '4Q
jq ''. $)/ -/ 2$/# '.. (*' 0' . +- . )/$)" )/$" ) *)
.Q -*( )?1 jq ''. . 1 -'N !0)/$*)''4 $./$)/N '' .0/4+ . )
1 '*+P# '+ -_#`g ''.N#h ''.N#gm ''.N!*''$0'-# '+ - ''._!#`N-g
''. ) $)0 ]+ -$+# -' - "0'/*-4 ''. _$- " *- +- "gj` ''.gkQ /0-'
- "_)- "*-/- "gj` ''.'.* '*)"/*/# jq ''.0/*)*/$!! - )/$/ !-*( + -$+# -' )?1 ''. 0/ 1 '*+ $) + ) )/'4 $) /# /#4(0.glQ jq ''.#1 1-$*0.!0)/$*).)/# $-.0/4+ .$!! -$)/# $- 3+- ..$*)*!.0-! (*' 0' .N /# $- (*' 0'- .$")/0- _/-).-$+/$*) !/*-.` ) .0. ,0 )/
4/*&$) +-*0/$*)gk_$"0- k`Q# (%*-/.&*!#g ''.$./*# '+/* '$($)/ $)/- ''0'-+/#*" ).Q#gS -$1 Sc$.-0$'/*/$1/ +#"*4/ .N.0#.
(-*+#" . 0/ '.* ($-*"'$' ''. )#)$)" /# +#"*4/$ /$1$/4Q #g '.*
. - / Sh /#/ +-*(*/ . /# .0-1$1' ) /$1/$*) *! )- ". 0/ '.* /# +-*'$! -/$*)*!nq)/# $-$!! - )/$/$*)/*.Qgm# $((0) - .+*). Q
( $/ 4#h ''.$.(*- $/ /* 3/- ''0'-+-.$/ .Q*- *1 -N/# 4
+'4 -*' $) '' -"$ $. . . ) ./#(Q # 4 +-*0 . 1 -' 4/*&$) . 2$/#
$!! - )/ !! /*- !0)/$*). .0# . SjN SkN SoN SgiN SgfN Sgk )
(+#$- "0'$)Q SjN !*- 3(+' N /-$"" - '' -"$ $)!'((/$*) ) )#) . /# +-*0/$*)*!
Sl)SN/2*+-*$)!'((/*-44/*&$) .Q
)*)/-./N
SgfN
(*)" */# - ! /0- .N $)#$$/. #g $((0) - .+*). ) /# - !*- +-*(*/ .
#*( *./.$.Qgm
((0)$/4+-*(*/ 4#gm ''./."$)./ 3/- ''0'-/ -$
) !0)"$Q ) *! /# $- .$")/0- 4/*&$) $. Sgm /#/ /-$"" -. /# . - /$*) *!
+-*$)!'((/*-4 4/*&$) .N .0# . SlN Sg ) aN ) # (*&$) . /#/
- -0$/*/# -$((0) ''./*/# .$/ *!$)!'((/$*)Qgm!# ''.- -0$'$)/# $)0/$*))*)/-*'*!
"'...2$/#$)").*(/$#4+ -(0//$*)*! ''.$)
" -($)' )/ -.)# '+ ''./*(& )/$*$ .$)- .+*). /*)/$" ).gkQ# ($)#-/ -$./$*!- ")-g ''.$./# .0++- ..$*)*!/# $((0) - .+*). gm
/*1*$ 3/ ).$1 /$..0 (" )/# ($)/ )) *!$((0)*'*"$/*' -) /*
*)/-*' 0/*$((0)$/4gkNgmQ # 4 ($)'4 / 1$ /# 4/*&$) . Sgf ) Sb /#/
- */# $(+*-/)/ $((0) S$)#$$/*-4 (*' 0' .Qgm # *1 ( )/$*) #-/ -$./$.' !//# (-&X# '+ -)- "0'/*-4 ''.Y*)jq ''.0/.*( jq ''.#1 ).#*2)/*#1 $- /4/*/*3$!0)/$*)..$($'-/*/#*. *!
.gnQ#0.Njq ''.. (/***-$)/ /# $((0) - .+*). "$)./'*/*!
$!! - )/+/#*" ).)- "0'/ $/.0-/$*))$)/ ).$/4Q0-/# -(*- N/# 4+'4
-*' $)/# !*-(/$*)*!( (*-4 ''.gkQ
/$. 1$ )//#//# '&*-4.!0)/$*)
*!jq ''.' ./*1-$ /4*!$)! /$*0.$. . .*-0/*$((0) $.*- -.Q
nq ''.$!! - )/$/ ($)'4$)/*4/*/*3$ ''._.`!/ -/$1/$*)
)- /# (*./ !! /$1 &$'' -.*!/# ''0'-$((0) - .+*).
goQ.-
*")$5 )/$" ). +- . )/ *) '.. (*' 0' . /#/ ) 3+- .. 4 '(*./ ''
)0' / ''.*!/# *4N$)+-/$0'-0-$)"$)!'((/$*)goQ# &$''$)"4.
) $- /'4/#-*0"#/# )"" ( )/*! /#- +/*-._.O
OSg`*)
/-" / ''.4/# $-- .+ /$1 '$").*)/$1/ .N*-/#-*0"#/# - ' . *!
4/*/*3$"-)0' .*)/$)$)""-)54( .)+ -!*-$)Q#$.' ./*/# +*+/*.$.*!
/# $)! / *-(" #*./ ''goQ.)'.*/$)$- /'44/# +-*0/$*)*!
4/*&$) .N .0# . Sγ ) Sa /#/ /$1/ +#"*4/ . ) .$")' /# ( /*
./-*4/# +/#*" )/# 4 )"0'! Q_$"0- l`
gn ,) D: )%+ CI ##* *,*+* ='+ )&$ . % + #:8 A?@A> jq '' .0. /. - #-/ -$5 4/# $-/-).-$+/$*)!/*-.)4/*&$) +-*0/$*)Q
,)E:+&),%+ &%&*:=)&$,$%%+#:8A??A>
go
gQgQiQhQi 4) -"4 /2 )jq)nq ''.
jq ) nq '' $)/ -/$*). - 1 -4 $(+*-/)/ !*- /# - "0'/$*) *! /# $((0) - .+*). Q # $- **+ -/$*) . (. /* .. )/$'N .+ $''4 $) /# - .+*). .$)2#$#nq ''.+'4/# (%*--*' !*-+-*/ /$*))) /* #$"#'4- "0'/ Q#$.$)'0 .1$-'$)! /$*).N)/$S/0(*-$((0)$/4.2 ''./# +- 1 )/$*) *! 0/*$((0)$/4Q ) N jq ''. +'4 0' -*' !*- nq ''
$((0) - .+*). Q ) /# *) #) # ''. # '+ nq ''. /* " / /$1/ /*
+ -!*-(/# $- !! /*-!0)/$*).N)*)/# */# -#)N- " ''.- ' /**2)S
- "0'/ nq ''/$1$/4/*1*$ 3/ ).$1 /$..0 (" Q
*- '' ( (*-4N $/ #. ) .#*2) /#/ nq ''. .#*2 +**-
+-*'$! -/$1 $'$/4)$(+$- '*)"S/ -(.0-1$1'!*''*2$)". *)-4#'' )" $!/# 4$!! - )/$/ $)/# . ) *!jq ''.0-$)"/# +-$(-4$)! /$*)hfNhgQ
#$.$.0 /*/# # '+*!jq ''./*/$1/ .)+-*(*/ /# $-(/0-/$*)Q
)/ -/$*)*!jq ''.2$/#./#-*0"#/# (*' 0' .jf)jf'$")
_jf` $)- . . )/$" )S+- . )//$*) ) /# 3+- ..$*) *! *S./$(0'/*-4
(*' 0' . *) .hhQ # !*''*2$)" $)/ -/$*) *! . ) nq ''. $)0 ./-*)" !! /*-nq ''.- .+*). Q#$.+-* ..#. ).#*2)/*$(+-*1 /# .0-1$1'*!nq ''.Q#0.Njq ''.- - .+*).$' !*-/# ($)/ )) *!
+**'/#/.0. ,0 )/'4"$1 .(*- /$( /* 3 -//# $- !! /*-!0)/$*).hiQ
*2 1 -Njq)nq ''.) /*- *")$5 )/$" )+- . )/ 4/# .( /*$)$/$/ $((0)$/4hgNhjQ0-/# -(*- N/# # '+*!jq ''.)!$'$// /# $)/ -/$*) /2 )nq ''.).Qnq ''.) /*($"-/ $)/*/# 2# - /# )/$" )S.+ $!$ Sjq ''. $)/ -/$*) /& . +' Q # (/0-/$*) *! . 4 jq ''. ) # '+ )$1 nq ''. /* )/ - /# /#-*0"#/# 3+).$*)*!/# $/. '!*-/# )'-" ( )/*!/# -/ -$*' ! $)"
/# hgNhkQ $/#$) /# N )/$" )S.+ $!$ Sjq ''. $)/ -/$*) - .0'/. $)
/# - ' . *! # (*&$) . 4 /$1/ . ) jq ''. +-*(*/$)" /# +- ! - )/$'- -0$/( )/*!nq ''./*# '']'0./ -.hl. *- *1 -Njq
''# '+$.-0$'/*1*$/# $)0/$*)*!/*' -) Q
hf 1 -/# ' ..N jq ''. * '.* #1 )*/# - .$ Q jq - " ''. - ' /*(+ )/# $((0) - .+*). /*1*$/$..0 (" *-0/*$((0)$/4Q
#0.N- " ''.- -0$'!*-/# $)0/$*)*!. '!S/*' -) Q ) N +' /$*) *!
- " ''.$)-* )/.*-(0//$*)$)/# $-.$")/0- /-).-$+/$*)!/*-*3+i' /* /# 1 '*+( )/ *! 0/*$((0) $. . $) ( ) ) ($ Q ) *)/-./N $/ 2.
.#*2)/#/ +' /$*)*!- " ''.$)/0(*-. //$)" )#) /# - .+*). ( $/ 4nq ''.)+-*(*/ /0(*-' -)
hmQ
# - 3$.//#0.!$) ') /2 )+*.$/$1 )) "/$1 *). ,0 ) *! - " '' /$1$/4Q ) /0(*-.N $/ 2. (*)./-/ /#/ - "S -$1 Sb )
$)#$$/ "-)0'/$*)N /#0. /. $- /'4 *) /# 4/*/*3$ /$1$/4 *! .hnQ
0-/# -(*- N $/ 2. (*)./-/ /#/ - " ''. $)#$$/ Sh +-*0/$*) )
/$1/$*)*! ''.$)*)//S + ) )/()) -hoQ*2 1 -N- " ''.)'.*
$)$- /'4/*)nq ''._)jq ''.`4!*-($)"""- "/ .-*0).
)/# - !*- *0/S*(+ / !! /*- ''.N..#*2)$))..4Q- " ''.
!0-/# - $)$/$/ /# *2)S- "0'/$*) *! nf]nl *) .N $)#$$/$)" /# $-
(/0-/$*)Qif
gQgQiQhQj ((0) # &+*$)/.
# $((0) .4./ ($)/# #0()*4$.) '*-/ *-")$5/$*)/#/+-*1$ .
+-*/ /$*) !-*( $)1$)" +/#*" ).Q # +/$1 $((0) ''. $)1*'1 !*''*2 ./-$/ . ' /$*) /* $!! - )/$/ /2 ) !*- $") ) . '!S )/$" ).Q $-./N $((0) ''. /# (. '1 . - ' /* - "0'/ /$1/$*) *- $)#$$/$*) *! ''.Q ) ''
.0. //#/.0++- .. . ''/$1$/4$.- " ''._. . /$*)gQgQiQhQh`0/'.*
S
gf +-*0$)" ''. ) $)#$$/ $((0) - .+*). .iQ )#$$/*-4 .$")'. +-*1$ . *)+-*/ /$1 --$ -/#//# $((0) ''.#1 /**1 -*( !*- /# 4)
+ -!*-( !! /*-!0)/$*).Q# . $)#$$/*-4.$")'.- $(+'$/ $)/# - "0'/$*)
*! /# $((0) - .+*). /* +-*/ / /# *4 !-*( 3 ..$1 $)!'((/*-4
("
igNihQ
) $/$*)N $((0) # &+*$)/. . ( /* #1 -0$' -*' $) /# ') /2 ) $)!'((/$*) ) 0/*$((0)$/4igNiiQ # - 3$./N /#0.N !$) ,0$'$-$0( /2 ) /$1/$*) ) $)#$$/$*) /#/ ) .$'4 $./0- *-
hg
($.0. Q 0(*- ''.N !*- 3(+' N /& 1)/" *! /#$. $)#$$/*-4 .4./ ( /*
.+ /# $((0) - .+*).
ggNiiNijQ2*$(+*-/)/+-*/
$)./#/+-*1$ $)#$$/*-4
.$")'. /* ''. - 4/*/*3$ '4(+#*4/ ..*$/ +-*/ $) j _Sj` )
+-*"-(( '' /#+-*/ $)g_Sg`N0/*/# -(*' 0' .N$)'0$)"iN
iN
N- '.*$)1*'1 $)/-).($//$)"$)#$$/*-4.$")'.Q# ''.0-! - +/*-
Sj$./-).$ )/'4 3+- .. *)*)1 )/$*)' ''!*''*2$)"/# $-/$1/$*))
*)./$/0/$1 '4 3+- .. *) - " ''.Q / $. *(+ /$/*- *! /# #*(*'*"*0. *S
./$(0'/*-4(*' 0' hn)#.-0$'-*' $)'$($/$)" ''- .+*). .QmSg
_nf`)mSh_nl`N 3+- .. *).N- '$").!*-*/#hn)Sj
0/#1 $!! - )/-*' .$)/# - "0'/$*)*! ''.Qgg)"" ( )/*!hn' ./*
'' /$1/$*) 2# - . Sj ) "/$1 '4 - "0'/ . '' - .+*). . 4 $)- .$)"
/# /#- .#*'*! ''+-$($)"Q# - 3$./N#*2 1 -N. 1 -'#4+*/# . .*0//# $)#$$/*-4 ( #)$.( *! SjQ Sj #. #$"# - !!$)$/4 /* nf]nl /#)
hn /#/ ' /* /# (*./ !- ,0 )/'4 .0"" ./ *) +/ /#/ Sj (4 *0/S
*(+ / hn 2# ) 3+- .. *) /# .( ''ik _$"0- n`Q ) *)/-./N /# .$")'$)"(* '+-*+*. ./#/Sj.$")'$)"+/#24*($)/ .*1 -/# hn
.$")'/# - !*- $)#$$/$)".$")'$)"ikQ
)*/# - ./04 .0"" ./. *) +/ $) 2#$# Sj /. . X+#4.$' '$")
+/0-$)" 1$ Y 1$ /-).S )*4/*.$. *! nf]nl /# - 4 +' /$)" /# /2*
'$")..#- 2$/#hnilQ0-/# -(*- N$/#. ) (*)./-/ /#/Sj$.
.. )/$' !*- - " '' !0)/$*)Q /$1/$*) *! - ". 1$ /# ./$(0'/$*) *! Sj
(4/# )' /*/# .0++- ..$*)*! !! /*- ''.ikQ_$"0- m`
)*)/-./NSg
) ShN /# '$"). *! SgN - )*/ *)'4 3+- .. *) . 0/ '.* *) */# -
$((0) ''. . 2 '' . *) ''. *! + -$+# -' /$..0 . ) ) *+'./$ ''.N $)
+-/$0'- !*''*2$)" Sc ./$(0'/$*)Q Sg '*)". /* /# m " ) !($'4 )
.0++- .. . ''- +/*-S( $/ +-*'$! -/$*))4/*&$) 3+- ..$*)QijSg$.
/#0. .. )/$'!*-/# - "0'/$*)*!'- 4/$1/ ''._$"0- n`Q*- *1 -N$/
#. ) '.* (*)./-/ /#/ Sg $. 3+- .. *) $- "]+- " ''. ) /#/
/# $)/ -/$*) 2$/# Sg +'4 -*' $) /# $- 1 '*+( )/N ($)/ )) )
!0)/$*)imQ
#0.N */# Sj ) Sg - .. )/$' !*- + -$+# -' /*' -) .
hh 3 (+'$!$ 4 /# +# )*/4+ *! /# - .+ /$1 &)*&S*0/ ($ Q Sj !$$ )/
($ $ !/ -iSj2 &.!-*(!/''4(+#*+-*'$! -/$1 $. . #-/ -$5 4
$)!$'/-/$*) *! ''. $) (0'/$+' *-").inNioQ !$$ )4 *! Sg $) ($ '$& 2$. +-*(*/ .0/*$((0)$/40/$)*)/-.//*Sj !$$ )/($ N/# 0/*$((0) - .+*). $. '4 )*-")S.+ $!$_ + )$)"*)/# " ) /$&"-*0)*!/# ($ `2$/#$)*(+' / + ) /-) *! ''.jfQ# 4- !0''4- "0'/ /# 3+).$*)
) !0)/$*) *! ''. ) /# - !*- ($)/$) /# '$/ ') /2 ) /# ) ..-4 $)!'((/$*) /* " / -$ *! +/#*" ). ) /-).!*-( ''. ) /# +- 1 )/$*) *! 3/ ).$1 $)!'((/*-4 (" /* /# #*./ ) ) 1 )/0'
0/*$((0) //&QggNig^ij 1 -/# ' ..N /# . X$((0)*'*"$' - &.Y #1 '.*
/# $- *2).$ Q *+'./$ ''. 0. /# . ( #)$.(. /* (+ ) /# $((0) - .+*). $) *- - /* .+ Q # - !*- N )/$*$ . "$)./ Sj ) Sg _)/$S
Sj ) )/$Sg` #1 ) 1 '*+ ) +-*1$ +*2 -!0' /- /( )/. !*-
.*( +/$ )/. 2$/# 1) ( ')*( *- */# - -$)*(.Qjg^ji # . $((0)*/# -+$ . +-*(*/ )/$S/0(*- $((0)$/4 4 '*&$)" /# )"" ( )/ *!
Sj ) Sg 2$/# /# $- '$"). ) /# - !*- )#) /# (")$/0 )
$1 -.$/4*!/0(*-)/$" )S.+ $!$ !! /*- ''.N)*/'4//# /0(*-.$/ Q
)($ N
$/#. ).#*2)/#//- /( )/2$/#)/$SSj$)- . ./# !!]- " ''-/$*
2$/#$)/# /0(*-($-* )1$-*)( )/0 /*/# +' /$*)*!- " ''.!-*(/0(*-
1$ cS 3+- ..$)" '*' (-*+#" .jjQ # . *. -1/$*). .0"" ./ /#/ )/$S
Sj /- /( )/ /. 1$ $)/-/0(*-' ( #)$.(Q ) *)/-./N ./04 $)
( ')*( +/$ )/. $)$/ . /#/ )/$SSj /# -+4 $)- . . nq ''
+-$($)"' $)"/*-* )$)"*!( ')*(S.+ $!$nq ''- .+*).
jkQ#0.N
)/$SSj(4//$!! - )/.$/ .)/#-*0"#(0'/$+' ( #)$.(.Q
*2 1 -N $) .*( +/$ )/. /#$. '*&" N .+ $''4 $) *($) /# -+4
_2$/# */# - # &+*$)/ $)#$$/*-.N # (*/# -+4N /-" / /# -+$ . *-
$((0)*/# -+$ .` ) ' /* $((0) S- '/ 1 -. 1 )/. _$-.`N $)'0$)"
.&$)N "./-*$)/ ./$)'N # +/$N )*-$) N ) 0-*'*"$N # (/*'*"$N *+#/#'(*'*"$N
) -# 0(/*'*"$ $)!'((/$*) *- 0/*$((0)$/4Qjl^jo )/'4N /2* +/$ )/.
1 '*+ 0/*$((0) ) +#'$/$.!/ -/# /- /( )/2$/#*($)/$*)*!)/$S
Sj))/$SgkfQ
hi
,)F:)')&'&*$&#*&;C,+ &%*=)&$%*&$8A???>:=>*(+ /$/$*)(* 'PSj
*0/S*(+ / .2$/#hn!*-/# $-'$").nf]nl2# )+- . )/*)/# .( ''0 /*#$.#$"# -!!$)$/4/*
/# $-'$").Q=>$")'$)"(* 'P/# .$")'*!Sj*($)/ ./# .$")'*!hn)$)#$$/..$")'$)"
=> Sj*)- " ''./$1/ ./# (0+*)$)/ -/$*)2$/#nf]nlQ
)/0-)- " ''.$)#$$/ !! /*-
''.Q
,)G:,%+ &%& $$,%"'& %+ % +&)$&#,#*=>;C%=>;@=)&$)&##8
A?@A>:Sj/.*)//# +-$($)"+#. *! ''.$)*)/-.//*Sg/#//.*)/$..0 S$)!$'/-/$)" ''.Q
hj @:A )%&'#*+ *0%)&$*
@:A:@ *+&)0
# / -( +-) *+'./$ .4)-*( .N '.* +-) *+'.$ _!-*( /# "- &N +- ^
.$ ]) 3/ /*N ) * ^ ) 2N +'.. $) ^ /* !*-(] 1 '*+` .-$ . $.*- -. /#/
- .0'/ !-*( /# +- . ) *! ) - 0/ - )*/ 0 /# +#4.$' +- . ) *! /# ('$"))4*-$/.( /./. .$)/# *-")!! / Q# - )#+#4.$$)0#:2.
/# !$-./ /#/ .-$ ) - +/$ )/ 2$/# ()$! .//$*). *! /# + -$+# -'
) -1*0. .4./ ( $) gnofkgQ ) gojo 0$#- ) $")*) 0. X+-) *+'./$Y /*
$./$)"0$.# /2 )( /.//$) 0-*+/#$ .!-*() 0-*+/#$ .)*/..*$/ 2$/#
( /./. . khQ 2* 4 -. '/ - -$) ) *'' "0 . (+#.$5 /#/ /# - 2. #$"# *-- '/$*) *! -$)*( 2$/# .0S0/ *-/$' - ''- " ) -/$*)kiQ /
2. (0# '/ - /#/ /# / -( 2. 0. /* #-/ -$5 $. . . ..*$/ 2$/# ) *+'.( 0/ 2$/#*0/ ' - 0. *! .4(+/*(.N .0# . $- / $)1.$*) *! /# /0(*0-khQ *4 /# - - 1$ ) . /#/ (*./ +-) *+'./$ .4)-*( . - 0/*$((0) $. . . -$1 ) 4 ) !!$$ )/ )/$S/0(*-' $((0) - .+*). _$.0.. $). /$*)gQiQj`Q
@:A:A ' $ &#&0
.- -- N!! /$)"*0/fQfg+ - )/*!) -+/$ )/.2$/#.*( 3 +/$*).
. /# ( -/S/*) (4./# )$ .4)-*( _ip *! +/$ )/. 2$/# .('' '' '0)"
) -`N (4./# )$ "-1$. _gkp $) /#4(*( +/$ )/.` ) (4 '$)/$)"
+ -$+# -' ) 0-*+/#4khNkjQ *2 1 -N /# 3/ $)$ ) $. $!!$0'/ /* 1'0/ N .
/# $")*.$. $. )*/ .4 /* (& N .+ $''4 $! /# /0(*- ))*/ / / *- $!
+/$ )/..#*2/4+$'.4(+/*(.Q
hk
@:A:B # % #+,)*
-) *+'./$()$! .//$*).(4)*/'24. $((0) S( $/ )/# '$)$'
()$! .//$*).)/# $)/-$).$( #)$.(1-4!-*(.4)-*( /*.4)-*( Q# 4
)!! /()4/$..0 .*-*-").)' /# - !*- /*$!! - )/.4(+/*(.Q
).*( . .N.0#./# 0.#$)"W..4)-*( )-*0.. 0W..4)-*( N/0(*-.+-*0 .0./) ./#//*)/# #*-(*)'.4./ (*-$)/ -/2$/#$-0'/$)"+-*/ $).kjQ
) *)/-./N $) +-) *+'./$ ) 0-*'*"$' $.*- -. _.`N /# !*0. *! /#$.
()0.-$+/N +/#*'*"$' ! /0- . *0- 0 /* /# ./-0/$*) *! ''. *! /# ) -1*0..4./ (Q#$.$.0 /*)$((0) - .+*). /-$"" - 4)/$" )./#/- /*+$''4 3+- .. 4 /0(*- ''. 0/ +#4.$*'*"$''4 3+- .. 4 ''. *! /# ) -1*0. .4./ (Q # . )/$" ). - /# - !*- '' *)*) 0-*)' )/$" ).Q
*24.N()4*!/# . )/$" ).- &)*2))/# $-" ) .#1 )'*) )
. ,0 ) _' g`kjQ + )$)" *) /# ..*$/ /0(*- ) /-" / )/$" )N
(0'/$+' ' 1 '.*!/# ) -1*0..4./ (_ Q"Q ) +#'*(4 '*-$0'$/$.`N.$)"' ''
/4+ _ Q"Q 0-&$)% ) 0-*). *! /# - ''0(`N *- .$)"' - _ Q"Q '$($
) +#'$/$.`) $)1*'1 _' g`Q
.+$/ /# 1-$ /4*!.4(+/*(.N..#- *((*)#-/ -$./$.Q$-./N
$) (*./ +/$ )/.N ) 0-*'*"$' ()$! .//$*). *0- !*- /# $")*.$. *!
) -N .0"" ./$)" ) !!$$ )/ )/$S/0(*-' $((0)$/4 /#/ ' . /* *''/ -'
0/*$((0)$/4Q *)N#$"#/$/ -.*!)/$*$ ."$)./*)*) 0-')/$" ).) / / $) . -0( ) *! (*./ +/$ )/.Q #$. +-*1$ . ) $(+*-/)/
$")*./$$*(-& -./# . #$"#/$/ -.))*/ / / $)+/$ )/.#-*-$)"
/# .( ) *+'.( 0/ * )*/ 1 '*+ kkNklQ # - $. '$)& /2 ) /# )/$*$ .N /# '$)$' .4(+/*(. ) /# 0) -'4$)" /0(*- _$"0- oO ' g`Q
)*2$)" /# )/$*4 ) /# .4(+/*(.N $/ $. +*..$' /* +- $/ /# 0) -'4$)"
) -2$/#"**0-4Q+/$ )/2$/#)/$S0)/$*$ .). ).*-4'*..2$''
(*./ +-*'4 #-*- .('' '' '0)" ) - ) $")*. 2$/# /# )/$S0
.4)-*(
kmQ
1 -/# ' ..N /# $")*.$. *! $. )*/ '24. ./-$"#/!*-2-Q
/$ )/. (4 #1 /4+$' .4(+/*(. *- /# 0) -'4$)" /0(*- ))*/ / / (&$)"$/$!!$0'//* ./'$.#!$-($")*.$.Q*+-/$''4.*'1 /#$.+-*' (-0.
hl /'Q_hffj` !$) .+ $!$$")*./$-$/ -$_' h`khNknQ
# !$-./ ' - (*)./-/$*) *! ) ..*$/$*) /2 ) 0/*$((0)$/4 )
) -2."$1 )4 2.*(S1$.$)gonkQ (*)./-/ /#/)/$*$ .!-*(
+/$ )/.2$/#/# ( -/S/*)(4./# )$.4)-*( _`).('' '''0)"
) - _` - / 2$/# 1*'/" S"/ '$0( #)) '. _` 3+- .. $)
N.2 ''.2$/#+- .4)+/$) 0-*(0.0'-%0)/$*).koQ
) N/# +- . ) *!0/*)/$*$ .$). -0()) +*.$/.*!)/$*$ .$)/# ./-*)"'4
.0"" ./ /#/ $. $((0) S( $/ kkNklNlfNlgQ # / /$*) *! )/$" )S.+ $!$ ''.$)/# '**N)-$)*!. 1 -'+/$ )/.$/$*)''4./- )"/# )./# 0/*$((0) #4+*/# .$.$)_' i`lh^llQ*2 1 -N$/$../$''0) - / #*2
) /* 2#$# 3/ ) /# #0(*-' *- /# ''0'- $((0)$/4 +-*1$ . /# ($)
!! /*-. $) .*( /4+ . *! Q / (4 + ) *) /# ''0'- '*/$*) *! /# *)*) 0-*)')/$" ))1-4!-*(.4)-*( /*.4)-*( Q
hm
1,'($+%5-*#!&"
$$+
&,!7'
;7><
$-,%,
*(,'*
?@5CB5>AB&
?=B#
>?E#
CA#
,',*'(!
$-,%,
*(,'*
-$!5-*#!&"$$+
','*(,'*+5
&$!'&$$+
*+1&(,!&*.
,*%!&$+
*+1&(,!
&-*'%-+-$*"-&,!'&
-*#!&"$$+5'$,'*1
&-*'&+5 !(('%(-+
*!( *$&*.
*!( *$&*.
*.$$+
-*'%-+-$*
"-&,!'&
-*'&+
-*'&+
7@
&,!*,!&$
&,!7
%( !( 1+!&
&,!7
&,!7%$->
&,!7
&,!7
&,!7
&,!7& &,!7
&,!7
CB&CD#
F=7>=B#
'&',*'(!
$-,%,
*(,'*
'&',*'(!
,1$ '$!&
*(,*'
A>6B#
1%'%
%$$7$$$-&&*
>&9'*?
+--&!,
&21%
%$$7$$$-&&*
1%'%
1%'%5+%$$7$$
$-&&*
$&+,*3%8+
%*'$'-$!&%!
.*!&,*,'%5
,+,!-$*,*,'%5
+%$$7$$$-&&*
'#!&8+$1%( '%
%$$7$$$-&&*
*+,&*5+%$$7$$
$-&&*
%$$7$$$-&&*5
%$&'%51&'$'!
&*+
-&&*
-&&*5', *
&*+
+,!-$*&*
,1$ '$!&
*(,'*
>'*?
+--&!,
',++!-%
&&$+
%( !( 1+!&
'.*!&
7
%$$7$$7$-&&*
%$$7$$7$-&&*5
, 1%'%
'#!&+8+$1%( '%
*+,51&'$'!5$-&
&$*&*+
&+,*,$6
!2,$6
!%!&( $!,!+/!, +!2-*+
1$&,$6
$%-,$6
!,$
*&!&'&
&&'&5*,,$6
%!,,,$6
-#-&,$6
!2,$65
%!$$!,$65'$$!,
$6
,$65'$&+
,$65 !*#!$$,$6
&,$6
'+&$,$6
'+&$,$6
,$$*,$6
-,$6
$,'$,$6
,*+'&,$65
, $$ 7 1# ,
$65*&$$,$6
&+&,$65&
,$65-)-,$65
-#&'.! ,$6
,!7(*+'&+1&*'%5*$$*
,0!5$!%!&( $!,!+5', *
1+, &!*.!+
*,*!+,!&( $!,!+
*!( *$&-*'(, 1
-*'%1','&!
*&'($+,!*$$*
&*,!'&
%*,7,'&%1+, &!
+1&*'%
,!7(*+'&+1&*'%5
(*&'($+,!&( $'%1$!,!+
&*7++'!,*,!&'(, 15
%$&'%7++'!,*,!&'(, 1
*&'($+,!*$$*
&*,!'&
&( $'%1$!,!+5*$$*
&*,!'&5 '*5+&+'*1
&-*'(, 1
&( $'%1$!,!+5*$$*
&*,!'&5%*,7,'&
%1+, &!+1&*'%
*!&7+,%&( $!,!+5*$$*
&*,!'&
!%!*!&7+,%&( $!,!+
&+'*1&-*'&'(, 15
&( $'%1$!,!+
,0!/!, '*/!, '-,'(+'$'&-+7
%1'$'&-+
*&'($+,!*$$*
&*,!'&
*-+,$65$%-
,$652',$65
.!&,$65#!
,$6
%$$7$$$-&&*5
&-*'$+,'%5(*'+,,
&*
.*!&5*+,&$-&
&*+
*&'($+,!&( $'%1$!,!+5
(*&'($+,!+&+'*1
&-*'&'(, 15(*&'($+,!
*$$*&*,!'&5-,'&'%!
1+-&,!'&
)+ $ !
#$ $$!
# !#'$$ $!# %")((*&""""$!"""$!"""
9,1(5
5
>D=#
-*'&+;+-&-$-+<
&,!7?
A=#
-*'&+;+-&-$-+<
&,!7>
7
?E=#
-*#!&"1,'($+%&
', *&-*'&+
&,!77?
CC#
7
$!'&*'1,+5
&-*'&+51,'($+%
BB&E=#
@A&C?#
@B:A=#
&,!7B
;&,!7?<
&,!7*
'*!&&-$-+, &
1,'($+%;&,*$
&*.'-++1+,%<
1,'($+%5-*#!&"
$$+
'*!&&-$-+, &
1,'($+%;$$&-*'&+<
&,!7-
;7><
&,!7!
;7?<
'" +
(" #
!
)" #
+
*" %
&
%!!
($+!!
(!
&
'" !
(" %
&
)" #
(
!
%%! %%! ) /4
4
-,14
24
24(-4
24--(
024
--4
.,4
-34
%&# "
!# "! !!!! !'
!'
%&# "
%*" !+&!"" "& !&#
!!!" ! !! !'
!'
" !'
!'
!'
!'
!'
!'
" !'
!'
!'
%
$!!%!! &
"" !!$!" !! $! #! &
# " #& !
% # "" &
%%
# "
# " !!* +
!
%
#""$! ! %& $"%&# "% &#
% & ! """%&#
" % &# ! #
(' !#!"#"# !"##!"$##"
# "!$ ##"+ " #" &! "& # !# &# #
!-" # !%$" "("# ## $"" # "##" " & "
&# # $!( "65+ $!#!!* #!"! $##" !
##" &# ! "# !! #' ("# "(! #
" ! #! # ! #" "!!"78*79+ $!$' $" "$"# ## # #" ! "(#") ( " " ##
!""#$#!##!"#"#"$#!#%#
# "!$7:+ " #! "#$" "$"# ## " ! #(,#
"""+&%!*#!"%###""(#"!"""#
&#'#!$!#""$"!#,#("#"(!/0
/20+63
* ""%#!"!
" ##"!#
# (" ! $##" #" "(!"81.85+ #! " & # $! $ !" " ( ( # ! $ "%!
#" !# # #" "# $!#!"##! ! #!" "$ " ,
#(,," !## /0 ! #!" ! "# #! #!"! $"
"$"" !386.88+
#!"#*"""#&##(##!""##!$!#"
" # ,#+ * ## #" # # "" #! (
$)# ! #( #!"! #! " # !$
$##(%""&#"!#" ##"7:*89.91+%!
## #!$# " ! "%! "#$" ## ## #,
" " ##"73*76*92*93+'#"%,#!#
# #$! $!#! "$
!#" # %%# # $!
$#(74*77*94*44,47+ (##' " /"0 $ $ !"
42
#$!"#" #,!%' "84+$!#!!*#
&" "& ## !"# "* ++ $! $!"* "##$#%( ' !""
"" $" #! ' !"" !"" $! #!(
#" ! $! $!!#85*86+ !#" # + ! !# %" # 10 !# 3; " # ##"87+10#"#3! #!' !"""""!#
("%!#( "*$#"*#!' "$!#
,/+#"!%""
##!## ! "* !#" " # # "* #"
"" " #,#$! #%#(88*89+ # " & ## # #!#
#& 10 3 " " !## ! #! %!$"
#"90*91+"$"(#!! ##% #
!#%"##
"#!##!#,#$!
#%#(+ "# # % %% # ,# ( #"" " !
"#$" ##" &# ! # !! !# -. ! # $,
"(!*&!"$""!#&+
""$#( !#!)(#"#%""$! $!"
#!$$"#""#!!##" ##"+!#
$##"!"#(!#"##(# "!!!#,
!# !# 2 -2 ! . ## " ' !"" ( $! $!" ( #
""#!+92*93#,2#(&"!"#"!#& ##"&#
%! !94+ ! #"* 2 " ' !"" ( !
-!$ !"#. #"#"* #& $, !% "#"95+ 2 ,
)" #!#" &# ,(* !## #!"! # #!* #
(# " "#,##$#!!$!$!"96+"#!#"
##&!$#,( !%"#!!!$#!("!
' !""96+#! (#&#"#& !#"$""!%
$!#""#$!"97+"# ##"&#!!!"#!
%!!##"""!($##"$##$98*99+*25:
32 ! !" 3-6 # !" ! ! ! ! !"
% /54) ! ( !! !*/ "!! ) !! !" !* &!!% 47 ! !! !& " ! *! !"! ! " " +" .-,3/(31) !(
& !! " !#! !* 47 !# '& " !! %!& ! " "
.--(.-.) $#( "
! & ! # ! ! " !!
.-/(.-0)
#! ( ! !"& # !! !'! !*/ ! & " " " "! /7 ! $ &
!! ! * !$& !
"!.-1) $#( ! !"& $ " !&
"!" ! $ "! !& ! $ !! ! !$!"" !!"!!"&
! # !! !& !) ! !&( ! !"& !&
!! ! !" !*/*+/,! !!
! !!/!.-1)! !!/(/ % ! " " !" ( ! ! !
!! "!!
.-2) !
!&( !! ! ! ! ! &! $!! (!*/!*/*% !$
$!( !&!$!#.-2)
&%! "
#
'%%($!#$" !07 !")
" "!!)
#$
"" )
00
!&$)1 !) &!'&&!1&%& &1'"$ !"%&
%+ $!- %! "$ !"%& % %!$+ '$!"&+ 2 "!+!"&+
3240
=:?!&%%&' $+ &'!$%&%' $
340%&% "%-&%%+ $!%%%!&)&& &1' &!+-
%! !)%&+"
&1 '$! '$ &!+3164-&&%&!&$&
&$ + !!!!'% "$!& % *"$%% & / ' 3 '$! 1
%" "$!& 9- 94- ' 3 '$! 1%" "$!& 8- 84 ' 3 '$! 1%" "$!& 7- 7. %! !) % 1640 !&$ )& & "$!& ' 3
'$! 1%" "$!& 6-96.%!)! %'4&+
'"&'+&&%+! %$($!%%%"%65;03$+! &
!$ (%'4- "$!& && % %% & !$ & (!" & ! & $(!'%
%+%&!
%!)%!!!+&!'"$!& %%'%& + $! '&" '$! "$!%%%65<-65=0 - '- ' ' (
%!) &! '$! 1%" "$!& % (!( %&,&! &'$ !($65>-6650 '- !$ *"- )% %!) &! &
! !$ $ 1$( '$!&$!" &!$ 346660 &! +- &
"$!!&%&!'&$!)&! '$&%(& &$&! )&& %66670
'$! % ' "$!& % $ !%&+ *"$%% & ''% '& $ &!
&$ %!& &! & +&!"%- ) % $& !$ '$! $ &&!
=8-668-6690
' % & ' "$!& !%& $#' &+ *"$%% + % $$%"&( !
)&$"& &%(!"2!$ !&66:-66;0
& '1%+ $! + $! ! & $(!'% %+%& & ! &$%&&!-%'"$!& %$*"$%%+($&'+ '$! %0'%- %+"&!% ($+ $! "& & &! "& & $ $! % %!$+ '$!"&+ &!
'&! !+%' &! 364:90$$ &$%)&"&!!%! %$
& ""!"'%- !)$ $ %&- %" !$ !$% $!!& 34;8-=8-66<-66=0
&)%$%&&!'&&&&'%+ $!)%&$$+$!%%1
$&( &!+ $%"! %0 &!+ &&$% "!%&% '$! % 89 $%"#%% $$#&&"$#) $##8:+22:,'&"+
$" # & $$ $-% $# $ "# # " $
#) $#, "#$+ "$ ""$ (#$# $' $ #$# $-%
$# %"# " #$$# #$ $)71+94,
+ # $ &+ $" # $ $ %" % "# #
"&$$" $$#7:,)+$$ $#$$###
'$%-# $#89+8:,%"$""+$-# 5;9;
# '" $$ $ $-% #)" $$# ##$ '$
76+93#%#$$$%"%$)) )"$",%$ #)#$%#
#' $"$ 9; # $ " ") #
"($)$%"#74+77+94+231,$"$9;#'" #$&"
$ )$$( "" -2+ 218 "*) #$") #%#$ $$ #
" "# # " $ 74+77+231 .%" 22/, ")+
%#$$##( "##%"# $$##%"
" $ % #)"77+231, ) $%) #"& ( #$ $
)$%"$'$&")$"##
$"#77,5;#"""#$"$$ "&#%""#"
" ## "!%$) % $ $ 9; #74+77+229, $"
$"$"$""# #$-% $$##$$0
" "$" ( # 9; #95+231, "
$&$%#"&$"#$+9;#
$) " # $$ '$ %"#74, $"#$+ # "") $"$ $
" ") %$ '" # ") "#$ # "&#%"
%#74,
!! " !" #'# 4; #$ #'# 9; #$ #'# # "% "*) # "($) $
%"#,
46
$ $ ! 1846121&122( # & "!& $ "$#1880" "
)$" 122124( ! " 1),) 2),) $ & $ )
! ./ 1 2( ! $(125"") # $ $ $ $! %$ $$ $ 122(
&"" $$
$ $ !!( ! " * + ' & . / 1(3(3122(
$ $ $(
& $ $ # !$ ! (126&127 "(&
& . "/($! $$
!(126&127& &&
! 35 $%'$%( !"
!"$%'$%(
$%'$%(
! " $%)$&# $%%
!$%"
$&# &'
011
$ ! # # ! $
& !!! !" !( !( ! "
015&020'"
! !
&$
+, +, & ! +, + &$ &!$ ,"( "
! $ " 015&021' ! & ! !&#! $# " !""&" + 0'2'2'2,021&022'
)*! ) *# !!"' !! # !' !+!02,'
0 ! # ""$ & $ %& $ !
!! !' & !& ! ! $ !! ! !
' &
&
-.&%!
# ! (-'011
1
( $ $ (- $ $ (
! ! ' $ ! $ ( " 023&024' $& ( -
! & ! 0/& 5 00& $
25
"# ! ! % ! ' #" ! ! " !# # "!!#!67>,68;,68<-
!" !! $!"" ""! #!& !!"
8 " ,!!68;- $ ,
65!!%"
!!'"#!"" "%$!!!%"
""#
68<-
!!$!#'# " !"""# !- # " , ! !" !# .!!" "! "" '!" !""# "!"!677-
8 !
!"""" '!,"$""# !9? ! "", "# , " # " "$" " "# .!
=? !687- %$ , ! "!!# !" ! !" "! " ! ! " " "# !"687- %, ! ! "# "
# .4 !/! !" " " # .67677,68:,68<- .67
"' "! " "# ! ' '""&"'
0 " "!!, "$ &' " " "!1
"!6 ""677,68:,68<-
9"!
"$""# .!9?=?! """!"""# " & " " " #"! " " " #! !- 9?
6 ! #" %" ! " "" "."# #
!!677,67;,687-6! #
.7,.2.4"" %"
!
"' " " #. #" " !! " & !! !! #! ! !, ! " '""&
"$"'677,67;,687- ! ! " )$ =? ! ' ! "
' ! ' =? !6>,68=- "
"."# !"$"'/$"' ".&!
"# !, $! '""& " ! 0-- (' 1 &" $"' '687- # " , "' " & !! !# #! "" % " " " " "# - 658/3< " & !!
95 ! !)! !!!
!!!"
/10(
!&!#! ,((
)2 )/- %! , ' & - ! "! ' )
!"!&#!'! "# !"
!! ! " !! !& ! /10( &
! & "!!!!"& !!
!!" (
!" "##' & "" !$ ! ! "
& !!!"$( ! !!!* +
& ! !! ! "! "!" , " ! 2(2-( %! ! "" !
$ "! ! " ! !! ! ! ! ! /13( ! $ !! ! !! ! "! !
!" (!" !!"&!!"
!& $ !! ! !& " ! $ & "!!(/12 & ! "!!!" ! !&"!$#! $!!$
#$!#" "!! ! !!!)"
!!(&' !" $! " "#/00'/10'/12
,"/1-(
!" !!! * !+"!!!
!" ! # ! " & ! ! !" ! !!!" & !!!(! " !& # ! "## !" /10( !''! ,((
-! ! /10'/11(" !! "!&! "
! " ! "!& ! " & !/2.( !&
2/
% " $" ! ( !
!"'%! ) %!
!)*(('%'
$ ' (+,.,( % ! ' % ! " (
! % "% ! % ! ( # # #)! ! $ % ' ! )
, 2 !(,.-',/, % ! % ! !% ! %! /3 " !
# ( ' !& ! # # /3 ! ),. # # #
,/-(!
'
)/!%/3 !!%( )/ " % -)&' " !"" % ,/.',//( ! %! ),.
)/'! !)
!( "' % -) " % % # !"" ' !
) ! "
,.,(
%)- " % $! %
!13 ,.-',/0("' /3
! ! " %%!
,(,(.(-(.(*!,.+
/- $ # & ! #% " ! *,.% ! $ $ '# ( ! # #-+% $ "
'%% $ ($ '#( '(-+%&#!
## -/% $ .)2 ! # *,.%
$ ! 0+2 & '-)2( '+-2( ! 1+% ! $ & $ #$ *,/%-&*)2!++%
#$ . -- # #1+%#$!#$#
! *,.% $
+"#
&
*,.%"# # % ! !!#*-2! !&!
--% !&& ! % $ # !
!&#
--$*,0% $ ! # !
#%#
! &#
,, ""6/$.-.$.13$.14$.16&$'
# " ' 32$5/$./-&
" ! " + , + ,%
.& ! % $ !" " ' 31& " & ' " ""
"$ " '&
/& % &
0& "17%
17&17$57
*" #&
1& 5717%
"" ( ") $$ &
12
!"!"!& !! ! !!" & !
! ##) 2:12( " , "!!%" - ! !! !
" & ! $ & ! !! ! ! !
!!! $ !261(262) !&%!$! !#! !"'!$!!$ )$
!" !!!& !! ! $ !!"! )261!$ 2:13!! ! #
"! !!! !!!!+ $" & ! !!" ! !" &% &261(262)$& !! !"! !
"!!& /"!'!0( "!& !! " !& + $
261(262)"
"! #! ! $("!!$ &
!$ 2:56 2:76 !! ! ! "!"!& ! !)
!(&"!" # !! ! $)
! ! "!" ! !! /0 !
! !!"! ! /0( 6*9; ! "! ! ! !! /0!!# 263)! !(!
"!" ! ! /0 !! ! !$ & " "!" 264) !"& 311:
"! # 8)7 . :; $$265) !!"&"!! !!! &!
&! # ! "!") $#( ! ! !! "!"
! !& $ 263(264(266) 57 " 2*&+** " "$ .* +/,$+/-$+//% (")
" $ " +/0$+/1% $ %
" " " # " %
" " "+/*$+/+% $ " & &"
$ " " " (&) " % " " " # +/2$+/3% ! +/+$+0*$+0+%"
%
"&"
% " +*%
"
( +.)% "'" & ! "
+*$+/0$+0,% .1
! )& $!!!!&-#!& *! "##
! !
10(162(163)
!'! $!!
"!!!& *! !$!!"!"!&) $
!& ! *! $ ! ! "! !! +,
! ! &10(162) " ( ! !& ! #! " "!!# # $!!& !
! ! ! # ! !&" ) & (!" ! *! % !!&" .
$ # / ! ! " $! !! *!*
% !156) $#( $! $ #!& *!* !
"! # ! #!& "
! " ! ) " ! % *
!"!& " # & ! " !"( " ! )
! "!!# !! $ ! ! *! !!
!& 10(162) ( ! ."
15/( % ! !! ! !" "! 10)
"!!# !
" ! # !! " & # ! ( ! &
- & !
10)
! .
/ % ! "* & ! * # ! ' !) ! "!!"!* !"!&" - !!
! ! $! ! !* ! " !" !
% ! ! !& " *4 *1 10) !! $! ! .! / ! &)
! ! ! ! % * !"!& *
!& " !! # ! #!10(164) !
! ! !"! !#! !! ! !# *
! ! - !& ! ! !164(165) !( !
&!"! 48 "!#!
"!" ! ) ( ! $ $ !! !! - !78 ! !!$ !
48 " !! "! 78 47 &(&!
8=<.&%%&&;A%$%%
& !&! +!$& &&! ! & ' $%"! % '& %! !$ '&!' &+8==. ;A % + %$( %
"$$+ &!$ '& !& ;A ?A % "&! '%
'&!' %%%8<=-8=>.
!%&!& !)!'&'&!' &+!%$!&)! !%-
! ! ! '&" %$!%% 23- !) % *"$ & '&!' "!+&% 23- & !'% ! ! ' &+" &%
28388:-89:. '&!$&( % ! &$'& &! '&!' &+ &$!' %($
)+%. + %$& +&! % && & %'%"&&+ ! &$& % &!
+&!&!*&+ !$ "$!!& & &(&! - $ &&! "$!$&! ! !&$
' %. & &% !- /4 /6 "$!' + ?A %
'"! &(&! &$$&+ $%+&!&!*&+(- &!$"&!$%
! %0% &! "$!!& '&! & "$% &&! !$ '"/$'& % !' *"$%%! ! 5/%8=?. /4 % '$&$ !) &! "+ $! &!$+!)%%23-*"$ &+%& $(% $'&!
$&$&% 238=?. '$&$!$- ! % $ $% &! &&$& !$ ' % &! & %& ! &! . ! % +&! % + %! $% &
*"$%%! ! %! !'% $"&!$% &! && & &$+ ! !$
' %&!&&!$ !$&%%'8<=. +-%%$&+(&
%/% "&)+ !$ + & $% ! "$!$ $ ,+% &! '
"!"&!%%;?-?<-8=>18=@.
!)($-&$$(!%%'%& &&'&!' &+% !&&'$!
&!$ '& $&$ & !%% ! #'$' &) )/ %/$&(&+
&"$!%% !!$ & %8=9. &%! "&-'&!' &+!'$%%!
&+ ('%&!&$!&$ %!&%!$&$!'%!)%&
!'%&!"$( &'
%%$+ &! &%%'. -
&
. $"!$& && &! ! $ % ( & &! ! &!* ! & '& &! & (!" & ! '&!' &+. $!$- &+ %'%& &&
%/$&(%$)+%"$% &&$!'!'&&%" !!'% &&
&%'""$%%! ($%% &!! &$!&$&(&+8>7.
;@
#%
$""$!
#& $""$!
!!# $,$&$%,# !( $& "#'$%$, %%
$%* $%% %* # %! * "#!%% #! & #$"! $$- #%! ! & $ %! % , !# )", $ %%* #&% $
' %! #.%'% !# %* %# % "# *4:4- ! *
#$ % & $ % # #!"$ 1 $, !#! "),
"#'$ #!1 %#."# *%!&$2-!& $#!& %#!%!#!")&$ % !"#% %,%(!$%$%%
# %!&% %! % %# $ ! & $ %! % &# %!#*! %! $489,4:5-!# & %#$%%$%!"$$
%# ###$- $ % !!.# ### 12 $&##!& "# *' &$,%$! ! $&##!& $%!#!")&$ $ !( $
!!. ### 12, % %# ! $ % !!."%! ###
1
2 !% #!'$$$ ! % $&# ! % # $" !#4:5- % & %! $ %( !% $ ! % "%$!% %'!$! !&$#&%%#
%! % - * # * * ! %#! * %!#* $%& %
*%! &- # %!#* ! %! $ %% & %! !&$, $& $
!& & .8#!( .#&% $! !&$,$&$.
4 .4/.5#&".#&%%!%%& %#*489,4:404:6- $"$$%$%(!###$%*'%!#.%'%*$!#%* )&% %# %!# & %! $4:4,4:5- $ # $%#%* !+ %
% - $ %% # %! #.%'% 7; $ # !$%* $
#!"$489,4:5- !('#, &# %! #! &".#&% !.$%&%!#* !&$ %! * "#!!% 7; #%'%!
489-
#! %! * $#% % *%! $ .45 .56
$%&% % "#!&%! ! . 3, .4: . * $ $ %! 84
! "$$ $ $ %$ %$) $ /34+ &"$##* $ " " # "# $" &"#+ " %! #$"$ $$ " !#
$$"#" " &$,$ ")%$ #$$$# )$,
"&" !#" $
$$$""%$ %$)/52+#$" )$## (!"#### ,#$%$ ") %#$"(! #$ ,.%$
$" " # # #$ $ "+ '&"* $) !" % )$ # # $$ % $ $ /34+ " 67 # $ # ##
" ' # " "#! # " "$&$ + " #$) #$$ $ #*
$ #* " !#* #* # # " # (!"##
$$&# ## %#/53+))!"#$$$ 67
# $ $$ $&$ "$ + '&"* $ #$"$ "#$ #* % %" #* %!,"%$ ## (!"## 64+ $ #
#%#$ $$ " $ %$ % !" ## $ #$"$ ",$&$ $%)
$"#$" $"$ $ $!"&#%"#! $$
"$ !$) #+#!# $$) $ "$
$ %" ,!!$ !(# &* "#!$&)+ $ '# # '
$$ # $$ " #$" ) "$&$ "# $" !" %$ (!"## ## ,/ $ ') $&$ #+ %#* ') $&$ # "
"!" $ "%$ )$&$%$ $ &,/-,
/
$"$ #10*24*/34+# " $"%$ %###27#'#67#
" $ #$" ) "#$ #64*/34+ " #$ ,$ %$ %
### $ $ # %$ $ ") $ $)! "#! # "
!$ ##+#$(!#$%$ %##$# %# + $ 27 67 # $$ $"" $
%$ $ ")"#! #/34*/44*/46*/54+ " &"* "27#$$"
/ " /5 $$ # "#! # " %$ %$) /34*/44+ * $ 27
67#$"$$!")+ '&"*67# %$%"
27 $& # #/55*/56+ %#* $ ($ " $)! #%$)!##$ $" &"#)"" !$$$ !$$+ $ #
%"'#'"!")'$)!#!#$ "+$
#$ !$$$$"$$ //5## $
30 ! !%* !$ %%*%() "%'#
#"$
! !
(&
$ %!#!$$%,!#%!% %!%.# $"$!
% !## %! )#% %# & %! $367,384- %$ ###$, %
"%! $"$, &#!"%! #!"$#"#$ %
$&$% %% &#! %! % "## %* & (% %$
$"$- %# #.%'%! , %!#* $ % " %#% %! % "# **#!$$ %% $$&"#$!%$&#!%# $" !#-$% $! $$%!$%#!*%% #!$-367,384
#!$$ %$&%$%""#!$$%%"%$$'#!&$! $ $ ( $ ! !% $ /&# 360- ! %% %$ "#!$$ #$%
%# $ % ! %% %( #&% $ % '$&# !%& $
-$! %%$ &*$! !&.$% ! !%$
%# .3384,389$ %#%! %$%$!(#! !$! % '$&# (- ! !%% %!#$ ! $ &# #! '#$ $.!&% $ %! 15. 24. %# $ & ! !#%! $ &$%# !#"%!#$-%'%! !#%! ! %# $ %&# $% %*!%$ %# $%!%##"%!#$ *#$&%$ %
##$%!%$-"%!#$%%#"!#% % %$$%"#.3,4,.
.3-384,389 $ %# .% "!$%.##$% $%# % % $! "!#+%! ! $- $ $%#% %! #( ! % !%&,
"#! %* % * % %#%! ! .3 / $0 .3 4
/ !%$0-384,389!$#!#$%!#"!$$"$$,$)"!#
% !%& (% '!$! "#!%#&$! $- * %! #( ! $% $ $% % #%! ! % !! !( %! ""#!"#% $% !#
"$$- # # %(! "%(*$ !# "$$, "#&# /%( !% $ %#!& !% & %! $0 !# %# $&# / & %
!#%! ! "!#. $%#&%&#$ % !%&0- %$ "#!$$ .3,
. 99"*#!-384,389
#&%!#$ !# ##&% % %# # ! $
)"#$$ * $'# %*"$ "% %! - !#* 65 &(& % *"$%% & #'& ! $"&!$%. ! % ! $"&!$%&&"+$!!$&& &%%&!&$ +
<1
86-;1
;-9/
?-76-77 =/
7?-87.&! !! %! &$$"&!$% '%&*"$%%! !%! !'% &$ %&&!)%&!$!%%&. & &! % &&&
%&& + !$% !&$' % &$&.7=8
- !&%!& "&%!&!$!"*'%
'"/$'&& &$ %/7 /7 %$!' ( '%
*"$%% &% !'% ! !& &+ *"$%% /7 2 !$ /73 4:57/ &$ 2 !$ /73. % *"$%% & %! !$
/7-4:5=/ &$ !' !&&&.!!4:/-57/ &$ %
!$ /7 &% & &$+ ! :@ >@ % &! & .7=8-7>6 ! &$%&- &!% %& & &$ 4:5= &! & $&! & &&4:57/ &$ &%& &$&! &) !&% %7=8-7>6. !)($- &(+ ' ;=
0< ! ! 4:/
&$ % ! & ! !($ &! . &$ & &! ! 4:/
&$ % &%&!'%!) &&! +&$&! !7%'& !&
7=% &"$ +)%$%&$&7>7.%%'%&%&&$ &&+"%!
%+($ &%&% %%&! &$&.7%%&!
"$$ &! " &$& %" !$ $!(%%% 4:/ &$ " & $
)$% 7= % $!%% & ( & &$&! &) < 86
&"!
/7.7=8-7>8
! &$%&&!&- !&%!&
"&!&
$!(%%%! %&&'&(+*"$%%/%& &&&$&! &!&%%&. &! -"&%!&!$!"*'%! %&&'&(+*"$%%
/7 /7.!)($-&+$!,! &"%&!&"&
% ! & !$! "*'% $ &$!$ ! "'% &!$% !$ $&! $!%%&.7=8-7=?
;;
"
! !
! !"!!$!#" $!!! " " ' ! % ! % !
#! ! % " " ! !' ! ! $ ! & !! ! " " !%
! ! " " ! !!' ! !
!"!!!!"!!!" %&!
"! !!" %!"!%
"!! ! !" ! ! ! ! !!).*'
$#& ! !%! & !!! !!
$ " !! % "' "!& ! $! !" ! & ! # # !#' % ! "! !
!% # ! ! ! ! % !"!
'" &!!#!$ ! !"%$ !#
!"!!!%"! !
" '
!%& " ! ! & " !((+ !() &
$" !"! ! !! & % ! !!
'"!(+ $!!(!"
"!% $ " !! %!! #!%'$#&"! % % # !
,-
! ! ""$
" $&#$'! ""$ !
%' $ " $ $ "$ $ $
$ !$'%&)
(*
8
9
:
;
<
&'(" )& 80960 .(& "# ( 8090;60 ' 8090:0 ! =
)&.8090")&<0# " )08094
>
?
81 87;: 3 <9?90 "(& ,'#$(#
@
&"
# #) #)'3)&$"0
87
91"*&'(.#)
88
:
3@770&-
89
;1$&(!"(#
8:
<1$&(!"(#)&#!!)"#
8;
#""0)'(&
8<
8=
&'("2)&5"'&!2&
8>
(&2$"# (5"'&!2&
8?
2,'5"'&!2&
8@
! 2!)&5"'&!2&
97
[email protected]
98
99
6')(#&'#"(&)(%) ,(#('+#&2
#)'
0:87770&"
" )&#'"'0#) #)'"*&'(,#'$( 0&"
#,0"(&#&&"'&0 "*&'(,
=8
45
46
%**
47
3265/74:4*$")# !$ % %#%"!
48
#!$*% $%")62253*5327; % %#(;*"
49
(,<55/784/96/67/7:+$! ,<55/784/96/67/37
4:
/," -%1#"-"
4;
52
53
)' "#, " !#$ %" ##* $% " %$)* %$ %$)*
54
$""& %##)#$*#
55
56
57
58
0/.0/$ ##
59
.$""& %##)#$
5:
."" #!%
5;
.)$ $ ()! )$
62
.%$
63
.!" !#$%" # ""
64
.# "$/&$ "
65
"."%$ ")
66
.'$)!
67
84 57
58
59
!" # ! ! /
!0 # #"# !!!
5:
""!"'""" $#!!'!"/
0,' " '"
61
# !! !" # !-" "" ! "' & !! 62
!""# !,#""!! "& !!+"#!'!" "!
63
" ' " "# ! #" ! " # ! !#" # ,
64
% " " " -" #"' ! !!" "
65
#""!!"" # "!,%$ +"! !" #""
66
"!! ! # , "! "&"+ # !"#' " $!"" "
67
" "-"# # # !!! " $" , "!
68
+ % $ , #! "# 69
& !!"#"/0$ #!"#"-"# !!
6:
-+%& !!
# !, "" "
71
!! !" " "+ ($ -! 9; . 5; !+
72
" -" ! !+ % " ! " "! , 73
!" " "" -& !! "# !+ #" " " "# !+ # 74
"$"+ " ""($-!5;9;!
75
"" !, $ +"!#!"!% "" "# %"
76
#
"-,#!+"!%#! $!
77
# " !" " " # !! % ' "" "-"# #"'
78
" ! -!!" #"# !!+ ' " " $
79
%" #"!" "!!"
,
74
03
1*
() 1+
! ' 1,
# # #& 1-
% 1.
%#"#
1/
## " # +& '
10
" ! ! # # 11
##,&! % !
12
&
13
%$#'
2*
# # % % # & 2+
% ! " &
2,
% & % 2-
#
2.
$ #-&
%!
2/
20
(
)% ! ! # &
21
% & 22
######.%/&
23
##!
3*
"% '
3+
0%1& % ! 0. 4-
! '!-'-!' 4.
$ 3( )
4/
! ! (' '
40
! ) ! 41
% % 35 !' # 42
% $$ % !
43
,/',0 44
! # )! %' ! )"
,++
$,1 % ! ,+,
! ! # ,+-
# # ! ! ,2*,4( ,+.
' "% ( " "
,+/
! ' ! % ,+0
!%
( '
#!"!(
,+1
' % !& # -+'-, ,+2
" ) ! ,+3
!
--'-. !%'#"!#
,+4
!$ !( ,,+
' " % % !
,,,
! ! !(
,,-
#'#" ! /535
,,.
! # ! %
,,/
(
4*,.(
"'
%' % $ " 10
559
55:
55;
55<
55=
564
# $ "#$ #$! $ - /# $- $ %$ 565
&"%# 23- '# $" % $"#!$ $% "- $ 85 %#
566
")" ."#%$85/#(!"##&# ##
567
%#- %$ " " 85 # '$ "#!$ $ $" (!"## 568
2 3. $ $)!#
569
% $" $ #
56:
2
3.
56;
$$/$% ""#! #-!$'$$85/$% " "$#
56<
!"$ - "& *& /#! 8> 0 " <> # # $ " 56=
/$"# 574
$"#"" /#! # '# #$%# $ " $ %# 575
# $"!$#.
576
"#$&#$$$!$) $85/$% "$ $&$*&/#!
577
#. %#- / 89.5> 8> # " $/
578
89.5> <> # '" /$ $ #) "!$ - !"& %#)
579
!$ '$ $" 85 " 85/ $% ". ( )# ! #$/$"#"- 57:
!" "$ $/#!8><>#'#&)%$ 57;
$% "#$)#85//"-'"#!" "$ /#!
:: 6816:.
$% "# "' #") '"
!$&) $"#"" /#! #
89.5 "" (!"## ) $
46;
$ $ ! $! 74 !" /
0, 46<
!&- 7>;> "-2-1
473
" !"!+!!&4'!+$!#!
474
&!-% !"/
0,- &"
475
!"! 74-/
0,
476
! ! $! !& ! !-!" " 6,
477
+!+# !!!!&!!$- " ! +
478
!+ ! ! ! 74- !", " $! $ 479
!!$!74- ! ! &$!(#
47:
- ;> .(#- 7> ,- ;>
47;
!& ! ! !" $ - 7> 47<
!!!,! !&+!-!(#- ;>7>
483
$!"!/
0,+!73=!
484
$! ! !& !" /
" !"
485
!$ #!!74!"/!! $0,
486
487
> > 488
489
!"
!"!$! ! % &!
48:
!" " + $ " - !! % 48;
! " 48<
!$!74-!"$! (#- 7> 493
;> , #!& !$ ! ! - $ # 8=
5:,
! $! $ # - 9:
050
!!" "%"-
.) "*!&"
051
$#! $ !""! !!" !$ ( '"$"'( "
052
-
.(%"" ! 69"!)
053
!! %! %$ " !" ! !" !# $$ $ " "
054
%"" "!%"2%!-""!%.)* 055
" "30"# %*"'-."%""30*"# 056
% $ !# !""! % " ! *! 3:
057
7: ! -
.) ! &#! "# ! ! !! #! 058
"! "" "*"# * !! %! " !#" " " # 06/
!""!"!& !!+# ,"")
060
" ! " !" " "# ) " #'( %
061
*-;2."%"30*" ! %""*!
062
3: 7: !( # !" *"!" #! %! ! $ %"#"
063
!! "# !!" &" !!) !"' !% 064
#'" " " #" $ ' % ! -
)
065
!"$ *
" $ & !! " !" ! "!"
066
-
.( #!""& !!"" !
067
!#!#"#"# "$$"!" *"!"" ")
068
!!!! " $# " #" 3: 7: ! " "'(
07/
30** * $ !( *! 7: !( *
070
!3:!( ")'*"%"""'!!
071
$%"!!# !!-
.)
57 072
"%' ') 30) !' 073
) 3: 7: % !!
074
) ! ! # ! ! (
075
%' *!+ !#
076
! ! %' )(
077
078
08/
080
# 081
!( #%& % 082
) %7- .%04-. 083
)$ !(%) # %
084
! $ ! !( # 085
! ' % ! - .' ! 086
$'!'! - #.(
087
! 7:- .( #
088
3(505(89#& !
1//
('! % !'!&%
1/0
# ! $ % ! - .( %' 1/1
! - . 2 " % - . !
1/2
# ( )2 " 1/3
, " ) -.(
58
1/4
% & ! %
1/5
!#% %+ ,
1/6
" % -0034. # " 30, ,
1/7
-
.+, 11;2+29
1/8
34+0: , 67 ; 3+0 9 ! 34+0, 10/
-
.+ %*34+0:,70+5;3+097:
100
+ * %3:-47+3;4+79. 7:-30+5
101
; 4+7 9. # ! -
.+ 102
! ,7: 103
% ! % " 104
! + %* !,! 105
!-34 00.#",
106
30, ! -
.+ -% 10.* , 107
# " !% - .* ! 108
! + " # 11/
! ! % 110
! *
#, # 30,
111
! # '",3:7:+ 112
, ! "
113
$! , 114
115
116
6/ 228
'# %"## ! # # #( " * #$! 229
"(&(##!(+#!"!!8;4;"*$#40,50:
230
'!"",γ,/#+"#!$##!
231
#!"!! 8; " #& !" - .+ #!"#* !
232
!!# " !$ # ,γ, ,/,!$ " &! !"#
233
# ! # # " ! #!"!! 4; " - .+ 234
! $(,,!
,17,!$"&"&!"-.+
235
%!#""* #!"!! 8; 4; "* #! &" !!!
236
$$# , ,17,!$ " # # #$!
237
!##!"$#!!#"+$""'##"
238
$# !!#"+ &%!* # ! $( $" 4; "
239
!$ ,γ ,/ &" !" # #$! " ! # # 240
-.+"!"$#"#!!#$$##(,1!)
241
"#&!"!##(,17!)"&"$#
242
#$!+
243
("" # "$! !!" 25* 44* 62
* 1 127 !%
244
!" # #( ,#!# " # #$! #!#
245
" "+ * # ! $( #!"!! $" #!
246
8;4462
& " &" ! # #$! ! "+ 247
#!"#* "# ! $ $ ! #!"!! $"
248
4;#!"#&#$!-.+!'!""25
249
&" " ## #$!,#!# " # #! "
71
472
!' &$"$&% 0
1- '$&$!$, ) !' $
473
$#' +! &$!$+6684.%" ! !'%:<
474
% & %" & & !$ &'!$ 0 1- "$!"!$&! ! %!$&.
475
(&!$:<%0%1&&)$%!) &!
3349!)4:)%
476
!) &$!$ %- ! &$%&&!.%":<%, ! !'%:<
477
% %"+ $ $#' + ! % &'!$ & & %" -
478
$ + $ && *'%& 6< % $ %! %
479
3349!) 4;- !'$ !, &$ %$$ 6< % )& &% " !&+"
47:
)$ + "$% & & ! &$%& &! ! !'% 6< % && )$
47;
%!"$% &&&&'!$%&-!&(+,. &$& %%!)$
482
$#' + ! &(&/&!$ % & % $% & &'!$ &
483
%" -$"$!"!$&! !
3349!)6<% &!$
484
!$ *'%&! - &$%& +, $ "$!"!$&! ! :< % & %" 485
%!)$+!$+" !&+"-
486
487
488
*& &! &$$ )& . $&! &! & )
489
"$%$( & &.&'!$' $%"! %-!$%"+,)&%& 48:
""$!$+ ! &! &.α6 &$ 0/41,)"$( &%&
48;
$&! !& "&! '!+&%$!%%&!!.$ .$$$&$!'
492
&% &!&.6/α6β3 &$ 52,53-!)($,&$& &%&$&&+8
493
!& % &+ (& % % 0 1 !$ &! 0
94 272
.+ %) ,4;8;$α4
273
-49. ! -4; 274
0 3:*8;2+3 16+2:.+ ! 275
! " $ % 276
! " !32)33+
277
278
279
!%)
! 280
! % & % 281
! ! %+ ) # ! # 282
! ! ) # " 283
! + !% " 284
%% # 4; 8; " 285
! # , !! %+
286
$ ! !
287
) , ! ! % ! ! %+ ) 288
! #! ! !
289
"" + " #
290
"!!+#") ! !
# 291
" " !& # !!!
292
! ! % ! 3+
293
%) ' + ! /, -/,. ! 294
" % "2 23+ , ! /,,
8)34
73
4;7
& !! "# ! %! "$+ "# %! ! $ # " #
4;8
" ,# +%'!!"" '"$" ! "-
4;9
! 6< :< ! "" + " + " #" " "-
4;:
" !", %" # !#"!+ ) " , #
4;;
" " "'#!& % !$$
522
"6<:<!!"1-45,
523
# !"#'+ % !" ' !#!" "" 6< ! $$ &" 3
524
"'!" "'" "6<! #!-γ-
525
0+!! $""! ;," #"!"& "
526
" ' "$ " ! 3 " 6< ! ! "
527
# " 3 "" ! " " !" ' 528
# "#!,%$ +"'%!! $ 44,
529
# + "-! 6< ! % # " # 52:
" " " " # ' "# , " !"+ :< ! #
52;
"'" ""# #"% "!#"""-" """
532
, # ! $"! !!"" %" " " ( #! 57,
533
' !" " "" " #" #" ! " !#" "# 534
",6<!!"""+"!#"
535
"! #"""""# 57+58, +%#" "" "
536
"%"-!6<:<!%!"'" $
537
" "# " #" ! !!" " # " #! ",
538
%$ + !" " %! ! $ "% " "# " 539
" ." " !%/+ !#!" "" " ! " " "
96 207
( # #,#$! $#( #!$# # # %# + 208
#!# 7: " &# 3: " ## !) # " # &"
21/
""!( ! # !! # !"" # ,! !!! $ #!
210
$#"+"#$($#$#"!%"!!"$#"+#!"
211
$" & " '!"" # !# . " " ",
212
#*#,"3:"!%#"$!%%"*#$"*'#
213
# # # !! #! #! $#" 26*27+ $!#!!* # &" "& ##
214
3:""!###%#$##! 28*3/+
215
#!!"$"###3:"(!#!#""$!"
216
" # $! #! $#" # !" #! "$!%%+ 217
#$#!#%"$#!!!#!(
218
!#!###
+
22/
#
*%!7/9#!#,""&!7:"*"$"#
220
###""!#$#!%
#+""
221
""## &# # " $ "#,!# ""
222
"#(""!""!%7:"!$!)(
223
" !'#( # $!"+ $ !!$ #" " $! 224
$!(##!!7:"
*!!##7:"!
225
##!"##$"$!#*&#!$#(#"
226
(#(# !$" #&!" $!"+ #!"# # #! "* &
227
$ # #( ##* !! ""* # $" # $!
228
"#!,#"##!#+""##&"!%$"(!!#
##"
23/
30-32+
0/*02*
&
64
12/
$!)5.8#$!&#"#&#"""&
120
#+ &%!) "# # !%! ( ( 0/+ "
121
$!" # "" &" # $ # # # # ! !() " !,
122
# # #$! ## % $ # "$"# # 123
#+ ! "!%#" &! $ " #!"! ,
124
" 29 69 " ##! &# # !,$# # ,
125
' !"" #$!+ " #$! # "" ( !"$#" !
126
'$"#," #!""!(# !""###' "$!
127
# !( ""# # $!$#!( #&(" #) 13.
#!") ( !$#!( "+ "!%# !
13/
//05&"
#$!!$"%!#%%#
130
'$"#+&%!)#"$!#'$"#," "$!"
131
##$!)
!#+
132
" & ' !# $ $" " ! # #"#
133
$"&# !%#
#+#!#""
134
&"###!!&####,#$!$#(+#"##! (
135
!(!#!$# "!""*(##("#-2
136
#!+ &%!) % #$ & # #!! &# #,#$! $#()
137
#"
14.
!!) $!#! "#$" % # !! # % # #!##
14/
!
+
54 ! !# !!#"##"&$"&!## !%#
#+
DGC
' "! !# $&#*' " )"$&"( &'# )(#" # ( " !!(#&-
DGD
&'$#"' (( )'' " + $&!( ( $&8 " * (#" # "#* DGE
(&$)($$&#'7
DGF
DGG
DGH
DGI
7EF7B!5!8!5E8"G7F8!*"'&
DGJ
$&*#)' - CE;CH7 !+&&#">:,FH:G?B&#)"7
DHA
+& $( )"& '$ $(#"8& #"(#"'7 ,$&!"( $&#)&'
DHB
+&#")#&"(#) "'"*"$$&#*-(&#" DHC
('#!!((<6:AJ:CD:AD:BC5#!(090(%)$#)& 9,$0&!"((#"
DHD
"! 8-&0"0'5$$&#*BE7AJ7CABC=
DHE
DHF
EB ()!#& "5 &* &#! : '$#"("#)'
DHG
!!!&- &'( &"#!5 " (' EB8 &*(* ,$&''" ! )(""
DHH
<=#(*&)'<$&#*-7 (.!"51$( (0 $0(&/&=5+&
DHI
) ()&" )(8
)!<
"*(&#"=')$$ !"(+(BAK( DHJ
'&)! < #&(#&'=5 BK $" "8'(&$(#!-" <
"*(&#"=5 BK
DIA
)& '# )(#" B < #&(#&'= " A7BK @8!&$(#("# DIB
<
"*(&#"=7#&
,$&!"('5BAFEB#&EB8 ' )("+&
DIC
"('77"(#( "#(!<BAAL :!#)'=7
DID
HH
;@<
.) 3&$ <C & " @C & *%
;@=
&# ' %#! >2=3 " <3 !1 %&$') ,2 ,!$ "# " &$ "
;@>
&" &(&$"&#"&("%*"'"')& '#"(&","&5")'%#"6
;@?
5#%".)<C &1'>9"'3:=!*&61# #*,$#&')
;@@
& '#"&'$(&">:!%#&5 '",62.)<C"4#%@C &
;@A
598? &6*% ('":88D ""'2)2"'#%$"'!2#%
;A8
&#! +$%!"'& $(% & *% &'" *' " % # '
;A9
5")'%#"6 #% "'#"2 $(%', # ' &(&'& *& )% , #*
;A:
,'#!'%,"%"%#!@A2;B'#A>2AB2
;A;
;A<
*%&&&& ,#%"(%# # &"&
;A=
" *' #&&2 (!#% &- *& '%!" )%, #'% , , !&(%"
;A>
$%$"( %!'%&1(&"%"% $%"+$%&&"!!:5*+62
;A?
"'37< "'%" "'#, 53: #"1 " , $%#) , 2 " %'1 %"
;A@
")%&',6*&"'2)2:=8D4"'#"4!#(&''"''!$#"'&2
;AA
<88
*%&%"'%&$ "&"
<89
%"" ,!$"#&*%%)&'''"''!$#"'&2'&&(&*%
<8:
&!& " % ## & *% ,& (&" ,&& (% 5829= <1 9!
<8;
;1829!:182=:1(&''#$?2:62
<8<
# &# ' " !!'#%, & %#! ' 1 ! *% $%(& *' 2 %"&
<8=
"&$" #%&*%&&'1&!&"(%'%&'*'# "&
<8>
5#1 :!4! 6 " (! 9><8 5")'%#"61 & 5#1 82:!4! 6
?@ 95<
" //#&+ // +&" #%#!'+ '#" +%# #% 1, !,
95=
5.57!0! 2 #% 85/95 !"('& ' 8<?. '% *&" &'$, !#"#"( % &
95>
*%# '# #*"$%# %"'&$%'#".
965
#%&# '#"#'(!#%/" '%'" &,''(!#%*&&&',('"7!!$&
966
" "(' " # "& 1#, 7!0! 2 " (! 6;95, & 967
15.7!0! 2#%85!"('&'8<?.'%*&"&'$,''(!#%&*% (%'%
968
&!&, '%""'%(.
969
96:
/"'(!#%/" '%'" &&* &&$ "" +!$ "#
96;
& *% &'" (&" ' # #*" "'#&- "'/+6.7 1:8/7.6, 96<
#&"2, "'/9:.7 1659, #&"2, "'/9:.6 175, #"2, "'/
96=
9: 185/66, #&"2, "'/= 16:;.<.<, #"2, "'/9
96>
19.:, #&"2, "'/66 160<5, #&"2, "'//
975
1:0669.6:.7, #&"2, "'/99 1
<, #&"2, "'/7: 1;6.:,
976
#&"2, "'/+; 1/76, #"2, "'/6 106, #"2,
977
"'/67<106>>,#&"2,"'/
416.7,#&"2,"'//
978
31;/77,#&"2,"'//16/77>,#&"2,""'/
/
979
6<166/6=65,#&"2.
97:
$%# %'#" # 9:.6/#"" /&$ & " &#"%+ +!$#
97;
#%"& *& ) (' '%#( ('#" # " % # '. '#" +,
97<
'%&'!( '#"(&"1!,6@ 0!2,#"#!+"1!,7@ 0!2"# 97=
$ ( 1 '%, 7@ 0!2 #% 9 #(%&, & *% &'" *' "'/
/4
97>
16.72""'//31;/772"'#&.
<>
<;8
) ,' $!!) $# $' $')(( 5)$# #($#6 # #!./
<;9
,)!$,$($),'5')'62
<;:
<;;
,'%'*(,)$!!$,.<B2((*(,'
<;<
'"$+#"#%'#2
""*#$()$"!()##,(%'$'"
<;=
$# =3C"3) ('! ()$#( *(# ) $!!$,# (1 #)3; 591:880 ?0
<;>
.)$"60 #)3; 591:880 60 #)3'#/." 591:=0 #) '*/60 #)3@
<;?
591=8880 $(#(60 #)3< 591:=80 $(#(62 ($#'. #)$(
<;@
*( ,' $)#.!) #)3') # #)3') #)$( 5 ($#6 $!!$, .
<;A
+#3%'$-( 5"62 )##( ,' +!$% ,) ;0;73"#$#/#
<<8
562$*#))#*"'$!!(#)'."))'$)(%#!$'0)
<<9
%%$"%*( # ) .%$)!"*(0 # &*#) ) %'$%$')$# $ !!( #
<<:
')$#)))$#*'$#2
<<;
<<<
$ (((( -%'(($#0 )$)! ,( -)') ,) (. # )
<<=
5*#60$!!$,.'+'()'#('%)$#5*%''%)
62"-%'(($#
<<>
,( #$'"!/ )$ "2 $!!$,# %'"'( ,' *( )$ "%!. <<?
5$','
<<@
3;460
<<A
=43;40+'(=433;462
<=8
=433;40
#
+'(
=43
5$','
<=9
'#( ),# ),$ ()( $ ) ,' +!*) . <=:
##3)#. )()2 *!)%! $"%'($# ) ,' #!./ *(# ) '*( !3
@8 342
# .! #$-$#$ %/, " $% " #*+ $ '" )* %# $ $' -')
343
.! #$ $#$ "" /, %"&& '# )* ) - $#$ .
$-
344
(/,)##'"!" " "#5."! $'"/," %!#'"
345
#"#$$#$)"$$!-&% 90,04,$"!"#$#$
346
8
,
71
"%&.## &, %%%!%&)+ )-#,# %',+*&%+
$%,*) '+%##+'&'#++')&- ')+ #&) %+##+,##'8,)+)
+%" + +% # ** *+% ')&- 0 + $911) :( 9# -6 #2) ,'#%9 % %%9,) * )&$ &,) 0+&$+)0 # +06 #) " 3"6
) %% **)%%#,)0)&$+%+)&)) %*) % %%%
# #&,1+6 2&) $'0& % + # '%"& )&$ + % $# # +0
;;>&)+" %)&+% $#*8
* .&)" .* *,''&)+ 0 )%+* )&$ ?99=;<=99,)&" %6 9
#+)96&%+ &%% ,)2 &%#&%+)#%)8
) *+ % ,)7 /') $%+# * %6 ')&)$ + /') $%+*6 # &)'06
.) + %$%,*) '+
+) %&#+7 /') $%+# * %6 ')&)$ + /') $%+*6 # &)'06
.) + %$%,*) '+
* 7#'. +/') $%+*%)- .+$%,*) '+
$ # ,)27#'. +/') $%+*
%,)7')&)$%,)&'+&#&0/') $%+*%)- .+$%,*) '+
&#% #,7/') $%+#* %6 %+)')++ &%&++6.) + %$%,*) '+
@= @9
%&.6.+'.16(+(':+(6(,'+9!1)+,,"('(-!.
=)+'()%,-"')!%(&2%"-",;,',(+2'.+('()-!2>'-" '"'!.&''(+&%
'-.&(+-",,.,9&-!(%@HHA7@C@8GG@<E9
A9
" '(%-6.+6"%.9
&&.'()-!( ',",()+'()%,-"
'.+(%( "%,2'+(&,,,("-0"-!'-":.'-"(",8'""%'-"-.&(+
"&&.'+,)(', ("' 0+29'("&&.'(%( 2A?@B7A8AFBGC9
B9
%&.6(,'%9+'()%,-",2'+(&,(-!9'-.+(%A??G7
F8BAF<C?9
C9
%&.6.+'.16+%%6+",6(,'+9--"('(-!'-":.
'-"(2"'-!,+.&()-"'-,0"-!,&%%%%%.' '+::*.'-"--"/0,-+'
%(-'%2,",9''.+(%@HH?7AF8DCC<DA9
D9
(%"'./(6+.,6++'(646.+++(6
%%
9-"%"-2('-":.
'-"(","'-!" '(,",()+'()%,-",',(+2'.+()-!29''.+(%@HHG7
CC8HFE<G?9
E9
%&.6.3.'6.6,#.'6(,,"6(%(,!"'6!+"' 6!"&3$"6
("6"' 6-%9+'()%,-"'-"::&-!2%::,)+--+)-(+')!%"-",
,,("-0"-!(/+"'-+-(&9''.+(%A??F7E@8AD<BE9
F9
+.,6' 6(3(:(,"!6"36,&"-#'6"''-9;-2)%".&:
!''%'-"(","')+'()%,-"+%%+ '+-"('0"-!%.' '+9
.+(%( 2A??A7DH8FEC<E9
G9
'$6'$6'(+6,.#"9+"%-(,-%",!''"&%&(%(
)+'()%,-"+%%+ '+-"('0"-!'-":('-"(29@9(.,,-+"',
GC '$'$)#%"*"(&'%*$)%(%$##*$.)%$,)
'%#$$)%&'%)$3*)%$%)*(*'!$ """%((6"$*'%"*'%(*'
:BB>4B@5B>8:996
B6
$-3"*3'"7/'"3%*'$3"#*3"))'6""7#)
*)%##*$)-$&'$%&"()$*'%"%"(-$'%#(,)$)7*$)%(6$$
*'%":BBB4=>5:?;8@6
:96 %')(3"*
3%#(3!3""#(3*!"-3%*(#$(3%($'
3'$""6)$)(,)"*$$'$&'$%&"()*(-$'%#'%'
*7(&)-&;AC""(6"$
$+();99B4::B5;9=;8>:6
::6 "')3*()$3'$""6))%$$)')#$)%)+)""($)
''%(&$""*%&)$)(,)&'$%&"()'""'$')%$6$$
*'%";9994=@5B8:@6
:;6 %*((*3$-3"#*3%$$$3*"")73"))'73%&&$6""
'(&%$()%*7&&)($&)$)(,)$)7*(-$'%#6*'%%$%";99>4
@:5;<:8?6
:<6 $3$$)3'$))3!'3"0#!
3'*(3""$'3*((3
")3""3)"6
##*$%&)%"%-%*)%$)%-7((%)
$&")(5"*(%'&)%$((6'$;9:;4:<>5:?;;8<A6
:=6 '$"3'*(3''/3.3$-3")6
##*$%()%#"
$"-((%$)7*7((%)&'$%&"()$&"%#-")(6)*'%&)%"
;99;4:9<5>9B8:>6
:>6 $3"#*3%3%($'3$3"#*3%6$"-((%)
(*"((()'*)%$$$"##)%'-$")')($&)$)(,)$)7*7((%)
&'$%&"()$&"%#-")(6*'%"%-:BB=4==5:=98@6
A>
@E; '$+08$%,8'*&)8'*&$;<$$)(+')&$/*!*!&&+!<,
**'!+()&'($*+!&( $'%/$!+!*;,)'$'/@HHG9D@:@@CE>D?;
@F; ,/8),*88&18$++);
&+)-&',*!%%,&'$',$!&
+)+%&+!&()&'($*+!&,)'$'!$*/&)'%*.!+ &+!&,)'&$
,+'&+!'!*;,)'$,)'*,)*/ !+)/@HHE9E?:BGG>HA;
@G; %*=!$!8)#&*8,.8&&&+8''!"#*8&)'$+8
+8!$$-!*%!++;)&'($*+!)$$)&)+!'&**'!+.!+ &+!&,)'&$&+!'!*:&$/*!*'D?(+!&+*;)!&A??B9@AE:@C?H>@G;
@H; ),*88$++)8'&-&+,)
8218)!08'$'*;
$*%( )*!*&&+!&'($*+!+)+%&+!&()&'($*+!*/&)'%*.!+ &+!&,)'&$,+'&+!'!*;,)'$'/@HHA9CA:DBE>C?;
A?; !$$-!*%!++8&$/8'*&);
%%,&!0+!'&.!+ + ()&'($*+!
&( $'%/$!+!*&+!&,'*&'+,*&,)'$'!!**!&%!;,)'$'/
@HHD9CD:@GFB>G;
A@; )(&+!)8'*&$8$++)8 $&8'*&)8$%,;
-!&+!'&.!+ ,!& !!+*)'.+ '&,)'$*+'%!&%!;$!&&)*
@HHG9C:AG@H>AC;
AA; $$#')8 ,)+83+))8 ,+08&/8 4$$)8**%&&8
' $$8'$+08!&!&+'&;'$$!&()&'($*+!!**:<$$**(!!
')+ '&'&,)'&$&+!&@%!+,+'!%%,&&( $'%/$!+!*!&+ )+;)!&A??C9@AF:@GAA>B?;
AB; $ )8)&8&+'%**'8')&)8''8))8#8'&++8
&+%&8)+$;$$*+)+!&&,)'&$()&'($*+!&+!&
%!++,%'))"+!'&&+)!),+'!%%,&!+/.!+ ,%')$+!-+!'&;,)
GE %%,&'$><=@3@@4?>@<7A=5
>@5 ')&2!$,2'++2$#2-!++2)-+&!#2'2 )%&5
D8F9$$6%!+*('&+&',*!+*!&&'&+$%!5
%%,&'$=EEB3
=AC4ECD7D?5
>A5 ))'*2,)2!!'2!$,2**%&&5+!-&*$+!-!%%,&
*,)-!$$&'+ )!&0$**
6)*+)!+0+'+'/!$0%( '0+*5,)
%%,&'$><<?3??4==C@7D>5
>B5 !))2)'&2#'2'$!)"$!&&2-'&' %)5 0%!*$+!'&
'DF*!&$('*!+!-$$*.!+ $**
%"') !*+''%(+!!$!+0'%($/6
)*+)!+)(+')5/(=EE@3=D<4>A7?@5
>C5 !#$2!&'$+2$)2*'!*2!*'&2%1#!2',!2,)2
**%&&2)!&6',1+2+$5,++!&4&,)'&$)'&!+!'&0D$$*
$!!+*&+)$!+*!&*!(!,*5
%%,&'$><=>3=DD4@C?=7A5
>D5 ,)+,$,*2)!(+ !2!$%&5)'++!&&)*,!&+ +')*4'$*'
!)&+!+!'&&*,)-!-$!&+ '&+)'$'%%')0$$-$'(%&+5)'&+5
%%,&'$5><=>3?5
>E5 !$02 !&!2!++%)2,#)6)2''&2&#!&*2) $2
!&*$'.2''$&5!*+!&+,&+!'&*'&+!&6*(!!@$$*,)!&
%,)!&0'+)!,%+,),$'*!*!&+!'&5)'+$!><=<3
=<C4=E@<D7=?5
?<5 &'#2&&'&2)!+12& 16)!2+!&%&+2)!&5)-&+!'&'
/()!%&+$,+'!%%,&&( $'%0$!+!*0&+!'!*!&*+:@;=!&+)!&5
+,)=EE>3?AB4B?7B5
?=5 )+!&6$'&$2!&'$+2!+12* !!2,)2)!&+2&!&&
2
DC
!))2#!')2!*5')$#$#%!)$#I!!(#)$)
#)'!#'+$*((.()"(%##)$#)?E@B6#)'#5*'
""*#$!CABF3
EF4DDAC:BC5
DC5 '#
2'2!+'/
2'*2'#'2$*'$##0'2$''2
*&*))2!$)2'$*'2)!5#)'!#'+$*((.()"''*)"#)$)$'
""$'.IK!."%$.)(*'##*'$#!"")$#(%##)$#?E#)'#5
'#CABB3BDE4DFGA:HH5
DD5 #$ 2##$#2')/2#/6'2)#"#2'#5'+#)$#$
-%'"#)!*)$""*##%!$".!)(.#)$(#()!%E)B
#)'#5)*'BJJC3DFG4GD:G5
DE5 2' ,2),22'$(5
#*)$#$.)$)$-!."%$.)(
(%$'%'#$%!()'!!'#')$#6(($)#)##++$.
""*#/)$#5*)$""*#CAAB3BH4CJH:DAC5
DF5 '/$2##'2 2'!#'2$!!#(2$#($#2$))5*"$'6
(%EK!!(+"$'7%$()6!#(#8'$!#")#)6)*"$'
""*#).5
""*#$!CAAA3BGF4GAEH:FF5
DG5 $(2'"#5EK6!!!%#))*"$'"!*('&*'$'''*)"#)
#.)$!.)*#)$#$IK!."%$.)(5#'(CABA3HA4IDGI:HH5
DH5 *')(2'$#2'##2!#(2!!($#2)2!!'5EK!!
!%"%'(IK!!!)$##*.'$((6%'(#))$#$(!6#)#(#
+$'(*)$""*#).5-%=
#)'#)>BJJH3BIG4CAFH:GC5+!!'$"4
%%'(C499%*!)$#9**9JEIFFJH6IA6EFAG6JBFG6CGGBHBE
DI5 !,2')25"*!))'$!$E;K<!!(#I;K<!!
""$'.5)+
""*#$!CABG3BG4BAC:BB5
II ;A5 -**2,1!&*5!$6+% &!+%'*%!&,!&!&+$6,'$*&5/(
9AA:39?>4==;7><5
<85 '*+ !&2$!2 -
2!'$62*(&,*2'$$*2! '$+'&2
%!2 2-62,$5@$$'$*&,'-%'*6++'!,$6
&,!&
+.*+0<$$+&!&*'/(*++, %$$(,'*5
%%-&'$:89=39A<498@87A5
<95 !'*!'2'.*2**2&'++2*&$$!2('&,!2,& $$!&!2
'&!&!2(($$'2&',,2,$5&,!6-6!&-&-*'&$('(,'+!+
-&*$0!&(*&'($+,!-,0+%',!$!,05+,*'&,*'$'0:88;39:=4?87A5
<:5 *-##*2!"2!"&&,+2*#
2+(*+5*&'($+,!
+,*'6!&,+,!&$&,!6-+0&*'%!&&-*'$+,'%5!,*$''&*:88A3
=:4;A>7@5
<;5 .*&2!#*2-&2!+ '(2-6*-& -,20*2&1$*5 *,%+)-**'%$!&&04 *'&!!&,+,!&$(+-'6'+,*-,!'&5!'%*#+
:89<3:4:;5
@A
$%-
$%-
$($,
&$
!.("
$%
&$ !.)"
$%
&%&,
&'$
&'$
&'$-&-
&'$-)-
&'$-)-
&'$-&-
% among Thy1.2+ CD45.1+ T cells
100
divided cells
divided IFN-γ+ cells
**
***
80
**
**
60
40
20
0
CD4+ T cells
CD8+ T cells
CD4+ T cells
4T1-HA
CD8+ T cells
4T1
40
****
0
0
5
10
15
days post-injection
20
80
60
40
****
ns
****
20
% of tumor - free animals
60
****
Tumor surface (mm2)
100
80
20
0
0
5
10
15
20
days post-injection
! "$#$
9:/6?7:0;7
? 9? % 65< &$ !& 230%& 0%"
9:/6?;7
? =? % &! )0&+" 23 $ &$ & 960 !$ &
96 &'!$/ & + ;- %" $ +" ! % )$ %&'& )&
1! !+ !$
9
!'$%/
+%%
)%
"$!$
&!
%%%%
"$!$&! 1'!$% & + '&! "$!'&! ! 0γ 0α + &
&$ %$$ 9:/6? %/ "$% &&( "!&% ! %" !+&% $! !'%
$$+ &$ & 960 2&3 !$ 96 2$&3 &'!$/ $#' + ! 0γ0"$!' 9:/6? 9? !$ 9:/6? =? % & %" / !! & $! 8 " &
*"$ &%-&$"$% && @!=)&960 <)&96
&'!$%/
0& +-44"B5/56/0$ &960&'!$$(&$
! %- ( 0%" 9:/6?7:0;7
? 9? % 265<3- ( 0%"
9:/6?;7
?=?%265<3-!$!&&+"%!%265<3/!!&$!8
" & *"$ &% $ %!) / &. &'!$ %,- (' $"$% &% & @
!&$!'"/)!0)+-4444"B5/5556/&."$ &!&'!$0$ %/
!0$ 2 &0!*3&%&- %A !&% &-4444"B5/5556/
>6
****
10
5
5
0
-5
-10
ns
-15
-20
0
-5
-10
-20
-25
-30
-30
-35
-35
!
!
!
ns
-15
-25
****
15
10
% weight loss
% weight loss
15
!
!
!
!
"#
!#
! "!'!#+*+.(
!&.202&
.+&.+$.+&%
'3
(-"!%&$4
$))))5*%***+%"!!.+&&
& $#&.2'+*/($#&
02'+*/(#'+*/(%
!'(%'3
(-"
!%&$4$))))5*%***+%
1, " #!
$
%#) &
&( %# ) $ %# ) &!
"!
"
& %# ) $ & '$
+*0/8+#$ %$!%$7
" +*0/8+#$
,2"!
+ * 4/ 8+ #$ 5 " $# $ + * 4/ 8+ #$ ! $
$ ,2 , $ + * 1/ 8+ #$ ",2 , +*1/8+
10
10
10
5
10
4
10
3
10
0
-10
-10
-10
3
0
10
3
10
4
10
4
10
10
3
10
****
4
3
3
5
-10
3
0
10
3
10
4
-10
10
3
5
-10
3
0
10
3
10
4
10
5
8
6
4
ns
2
10
5
10
4
10
98.4
10
3
10
4
10
1.14
10
10
21.4
3
-10
-10
3
0
10
3
10
4
10
ns
2
0
0
3
4
4
78.1
3
6
5
3.80
95.9
0
-10
5
8
0
0
10
****
10
10
5
0
0
3
5
# CD45highCD11bhigh cells (x104)
# Thy1.2+CD45high cells (x104)
3
5
-10
-10
3
0
10
3
10
4
10
5
3
-10
3
0
10
3
10
4
10
5
31.2%
150
100
18.1%
46.8%
CD45.1+ CD4+ T cells
CD45.1+ CD8+ T cells
CD45.1- CD4+ T cells
CD45.1- CD8+ T cells
81.4
50
0
-10
3
0
10
3
10
4
10
5
relative fold increase
of MHCII
3.9%
25
20
15
10
5
0
CamK-HA (n=8)
WT (n=4)
&!&%""
" ! ! &! , 34+07 37 34+07
57,30,30 )
30, + $ " " $ 0/ 03+#$$00340034,!
$ - ". $0+1734 - ". !$
-34+07. -34+0,.! +#$ $0+17340034
63 / $"!"#$#&%-"#$$>/
$
" 7 !$ (!"$#- "%#0#- #? $ #$- 4444!@5/5556/ #$"%$ 0$"$# "$ 8$ "#.$"#""8=#-
$"#"";=#- %#8=# " %#;=#2?<
0
3/ $. ## (!"## " 26689$3 "!"#$$& 0 %#/ $. $& "# ## (!"## 02-?;32")-?83/
transferred CD4
transferred CD8
75
100
ns
CNS (n=10)
Tumor (n=5)
Spleen (n=10)
50
25
**
10
**
ns
5
% among Thy1.2+
CD45.1+ CD4+ T cells
% among Thy1.2+
CD45.1+ CD8+ T cells
100
***
75
**
50
**
25
10
5
0
0
IFNγ+TNFα+
GM-CSF+
IFNγ+TNFα+
IL-17A+
100
CNS (n=10)
Tumor (n=5)
Spleen (n=10)
50
***
*
10
***
*
5
% among Thy1.2+
CD45.1- CD4+ T cells
% among Thy1.2+
CD45.1- CD8+ T cells
**
25
GM-CSF+
IL-17A+
endogenous CD4
endogenous CD8
100
75
**
*
75
***
*
50
**
****
25
10
***
5
0
0
IFNγ+TNFα+
GM-CSF+
IL-17A+
IFNγ+TNFα+
GM-CSF+
IL-17A+
!$&$"#" *&0#!89/6=8=#;=#$ 0
"$860$% "/)##'#!" " #" -$% "-
#! '1 )#$%$ $')6568/!" ! "$ #
$"#"" 89/6= ;= 2%!!" $3- $"#"" 89/6= 8= 2%!!" "$3-
%#89/60;=2 '"$3 %#89/608=2 '""$3#
$-$% "#!$$(!"##0γ0α-0 "06:"! $$/
$" 7!$(!"$#- &%#" !
8 "
<9
!* # ! !"# # < , !$"-"* 0 >1,16*
00
>1,12*
000 >1,112*
0000 >1,1112
transferred CD8
transferred CD4
*
CNS (n=8)
TUMOR (n=3)
SPLEEN (n=8)
% among Thy1.2+
CD45.1+ CD8 +T cells
80
60
**
*
ns
40
20
**
100
% among Thy1.2+
CD45.1+ CD4 +T cells
*
100
80
60
40
***
20
20
*
10
0
0
CD44highCD62Llow
KLRG1highCD127low
CD44highCD62Llow
CD44highCD62Lhigh
endogenous CD8
80
*
**
40
*
*
20
*
100
% among Thy1.2+
CD45.1- CD4+ T cells
% among Thy1.2+
CD45.1- CD8 +T cells
CNS (n=8)
TUMOR (n=3)
SPLEEN (n=8)
*
60
CD44highCD62Lhigh
endogenous CD4
**
100
KLRG1highCD127low
80
60
**
40
**
20
20
ns
10
0
0
CD44highCD62Llow
KLRG1highCD127low
CD44highCD62Lhigh
CD44highCD62Llow
KLRG1highCD127low
CD44highCD62Lhigh
- &!
$#% ""!$!"5)6,(""#.=9/*#$!
.=4/" .=9/## #"", !"# ! !#
56,2; 9; .$
! #/* 56,2; 5; .$
! !#/* $" 56,2-
9;.&!#/$"56,2-5;.&!!#/"#*#$!
" , !! 55* 73
* 2 238 &! """" # #( #! ".5573
&/*#!!(".5573
/!9;"+
"!#-%#!"!5;"+#!(!##'$"#"
.
2238&/, # . < / ! 3 # ' !#"* %$!%"! 5!!,!$"-"*0 >1,16*00 >1,12
:7 15
10
% weight loss
5
0
-5
-10
-15
-20
-25
ns
IgG (n=16)
PS/2 (n=15)
ns
3.0
# T cells in the CNS
2.5
2.0
ns
1.5
1.0
0.5
-30
-35
0.0
Thy1.2+CD45.1-
Thy1.2+CD45.1+
$ α # )#! "
! . 0( )α0 +*., # ("(
"%!% 2 ( "!'
6 ( / $ ' )
%'7 !"
$# #! %-.(!" -.'
) # %& % # % %( ! ! %-(.501(-)%-(.501(-5#(
43
400
1.5K
300
98.2
93.5
1.0K
200
100
0
500
0
10
0
10
1
10
2
10
3
10
4
10
0
10
1
10
2
10
3
10
4
tumor surface (mm2)
150
4T1-HA (n=6)
4T1 (n=6)
100
50
0
0
5
10
15
20
25
days post-injection
! ! $
+)&
+)
% $ +)
+)&% +) '! # /,( +)& '
# /,( &! ! % *) !% " '*(
!%
.- 0.8
ΔΔCp
0.6
0.4
0.2
S
m
C
N
m
nu
ju
je
Tg
um
nu
en
ju
W
T
je
od
du
Tg
um
ac
en
om
od
T
du
st
W
Tg
T
W
Tg
st
om
ac
h
h
0.0
#
$ ) 0.)
$ )01(.40401(.424!
# .- #( !" ) ) ( !" " '
#*' +5/, ) +50, !
"( !" # )
!(
33
1.2
# Thy1.2+CD45.1- T cells (x10^4)
# Thy1.2+CD45.1+ T cells (x10^4)
**
1.0
0.8
0.6
0.4
0.2
0.0
D10-14 (n=15)
n.s.
1.2
1.0
0.8
0.6
0.4
0.2
0.0
D21 (n=5)
D10-14 (n=15)
D21 (n=5)
reinjection of 4T1-HA + CD4 and CD8 T cells
reinjection of 4T1-HA
reinjection of 4T1-HA
1.2
# Thy1.2+CD45.1- T cells (x104)
# Thy1.2+CD45.1+ T cells (x104)
reinjection of 4T1-HA + CD4 and CD8 T cells
1.0
n.s.
0.8
0.6
0.4
0.2
0.0
D39 (n=7)
D39 (n=7)
1.2
1.0
n.s.
0.8
0.6
0.4
0.2
0.0
D39 (n=7)
D39 (n=7)
" ('-&*+%(/)+&,)/*/('-&
*+%(/,)/./ & *(& !%
##! )($%# #$('
(* )(& # #$ $%! #"!$!!*%! !
$(%)/*+%(/ )(%! !!$(%)/*+%(& )(%
(''
&#&!!-##25咔-#$!"&#!
&#$# 218 -" 56,2;36-73; 5; " 218 -" 56,2;73;9;",-#!#"&!()#4:$"&
(##!( "$# $!" (2,3;56,2; " # 4:, "$#$!"$"(2,3;56,2-"#4:,#! !"#"
%$ + !" # # < + -#( #"#+ "=#
"#+00 >1,12
% CD25+ cells
among CD44+CD62L- cells
100
**
**
*
***
*
*
CD4
CD8
CNS (n=8)
TUMOR (n=3)
SPLEEN (n=8)
80
60
40
20
0
CD4
CD8
Thy1.2+CD45.1+
Thy1.2+CD45.1-
" !#-&!$#% ""!$!"5*6
("" # .=9/+ #$! .=4/ " .=9/ &! !!
#& ( 21 25, ! !#" 56,2; 9;+ 56,2;
5;+$"56,2-9;$"56,2-5;"#+#$!
" ##' !""36! ##,#.<
/!3 #
' !#"+ %$ !%" ! 5 ! !, !$"-"+
0 >1,16+00 >1,12+000 >1,112
212
#
' ("
%&
!
&$)"
"
&"
%$&
'& '!&$ &!$&$
!$! & " !& ! & ! !#!& !(
#&!!
!&+)*-
*),
Brain Advance Access published September 6, 2016
doi:10.1093/brain/aww225
BRAIN 2016: Page 1 of 12
| 1
CTLA4 blockade elicits paraneoplastic
neurological disease in a mouse model
Lidia M. Yshii,1,2 Christina M. Gebauer,1,* Béatrice Pignolet,1,3,* Emilie Mauré,1
Clémence Quériault,1 Mandy Pierau,4 Hiromitsu Saito,5 Noboru Suzuki,5
Monika Brunner-Weinzierl,4 Jan Bauer6 and Roland Liblau1
These authors contributed equally to this work.
CTLA4 is an inhibitory regulator of immune responses. Therapeutic CTLA4 blockade enhances T cell responses against cancer
and provides striking clinical results against advanced melanoma. However, this therapy is associated with immune-related adverse
events. Paraneoplastic neurologic disorders are immune-mediated neurological diseases that develop in the setting of malignancy.
The target onconeural antigens are expressed physiologically by neurons, and aberrantly by certain tumour cells. These tumourassociated antigens can be presented to T cells, generating an antigen-specific immune response that leads to autoimmunity within
the nervous system. To investigate the risk to develop paraneoplastic neurologic disorder after CTLA4 blockade, we generated a
mouse model of paraneoplastic neurologic disorder that expresses a neo-self antigen both in Purkinje neurons and in implanted
breast tumour cells. Immune checkpoint therapy with anti-CTLA4 monoclonal antibody in this mouse model elicited antigenspecific T cell migration into the cerebellum, and significant neuroinflammation and paraneoplastic neurologic disorder developed
only after anti-CTLA4 monoclonal antibody treatment. Moreover, our data strongly suggest that CD8 + T cells play a final effector
role by killing the Purkinje neurons. Taken together, we recommend heightened caution when using CTLA4 blockade in patients
with gynaecological cancers, or malignancies of neuroectodermal origin, such as small cell lung cancer, as such treatment may
promote paraneoplastic neurologic disorders.
1 INSERM UMR U1043 - CNRS U5282, Université de Toulouse, UPS, Centre de Physiopathologie de Toulouse Purpan, Toulouse,
31300, France
2 Department of Pharmacology, Institute of Biomedical Sciences I, University of São Paulo, 05508-900, Brazil
3 Department of Clinical Neurosciences, Toulouse University Hospital, 31059, France
4 Department of Experimental Paediatrics, University Hospital, Otto-von-Guericke University Magdeburg, 39120, Germany
5 Department of Animal Genomics, Functional Genomics Institute, Mie University Life Science Research Center, 2-174 Edobashi,
Tsu, Mie 514-8507, Japan
6 Department of Neuroimmunology, Center for Brain Research, Medical University of Vienna, A-1090, Austria
Correspondence to: Roland Liblau, MD, PhD,
Centre de Physiopathologie de Toulouse, Purpan Hospital, Place du Docteur Baylac TSA
40031, 31059 Toulouse Cedex 9, France
E-mail: [email protected]
Keywords: paraneoplastic neurological disorder; CTLA4; immunotherapy; Purkinje cells; neuroinflammation
Abbreviations: HA = haemagglutinin; mAb = monoclonal antibody
Received April 15, 2016. Revised July 21, 2016. Accepted July 21, 2016.
ß The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved.
For Permissions, please email: [email protected]
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
*
2
| BRAIN 2016: Page 2 of 12
Introduction
in cerebellar Purkinje cells and in an implanted breast
tumour. Using this in vivo setting, we assessed the impact
of anti-CTLA4 therapy on development of paraneoplastic
neurological disorder.
Materials and methods
Mice
6.5-TCR mice, CL4-TCR mice, L7-Cre, Mog-HA, and the
Rosa-Stop-HA (Rosa26rtm(HA)1Lib) mice have been described
elsewhere (Kirberg et al., 1994; Morgan et al., 1996; Saito
et al., 2005; Saxena et al., 2008). L7-Cre mice were backcrossed at least six times on the BALB/c background. We obtained the L7-HA mice by crossing L7-Cre with Rosa-Stop-HA
mice. Mice were kept in specific pathogen-free conditions
within the UMS006 animal facility, Toulouse, France. All procedures involving animals were in accordance with the
European Union guidelines following approval by the local
ethics committee.
Reverse transcription polymerase
chain reaction
To assess influenza virus haemagglutinin (HA) expression,
Õ
total RNA was extracted with TRIzol (Life), followed by reÕ
verse transcription (SuperScript III, Invitrogen). The cDNA
Õ
was used as template for quantitative PCR using SYBR
Green I master mix (Roche) on a LightCycler 480 thermocycler (Roche). The following primers were used to amplify HA
(forward 5’AAACTCTTCGCGGTCTTTCCA 3’, reverse 5’
GATAAGGTAGCTTGGGCTGC 3’), Ctla4 (forward 5’GCT
TCCTAGATTA CCCCTTCTGC 3’, reverse 5’ CGGGCAT
GGTTCTGGATCA 3’), and Hprt (forward 5’ TTGCTCGAG
ATGTCATGAAGGA 3’, reverse 5’ TGAGAGATCATCT CCA
CCAATAACTT 3’). HA mRNA expression was normalized to
Hprt mRNA.
Cell line and tumour implantation
The BALB/c mouse 4T1 breast cancer cell line and its 4T1-HA
derivative that expresses HA (a gift from D. Klatzman) were
cultured as described (Aslakson and Miller, 1992). 4T1 or
4T1-HA cells (105) were injected subcutaneously into the left
flank of mice. Tumours were measured with a Vernier calliper
daily for 20 days, and the tumour size (w l) is expressed as
mm2.
Haemagglutinin-specific T cells
Naive HA-specific CD4 + and CD8 + T cells were purified from
6.5-TCR and CL4-TCR mice, respectively. Spleens and lymph
nodes were collected and T cells were purified (Dynabeads
Untouched Mouse CD4 + or CD8 + Cells kit; Invitrogen).
CD4 + T cells were incubated with anti-CD25 (clone PC61)
monoclonal antibody (mAb) for Treg depletion. Naive T
cells were further purified based on expression of CD62L
(Miltenyi Biotech). Naive CD4 + and CD8 + T cells (107
each), depleted of Tregs, were injected intravenously into the
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Paraneoplastic neurological disorders are immune-mediated
diseases that develop in the setting of malignancy and offer
a unique prospect to analyse the interplay between tumour
immunity and autoimmune disease (Albert and Darnell,
2004; Steinman, 2014). In paraneoplastic neurological disorders, the pathogenic adaptive immune response targets
proteins, so-called onconeural antigens, normally expressed
by neurons and aberrantly expressed by tumour cells
(Furneaux et al., 1990). Highly specific anti-neuronal autoantibodies in the serum and CSF represent key diagnostic
biomarkers. When these autoantibodies recognize cell surface antigens, they most likely contribute to pathogenicity
(Tuzun et al., 2009; Graus et al., 2010). In contrast, when
onconeural antigens are localized intracellularly, T cells
provide a beneficial anti-tumoural response but are implicated in inducing the deleterious autoimmune neurological
reaction (Pellkofer et al., 2004; Pignolet et al., 2013).
Paraneoplastic cerebellar degeneration, characterized by
the selective loss of Purkinje neurons in the cerebellum, is
an illustrative example of paraneoplastic neurological disorder targeting intracellular neuronal antigens (Albert et al.,
1998). Paraneoplastic cerebellar degeneration develops, in
particular, in patients with gynaecologic carcinomas that
express the Purkinje neuron-specific CDR2 protein, with
small cell lung cancer that expresses the neuronal HuD
protein, or with testicular cancer that expresses the Ma2
antigen (Mason et al., 1997; Albert et al., 1998; Dalmau
et al., 2004).
Cytotoxic T lymphocyte-associated antigen 4 (CTLA4) is
expressed transiently following activation of conventional T
cells, and constitutively by regulatory T cells (Tregs). This
receptor has a crucial role in limiting T cell responses
(Allison, 2015). Therefore, therapeutic blockade of
CTLA4 with antibodies has been tested to enhance antitumour immunity, and proved to be efficient in murine
cancer models (Leach et al., 1996). This has led to the
clinical development of anti-CTLA4 antibody (ipilimumab)
as immunotherapy in patients with advanced melanoma or
other carcinomas (Hodi et al., 2010; Robert et al., 2011).
The benefit of this therapy for tumour control and survival
has since been confirmed. Collectively, immune checkpoint
inhibitors, and their combination, have revolutionized the
field of cancer immunotherapy (Allison, 2015). However,
anti-CTLA4 therapy is associated with a high frequency of
immune-related adverse events, notably autoimmune hypophysitis (Bertrand et al., 2015).
Patients affected with gynaecological cancers, or malignancies of neuroectodermal origin, such as small cell lung
cancer, are particularly prone to develop paraneoplastic
neurological disorders. We, therefore, sought to investigate
whether the risk to develop paraneoplastic neurological disorder of autoimmune nature could be enhanced by antiCTLA4 therapy. To test this hypothesis, we generated a
mouse system in which the same model antigen is expressed
L. M. Yshii et al.
Paraneoplastic neurological disorder
mice. Mice were assessed daily for weight and neurological
signs.
Anti-CTLA4 and anti-CD8 treatment
For in vivo antibody therapy, the hamster anti-mouse CTLA4
mAb (UC10-4F10-11) was produced by culturing hybridoma
cell lines in RPMI 1640 supplemented with low IgG foetal
bovine serum. Antibodies were purified from supernatants
using protein G purification (GE Healthcare). Mice were treated through intraperitoneal injections of anti-CTLA4 mAb
(100 mg/mouse) at Days 1, 0, 2, 4, 6, 8, 10, 12, 14 and
16. In one experiment, depleting anti-CD8 mAb (53.6.7) or
control IgG (200 mg/mouse) were injected intraperitoneally at
Days 7, 9, 11, 13, 15, 17 and 19.
Motor behavioural tests
Purification and activation of cerebellum-infiltrating mononuclear cells
Brain-infiltrating mononuclear cell purification was described
previously (Martin-Blondel et al., 2015). Briefly, 15 days after
tumour implantation, mice were perfused with phosphate-buffered saline (PBS) and their cerebellum was dissected.
Mononuclear cells were collected and used for flow cytometry
staining or in vitro stimulation with peptides. For the latter,
cerebellum-infiltrating mononuclear cells were stimulated
in vitro for 16 h with HA512-520 or control H-2-Kd-binding
peptide (Cw3170-179) for CD8 + T cells, and HA110-119 or control H-2-IAd-binding peptide (OVA323-339) for CD4 + T cells.
TM
The cells were incubated with GolgiPlug (1:1000; BD) and
TM
GolgiStop (1:1000; BD) for 16 h.
| 3
2012), we found no detectable CD80 and CD86 expression.
Data were recorded on an LSRII Fortessa (BD Bioscience) and
analysed with the FlowJo software (Tree Star).
Immunohistochemistry
The light microscopical stainings were performed as described
(Bien et al., 2012; Bauer and Lassmann, 2016). The primary
antibodies used were: anti-Calbindin D28K (1:2000, Swant),
anti-CD3 (1:200, SP7, Zytomed), anti-CD8 (1:100, 4SM15,
eBioscience), anti-Iba-1 (1:1000, Wako Chemicals), antiGranzyme B (1:25, Santa Cruz), anti-activated caspase 3
(1:3000, BD), anti-Mac3 (1:200, BD), anti-b2-microglobulin
(1:1000, Santa Cruz), and anti-C9neo (a kind gift by Dr
Paul Morgan, Cardiff, UK). Staining for immunoglobulin (Ig)
was performed using biotinylated donkey-anti-mouse Ig
(Jackson). Quantification of immunohistochemistry data was
performed by manual counting of Purkinje cells per mm2 of
Purkinje cell layer. In brief, for each mouse, the number of
Purkinje cells was determined from five equally sized cerebellar
cortex regions (central lobules II, III, simple lobule, ansiform
lobule, paramedian lobule) and normalized for the length of
the Purkinje cell layer.
Immunofluorescence
The fluorescent stainings were performed as previously
described (Bauer and Lassmann, 2016). The primary antibodies used were: rabbit anti-Calbindin D28K (1:2000, Swant),
mouse anti-Calbindin D28K (1:2000, Sigma), mouse antiHA37-38 hybridoma supernatant (1:10), rabbit anti-IP3R1
(1:500,
ThermoFisher),
mouse
anti-H-2Kd
(1:500,
ThermoFisher), anti-Granzyme B (1:25, Santa Cruz) and rat
anti-CD8 (1:50). Images were analysed using ImageJ software
(NIH).
Statistical analysis
Statistical analyses for two sets of data with normal distribution and for paired data were performed using the Student’s ttest. Comparisons between multiple groups were performed
using the one-way ANOVA (post-test Tukey). For tumour
size and weight loss, data were analysed using the two-way
ANOVA (post-test Sidak). The analyses were performed on
Prism 6 (GraphPad Software). Groups were considered statistically different at a P-value 5 0.05. The data are represented
as mean SEM (standard error of the mean).
Flow cytometry analysis
Lymph node cells, splenocytes, and tumour-infiltrating cells
were stained with anti-Thy1.2 (53-2.1, BD), anti-CD45 (30F11, Biolegend), anti-CD8 (53-6.7, BD), anti-CD4 (RM4-5,
BD), and anti-CD152 (UC10-4B9, eBioscience) mAbs.
Cerebellum-infiltrating cells were stained with the following
antibodies: anti-Thy1.2, anti-CD45, anti-B220 (RA3-6B2,
BD), anti-CD138 (281-2, BD), anti-CD8, anti-CD4, antiCD11b (M1/70, eBioscience), anti-IFN- (XMG1.2, BD),
anti-TNF- (MP6-XT22, BD), and anti-IL-17A (TC1118H10, BD). 4T1 and 4T1-HA tumour cells were stained
with anti-CD80 (16-10A1, eBioscience) and anti-CD86 (GL1,
BD) mAbs and in agreement with previous data (Ruocco et al.,
Results
Model of paraneoplastic neurological
degeneration
To model experimentally paraneoplastic cerebellar degeneration, we designed a mouse model expressing the influenza
virus haemagglutinin (HA) specifically in Purkinje cells. We
crossed the Rosa-Stop-HA mice with the L7-Cre mice,
which express the Cre recombinase specifically in Purkinje
cells. In the resulting L7-HA mice, the stop cassette is
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Motor coordination was assessed with a Rotarod device
(Bioseb) with acceleration from 4 to 40 rpm over a 600 s
period. For training, mice were tested on seven consecutive
days, thrice daily. During the investigation period (Day 0 to
Day 20), the latency to fall was measured for each mouse
twice daily, and the longest time was recorded. The 100%
represents the Day 0 value. To test the spontaneous motor
activity an automated actimeter (ActiTrack) was used. This
apparatus consists of four 22.5 cm2 surface areas with 16
surrounding infrared beams coupled to a control unit. The
activity was recorded for 10 min every day, and total distance
travelled (m) was recorded.
BRAIN 2016: Page 3 of 12
4
| BRAIN 2016: Page 4 of 12
L. M. Yshii et al.
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Figure 1 Generation and characterization of the L7-HA mice. (A) Scheme of the L7-HA double knock-in mice. Top: In the Rosa-StopHA mice, a LoxP-flanked Stop cassette followed by the haemagglutinin (HA) sequence was introduced in the Rosa26 locus. Middle: In the L7-Cre
mice, the Cre sequence was inserted in the Purkinje cell-specific L7/pcp2 gene. Bottom: In L7-HA mice, resulting from the crossing of the RosaStop-HA and L7-Cre mice, the Cre-mediated recombination within the Rosa26 locus permits transcription of HA. (B) HA mRNA expression
assessed by quantitative RT-PCR in different organs of L7-HA mice (black bar) or cerebellum of MOG-HA mice (open bar). One experiment
representative of three is shown. n.d. = not detected. (C) Expression of HA protein in Purkinje cells from L7-HA mice. Double immunostaining
for HA (green) and calbindin (Calb, red). Top row: Littermate control mouse (WT), bottom row: L7-HA mouse. Nuclear staining (DAPI). Scale
bar = 50 mm. (D–G) CTLA4 expression was assessed by flow cytometry on Day 5 in transferred HA-specific Thy1.2 + CD4 + (D) or
Thy1.2 + CD8 + (E) T cells in the lymph nodes of Thy1.1 congenic mice bearing 4T1 or 4T1-HA tumour, and in tumour-infiltrating total CD4 +
(F) and CD8 + (G) T cells.
excised due to L7-controlled Cre expression, leading to selective expression of HA in Purkinje cells (Fig. 1A). Transcription
of HA was detected by reverse transcriptase polymerase chain
reaction (RT-PCR) in the cerebellum but not in other organs
of L7-HA mice, including the rest of the CNS. Cerebellum of
MOG-HA mice, which express HA in oligodendrocytes, was
used as a positive control (Saxena et al., 2008) (Fig. 1B).
Furthermore, by immunohistofluorescence, we confirmed
that HA protein expression was confined to Purkinje cells
in L7-HA mice as shown by the co-staining for HA and
calbindin (Fig. 1C). As expected, HA expression was not detected in littermate control mice (wild-type).
Paraneoplastic neurological disorder
To further model paraneoplastic neurological disorder,
L7-HA or wild-type mice were challenged with the 4T1HA breast cancer cells that express the HA antigen. Given
the key role of T cells as effectors of tumour control and
paraneoplastic neurological disorder pathogenesis (Albert
and Darnell, 2004; Dalmau and Rosenfeld, 2008;
Pignolet et al., 2013), on the day of tumour implantation,
mice were transferred with HA-specific naive CD4 + and
CD8 + (CD4/CD8) T cells. CD4/CD8 T cells were capable
of partially controlling tumour growth as compared to mice
injected with tumour only (Fig. 2A), but they elicited no
patent neurological manifestations.
We next addressed whether treatment with a mAb blocking
CTLA4 would increase anti-tumour immunity since a high
| 5
proportion of T cells activated by the HA-expressing
tumour expressed CTLA4/CD152 (Fig. 1D–G). AntiCTLA4 mAb therapy protected mice almost completely
from tumour outgrowth, regardless of their expression of
HA in the cerebellum (Fig. 2A). Strikingly, L7-HA mice
bearing 4T1-HA tumour and treated with anti-CTLA4
mAb lost weight significantly, from Day 15 onwards (Fig.
2B; P 5 0.0001).
To investigate whether mice also developed neurological
signs, we evaluated motor activity. L7-HA mice bearing
4T1-HA tumour and treated with anti-CTLA4 mAb displayed a significant reduction in forced motor activity on
the Rotarod during the diseased period (Fig. 2C;
P 5 0.0001). Using the actimeter test, we also revealed
reduced spontaneous locomotion in 4T1-HA tumour-bearing L7-HA mice that received anti-CTLA4 mAb (Fig. 2D).
Importantly, no such clinical manifestations developed in
4T1-HA tumour-bearing wild-type mice treated with antiCTLA4 mAb or in 4T1-HA tumour-bearing L7-HA mice
not treated with anti-CTLA4 mAb (Fig. 2B–D).
Figure 2 CTLA4 blockade allows tumour control but causes weight loss and motor impairment in L7-HA mice. (A) Tumour size
was determined in L7-HA or wild-type (WT) mice implanted with 4T1-HA tumour cells (105), injected with no T cells or naive HA-specific CD4 +
and CD8 + T cells (107 each), with or without treatment with anti-CTLA4 mAb. The values are from the subgroup of mice shown in (B), in which
tumour size was assessed daily (5 to 20 mice per group). (B) Weight of 4T1-HA tumour-bearing L7-HA or wild-type mice described in A. The
values are from 45 pooled experiments, involving 12 to 32 mice per group. (C) Rotarod performance in wild-type versus L7-HA mice treated as
described in A. D0-D5 = sum of the percentage of time (normalized to Day 0) spent by a mouse on the Rotarod from Day 0 to 5, i.e. before
disease onset. No significant differences between groups exist before disease onset. D15-D20 = sum of the time spent by a mouse on the
Rotarod from Day 15 to 20, i.e. after onset of weight loss. The data are from 45 pooled experiments. (D) Distance (m) travelled during a 10 min
cycle. D0-D5 = sum of the distance travelled from Day 0 to 5, i.e. before disease onset. D15-D20 = sum of the distance travelled from Day 15
to 20, i.e. after disease onset. No significant differences between groups exist before disease onset. Pooled data from two independent experiments. *P 5 0.05; **P 5 0.01; and ****P 5 0.0001.
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Anti-CTLA4 antibody triggers weight
loss and reduced locomotion in L7HA mice
BRAIN 2016: Page 5 of 12
6
| BRAIN 2016: Page 6 of 12
Collectively, these results show that clinical signs resembling paraneoplastic neurological disorder occur upon
CTLA4 blockade, only when the antigen is expressed
both in the CNS and tumour.
Therapeutic CTLA4 blockage induces
cerebellar inflammation and Purkinje
cell loss in L7-HA mice
Immune mechanisms of Purkinje cell
death in L7-HA mice with paraneoplastic neurological disorder
To gain insight into the immune cells responsible for
Purkinje cell loss the cerebellum of L7-HA mice with paraneoplastic neurological disorder was further studied by
flow cytometry. Contrasting with control mice, the cerebellum of L7-HA mice with paraneoplastic neurological disorder harboured CD45high CD11blow lymphocytes as well
as CD45high CD11bhigh myeloid cells (Fig. 4A). Some B
cells (13.2 3.4% of blood-derived CD45high cells) including a small number of CD138 + plasma cells (range 24 to
90 cells/cerebellum, n = 14) were present on Day 15 after
disease induction. T cells were the dominant population
with a mean of 2000 (range 3 to 9219 cells, n = 12)
CD4 + and 1300 (range 2 to 7405, n = 12) CD8 + T cells.
We then assessed the antigen specificity of these cerebelluminfiltrating T cells. Few CD4 + T cells reacted ex vivo to HA
peptide by production of either IL-17 or IFN- (Fig. 4B).
By contrast, cerebellum-infiltrating CD8 + T cells exhibited
a marked HA-specific production of IFN- and TNF- (Fig.
4C). These data indicate that HA-specific CD8 + T cells are
enriched in the cerebellum of L7-HA mice with paraneoplastic neurological disorder.
To further dissect the interaction between CD8 + T cells
and Purkinje cells, immunohistological investigations were
conducted in L7-HA mice exhibiting marked ongoing loss
of Purkinje cells and their neighbouring dendritic tree (Fig.
5A and B). Numerous CD8 + T cells were localized in close
contact with Purkinje soma or along their dendrites (Fig.
5C and D). In some instances, intimate interactions between CD8 + T cells and Purkinje cells were evidenced,
with indentation of the neuronal surface and polarization
of the cytolytic granules towards the CD8 + T cell/Purkinje
cell interface (Fig. 5E and F). Possibility of direct targeting
of Purkinje cells by HA-specific cytotoxic CD8 + T cells was
further strengthened by in situ detection of MHC class Iexpression in Purkinje neurons (Fig. 5G). In L7-HA mice
with paraneoplastic neurological disorder, some Purkinje
cells exhibited DNA fragmentation (Fig. 5H) and caspase
3 activation (Fig. 5I), indicating ongoing apoptosis.
Neuronophagia of cells with Purkinje-like morphology by
macrophages/microglia was also detected (Fig. 5J). We also
assessed Ig deposition and complement activation in the
cerebellum of these mice. Whereas Ig leaked into the cerebellum
due
to
blood–brain
barrier
disruption
(Supplementary Fig. 1A), there was neither Ig binding
(Supplementary Fig. 1B) nor C9neo deposition
(Supplementary Fig. 1C) on Purkinje cells. Therefore, our
data suggest that the humoral immune response does not
play a main role in this model. Together, these findings
indicate that cerebellar inflammation is associated with
MHC class I expression on Purkinje cells, physical contact
with CD8 + T cells, which polarize their lytic granules towards the neurons, strongly suggesting that cytotoxic T
cells deliver a lethal hit to Purkinje cells in an antigen-specific manner. To further explore the in vivo role of CD8 + T
cells in our model, we treated mice with a depleting antiCD8 mAb. Whereas mice treated or not with control IgG
exhibited loss of Purkinje cells (mean loss of 36 and 44%,
respectively), the five mice treated with the depleting antiCD8 mAb did not (data not shown).
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
To uncover the structural defects underlying the phenotype
caused by anti-CTLA4 mAb therapy in L7-HA mice, we
performed neuropathological analyses. L7-HA mice implanted with 4T1-HA tumour and treated with antiCTLA4 mAb showed a massive infiltration of T cells in
the cerebellum (Fig. 3C). In addition, clear local microglial
activation was present in these mice (Fig. 3F). Other brain
regions were spared from inflammation (data not shown).
Neither T cell infiltration nor microglial activation was detected in the cerebellum of wild-type mice treated with antiCTLA4 mAb (Fig. 3A and D), or L7-HA mice not treated
with anti-CTLA4 mAb (Fig. 3B and E).
CTLA4 blockade also resulted in loss of Purkinje cell soma
and dendritic arborization in L7-HA mice (Fig. 3I), but not in
control mice (Fig. 3G and H), as detected by calbindin immunostaining. This Purkinje cell loss was further confirmed by
IP3R1 immunoreactivity (Fig. 3J), another characteristic
marker of Purkinje cells (Miyata et al., 1999). No detectable
Ctla4 mRNA expression was detected in the cerebellum of
L7-HA mice, whereas a strong signal was evidenced in the
spleen (data not shown). We then quantified the number of
Purkinje cells by counting Calbindin + cell bodies in 20 to
40 mm of Purkinje cell layer. A very significant reduction in
Purkinje cells was observed in L7-HA mice treated with antiCTLA4 mAb, in comparison to the other groups (Fig. 3K).
The magnitude of Purkinje cell loss was similar between Days
20 and 45, underlining the acute nature of the paraneoplastic
autoimmune process (data not shown). Overall, in the 32 L7HA mice treated with anti-CTLA4 mAb, the mean loss of
Purkinje cells was 40%, with marked interindividual variability ranging from 0 to 81% (Fig. 3K). Six L7-HA mice treated
with anti-CTLA4 mAb presented normal Purkinje cell density, including five without cerebellar microglia activation and
T cell infiltration. Collectively, these data suggest that the
penetrance of disease is not 100% in our model. Thus, in
L7-HA mice treated with anti-CTLA4 mAb, paraneoplastic
neurological disorder is the consequence of massive cerebellar
inflammation associated with the destruction of onconeural
antigen-expressing Purkinje neurons.
L. M. Yshii et al.
Paraneoplastic neurological disorder
BRAIN 2016: Page 7 of 12
| 7
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Figure 3 Treatment with anti-CTLA4 antibody induces marked cerebellar inflammation and Purkinje cell loss selectively in
L7-HA mice. (A–I) Histological analysis 20 days after transfer of naive HA-specific CD4 + and CD8 + T cells in L7-HA mice (B, C, E, F, H and I)
or littermate controls (A, D and G) implanted with 4T1-HA, with (A, C, D, F, G and I) or without (B, E and H) anti-CTLA4 mAb treatment.
Representative staining in brown for CD3 + cells (A–C; top row), microglia (Iba-1, D–F; middle row), and Purkinje cells (calbindin, G–I; bottom row);
nuclear counterstaining: haematoxylin (blue). Arrows in (I) point to loss of Purkinje cells. Scale bars = 100 mm. (J) Representative images of
immunofluorescence confocal microscopy using co-staining with anti-calbindin and anti-IP3R1 antibodies to label Purkinje cells with independent
markers. Nuclear staining was performed with DAPI. Scale bar = 50 mm. (K) Quantitative evaluation of the density of Purkinje cells in 4T1-HA
tumour-bearing wild-type (WT) and L7-HA mice, treated or not with anti-CTLA4 mAb. Results are expressed as mean SEM of 6–32 mice per
group from six independent experiments analysed at either Day 20 or 45 (****P 5 0.0001).
8
| BRAIN 2016: Page 8 of 12
L. M. Yshii et al.
infiltrating cells in wild-type (WT) and L7-HA mice implanted with 4T1-HA, 15 days after transfer of naive HA-specific CD4 + and CD8 + T cells and
treatment with anti-CTLA4 mAb. (A) Cerebellum-infiltrating cells were stained with anti-CD45 (blood-derived cells), anti-CD11b (myeloid cells),
anti-Thy1.2 (T cells), anti-B220 (B cells), anti-CD138 cells (plasma cells), anti-CD4 and anti-CD8 mAbs. (B) Cerebellum-infiltrating CD4 + T cells
were stimulated in vitro for 16 h with HA110-119 or a control H-2-IAd-binding peptide and IFN- and IL-17 A production was assessed by intracellular
staining. The absolute number of CD4 + T cells that produce IFN- or IL-17 A is shown in the right panels. The mouse indicated by a plus sign is
depicted on the flow cytometry plot presented on the left. (C) Cerebellum-infiltrating CD8 + T cells were stimulated in vitro for 16 h with HA512-520
or a control H-2-Kd-binding peptide and IFN- and TNF- production was assessed. The absolute number of CD8 + T cells that produce IFN- or
TNF- is plotted on the right panels (*P 5 0.05). The mouse indicated by a plus sign is depicted on the flow cytometry plot presented on the left.
Finally, we wondered whether analogous immunological
events could contribute to Purkinje cell targeting in human
paraneoplastic neurological disorder in which autoantibodies have no demonstrated pathogenic effect. Confirming a
previous report (Aboul-Enein et al., 2008), close apposition
between CD8 + T cells and remaining calbindin + Purkinje
cells was detected in patients with anti-Hu or anti-Ma2
antibody-associated encephalitis with prominent cerebellar
involvement (Fig. 5K and L).
Discussion
Using a mouse model prone to develop paraneoplastic
neurological disorder, we explored the delicate balance
between tumour immunity and autoimmunity. As expected,
the anti-tumour T cell response was sufficient to reduce
tumour growth. Similar to the human situation, antiCTLA4 mAb, which antagonizes an inhibitory pathway
in T cells, increased the efficacy of this anti-tumour immunity. Strikingly, however, this enhanced tumour control was
obtained at the expense of autoimmune paraneoplastic
neurological disorder. Actually, without anti-CTLA4 therapy, none of the studied animals developed cerebellar inflammation, whereas the use of anti-CTLA4 mAb led to
cerebellar inflammation in 27/32 mice (84%).
Anti-CTLA4 therapy promotes anti-tumour immunity
through several converging mechanisms in both mice and
humans (Allison, 2015). In mice, anti-CTLA4 treatment
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Figure 4 Characterization of immune cells within the cerebellum of L7-HA mice. Flow cytometry analysis of the cerebellum-
Paraneoplastic neurological disorder
BRAIN 2016: Page 9 of 12
| 9
Cerebellum of wild-type (A) and L7-HA mice (B–J) 20 days after transfer of anti-HA specific T cells and anti-CTLA4mAb therapy. (A and B)
Calbindin staining shows marked loss of Purkinje cells in the L7-HA mice. Scale bars = 100 mm. (C) Double staining for CD8 (orange-brown) and
calbindin (dark blue) shows the presence of large numbers of CD8 + T cells in the molecular layer of the cerebellum. Scale bar = 50 mm. (D)
Double staining for CD8 and calbindin reveals cytotoxic T cells in contact with Purkinje cells. Scale bar = 20 mm. (E and F) Confocal fluorescence
triple staining for Granzyme-B (red), CD8 (green) and calbindin (blue) shows CD8 + T cells in close apposition to Purkinje cells. Note the position
of cytotoxic granules all facing the plasma membrane of the Purkinje cells. Scale bars = 10 mm. (G) Double staining for calbindin (blue) and b2microglobulin (brown) showing MHC class I upregulation in the Purkinje cell. Scale bar = 25 mm. (H) Double staining for TUNEL (blue) and
calbindin reveals degeneration of a Purkinje cell (arrowhead). Scale bar = 50 mm. (I) Presence of a caspase-3-positive cell with condensed nucleus
in the Purkinje cell layer. Scale bar = 10 mm. (J) Microglial cells stained for Mac-3 enclosing a Purkinje cell. Scale bar = 25 mm. (K) Double staining
for calbindin (blue) and CD8 (brown) shows severe loss of Purkinje cells and dendritic arborization in a patient with anti-Hu antibody-associated
paraneoplastic neurological disorder. Scale bar = 200 mm. Arrowheads point at some remaining Purkinje cells. The inset shows a higher magnification of a CD8 + T cell (arrowhead) in tight apposition to a Purkinje cell. (L) Loss of Purkinje cells (arrowheads) can also be seen in a patient
with anti-Ma2 antibody-associated paraneoplastic neurological disorder. Scale bar = 200 mm. Here the insets reveal multiple CD8 + T cells attacking Purkinje cells.
depletes Treg cells selectively from tumour via Fc receptor-expressing local macrophages, while the absolute numbers of effector T cells are increased (Simpson et al., 2013).
In addition, CTLA4 blockade on effector T cells, notably
on cytotoxic CD8 + T cells, appears essential for the
enhanced anti-tumour response following anti-CTLA4 therapy. In that respect, human studies have shown that
CTLA4 blockade therapy increases the amplitude of
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Figure 5 Immune mechanisms of Purkinje cell loss in experimental and human paraneoplastic cerebellar degeneration.
10
| BRAIN 2016: Page 10 of 12
simultaneously by two or more CD8 + T cells. This feature
was recently associated with high probability of target cell
death using dynamic two-photon imaging in experimental
models of viral infection (Halle et al., 2016).
Our data highlight the induction of paraneoplastic neurological disorder after therapeutic blockade of CTLA4, raising the concern that checkpoint inhibitors, by enhancing
anti-tumour immunity, may inadvertently increase the likelihood
for
paraneoplastic
neurological
disorders.
Paraneoplastic neurological disorder development has
been associated with a better control of the underlying
tumour, attributed to a partly efficient anti-tumour adaptive immunity (Pignolet et al., 2013). In addition, the oncologic response to anti-CTLA4 therapy correlates with
immune-related adverse events (Bertrand et al., 2015).
Gynaecologic cancers and certain cancers of neuroectodermal origin are particularly associated with paraneoplastic
neurological disorders. Consequently, the enhanced and
diversified anti-tumour T cell response promoted by antiCTLA4 therapy could lead to paraneoplastic neurological
disorder, in patients harbouring these types of cancers. As
suggested, based on theoretical grounds (Pignolet et al.,
2013; Steinman, 2014), our experimental model argues
that immune checkpoint inhibitors may favour paraneoplastic neurological disorder development. Interestingly,
two cases of autoimmune encephalomyelitis developing
after the first injection of immune checkpoint inhibitors
have been recently reported (Williams et al., 2016). The
sero-prevalence of anti-neuronal autoantibodies can be as
high as 29% in patients with small cell lung cancer
(Pignolet et al., 2013; Gozzard et al., 2015) and anti-neuronal antibodies are associated with T cells with the same
specificity (Albert et al., 2000). Therefore, a close monitoring of neurological symptoms is warranted, at least in the
subgroup of patients with anti-neuronal autoantibodies,
when immune checkpoint inhibitors are being used.
Acknowledgements
We acknowledge Dr Isabelle Dusart for advice regarding
the study of the cerebellum, and Drs Anne Dejean,
Abdelhadi Saoudi, Nicolas Blanchard, and Daniel
Gonzalez-Dunia for their valuable inputs on the manuscript. The authors acknowledge the technical assistance
provided by CPTP Cytometry and Imaging facilities, and
histology and animal facility staff of US006.
Funding
This work was supported by grants from FP7-PEOPLE2012-ITN-Neurokine, ERA-NET Meltra-BBB, MidiPyrénées Region, Fondation ARC pour la recherche sur le
cancer ARC, and Ligue régionale contre le cancer (R.L.).
L.M.Y. was supported by grant #2013/22196-4 from São
Paulo Research Foundation (FAPESP).
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
melanoma-specific CD8 + T cell responses against selfantigens and, possibly, against tumour neoantigens
(Kvistborg et al., 2014; Van Allen et al., 2015).
Importantly, CTLA4 deficiency is associated with multitissue lymphocytic infiltration and damage of likely autoimmune origin (Waterhouse et al., 1995; Ise et al., 2010). Here
again, CTLA4 maintains T cell tolerance by regulating the
pathogenicity of autoantigen-specific T cells by both effector
T cell autonomous effects and non-cell autonomous mechanisms, involving Treg cells (Wing et al., 2008; Ise et al., 2010).
Furthermore, patients with CTLA4 haploinsufficiency present
multi-tissue inflammation, including brain and cerebellar involvement (Kuehn et al., 2014; Schubert et al., 2014). Partly
mirroring these data, anti-CTLA4 therapy has been associated with immune-related adverse events in 60% of treated patients (Bertrand et al., 2015). In particular, CNS
autoimmunity is part of the spectrum of immune-related adverse events of anti-CTLA4 therapy. Indeed, autoimmune
hypophysitis has been widely recognized as a frequent side
effect of ipilimumab therapy (Iwama et al., 2014; Bertrand
et al., 2015). Exacerbation of pre-existing autoimmune disease has also been reported in patients with advanced melanoma treated with ipilimumab (Johnson et al., 2016).
Whether de novo development of autoimmune side effects
is related to genetic susceptibility or to pre-existing serologic
evidence for autoantibodies is currently unknown.
In our mouse model, immune checkpoint therapy elicited
migration of antigen-specific T cells into the cerebellum and
subsequent killing of neurons, only when the antigen was
expressed in neurons. Our data strongly suggest that CD8 +
T cells play a final effector role by specifically killing MHC
class I-expressing Purkinje cells in paraneoplastic cerebellar
degeneration. Purkinje cells have indeed been reported to
express MHC class I molecules (McConnell et al., 2009), a
feature confirmed here both in vitro upon IFN- incubation
and in vivo. Based on these data and on the strong production of IFN- by cerebellum-infiltrating CD8 + T cells, it
is tempting to speculate that a pathogenic feed-forward
loop takes place. This involves IFN- secretion by CD8 +
T cells upon local recognition of onconeural antigens that
further promotes MHC class I presentation by neurons, in
turn rendering them vulnerable to killing by antigen-specific
CD8 + T cells. A similar scenario is likely at play in human
paraneoplastic neurological disorders with autoantibodies
against intracellular neuronal antigens. Indeed, an IFN-
signature has been reported in the CSF of such patients
(Roberts et al., 2015). Additionally, CDR2-specific CD8 +
T cells are present in the blood and CSF of patients with
paraneoplastic cerebellar degeneration (Albert et al., 1998,
2000) and they can kill CDR2-expressing target cells in an
HLA-restricted manner (Santomasso et al., 2007). Finally,
in situ evidence for direct killing of neurons by cytotoxic T
cells has been documented by converging studies (Bien
et al., 2012). Our still images from the experimental
model and from tissue of patients with paraneoplastic
neurological disorder point to a possible T cell cooperation
for killing, as some target neurons are contacted
L. M. Yshii et al.
Paraneoplastic neurological disorder
Supplementary material
Supplementary material is available is available at Brain
online.
References
| 11
Kirberg J, Baron A, Jakob S, Rolink A, Karjalainen K, von Boehmer
H. Thymic selection of CD8 + single positive cells with a class II
major histocompatibility complex-restricted receptor. J Exp Med
1994; 180: 25–34.
Kuehn HS, Ouyang W, Lo B, Deenick EK, Niemela JE, Avery DT,
et al. Immune dysregulation in human subjects with heterozygous
germline mutations in CTLA4. Science 2014; 345: 1623–7.
Kvistborg P, Philips D, Kelderman S, Hageman L, Ottensmeier C,
Joseph-Pietras D, et al. Anti-CTLA-4 therapy broadens the melanoma-reactive CD8 + T cell response. Sci Transl Med 2014; 6:
254ra128.
Leach DR, Krummel MF, Allison JP. Enhancement of antitumor immunity by CTLA-4 blockade. Science 1996; 271: 1734–6.
Martin-Blondel G, Pignolet B, Tietz S, Yshii L, Gebauer C, Perinat T,
et al. Migration of encephalitogenic CD8 T cells into the central
nervous system is dependent on the alpha4beta1-integrin. Eur J
Immunol 2015; 45: 3302–12.
Mason WP, Graus F, Lang B, Honnorat J, Delattre JY, Valldeoriola F,
et al. Small-cell lung cancer, paraneoplastic cerebellar degeneration
and the Lambert-Eaton myasthenic syndrome. Brain 1997; 120 (Pt
8): 1279–300.
McConnell MJ, Huang YH, Datwani A, Shatz CJ. H2-K(b) and H2D(b) regulate cerebellar long-term depression and limit motor learning. Proc Natl Acad Sci USA 2009; 106: 6784–9.
Miyata M, Miyata H, Mikoshiba K, Ohama E. Development of
Purkinje cells in humans: an immunohistochemical study using a
monoclonal antibody against the inositol 1,4,5-triphosphate type 1
receptor (IP3R1). Acta Neuropathol 1999; 98: 226–32.
Morgan DJ, Liblau R, Scott B, Fleck S, McDevitt HO, Sarvetnick N,
et al. CD8( + ) T cell-mediated spontaneous diabetes in neonatal
mice. J Immunol 1996; 157: 978–83.
Pellkofer H, Schubart AS, Hoftberger R, Schutze N, Pagany M,
Schuller M, et al. Modelling paraneoplastic CNS disease: T-cells
specific for the onconeuronal antigen PNMA1 mediate autoimmune
encephalomyelitis in the rat. Brain 2004; 127 (Pt 8): 1822–30.
Pignolet BS, Gebauer CM, Liblau RS. Immunopathogenesis of paraneoplastic neurological syndromes associated with anti-Hu antibodies: a beneficial antitumor immune response going awry.
Oncoimmunology 2013; 2: e27384.
Robert C, Thomas L, Bondarenko I, O’Day S, Weber J, Garbe C, et al.
Ipilimumab plus dacarbazine for previously untreated metastatic
melanoma. N Engl J Med 2011; 364: 2517–26.
Roberts WK, Blachere NE, Frank MO, Dousmanis A, Ransohoff RM,
Darnell RB. A destructive feedback loop mediated by CXCL10 in
central nervous system inflammatory disease. Ann Neurol 2015; 78:
619–29.
Ruocco MG, Pilones KA, Kawashima N, Cammer M, Huang J, Babb
JS, et al. Suppressing T cell motility induced by anti-CTLA-4 monotherapy improves antitumor effects. J Clin Invest 2012; 122: 3718–
30.
Saito H, Tsumura H, Otake S, Nishida A, Furukawa T, Suzuki N. L7/
Pcp-2-specific expression of Cre recombinase using knock-in approach. Biochem Biophys Res Commun 2005; 331: 1216–21.
Santomasso BD, Roberts WK, Thomas A, Williams T, Blachere NE,
Dudley ME, et al. A T-cell receptor associated with naturally occurring human tumor immunity. Proc Natl Acad Sci USA 2007; 104:
19073–8.
Saxena A, Bauer J, Scheikl T, Zappulla J, Audebert M, Desbois S,
et al. Cutting edge: multiple sclerosis-like lesions induced by effector
CD8 T cells recognizing a sequestered antigen on oligodendrocytes. J
Immunol 2008; 181: 1617–21.
Schubert D, Bode C, Kenefeck R, Hou TZ, Wing JB, Kennedy A, et al.
Autosomal dominant immune dysregulation syndrome in humans
with CTLA4 mutations. Nat Med 2014; 20: 1410–16.
Simpson TR, Li F, Montalvo-Ortiz W, Sepulveda MA, Bergerhoff K,
Arce F, et al. Fc-dependent depletion of tumor-infiltrating regulatory
T cells co-defines the efficacy of anti-CTLA-4 therapy against melanoma. J Exp Med 2013; 210: 1695–710.
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
Aboul-Enein F, Hoftberger R, Buxhofer-Ausch V, Drlicek M,
Lassmann H, Budka H, et al. Neocortical neurones may be targeted
by immune attack in anti-Yo paraneoplastic syndrome. Neuropathol
Appl Neurobiol 2008; 34: 248–52.
Albert ML, Austin LM, Darnell RB. Detection and treatment of activated T cells in the cerebrospinal fluid of patients with paraneoplastic cerebellar degeneration. Ann Neurol 2000; 47: 9–17.
Albert ML, Darnell JC, Bender A, Francisco LM, Bhardwaj N, Darnell
RB. Tumor-specific killer cells in paraneoplastic cerebellar degeneration. Nat Med 1998; 4: 1321–4.
Albert ML, Darnell RB. Paraneoplastic neurological degenerations:
keys to tumour immunity. Nat Rev Cancer 2004; 4: 36–44.
Allison JP. Checkpoints. Cell 2015; 162: 1202–5.
Aslakson CJ, Miller FR. Selective events in the metastatic process
defined by analysis of the sequential dissemination of subpopulations of a mouse mammary tumor. Cancer Res 1992; 52: 1399–405.
Bauer J, Lassmann H. Neuropathological Techniques to investigate
central nervous system sections in multiple sclerosis. Methods Mol
Biol 2016; 1304: 211–29.
Bertrand A, Kostine M, Barnetche T, Truchetet ME, Schaeverbeke T.
Immune related adverse events associated with anti-CTLA-4 antibodies: systematic review and meta-analysis. BMC Med 2015; 13: 211.
Bien CG, Vincent A, Barnett MH, Becker AJ, Blumcke I, Graus F,
et al. Immunopathology of autoantibody-associated encephalitides:
clues for pathogenesis. Brain 2012; 135 (Pt 5): 1622–38.
Dalmau J, Graus F, Villarejo A, Posner JB, Blumenthal D, Thiessen B,
et al. Clinical analysis of anti-Ma2-associated encephalitis. Brain
2004; 127 (Pt 8): 1831–44.
Dalmau J, Rosenfeld MR. Paraneoplastic syndromes of the CNS.
Lancet Neurol 2008; 7: 327–40.
Furneaux HM, Rosenblum MK, Dalmau J, Wong E, Woodruff P,
Graus F, et al. Selective expression of Purkinje-cell antigens in
tumor tissue from patients with paraneoplastic cerebellar degeneration. N Engl J Med 1990; 322: 1844–51.
Gozzard P, Woodhall M, Chapman C, Nibber A, Waters P, Vincent
A, et al. Paraneoplastic neurologic disorders in small cell lung carcinoma: a prospective study. Neurology 2015; 85: 235–9.
Graus F, Saiz A, Dalmau J. Antibodies and neuronal autoimmune
disorders of the CNS. J Neurol 2010; 257: 509–17.
Halle S, Keyser KA, Stahl FR, Busche A, Marquardt A, Zheng X, et al.
In Vivo Killing Capacity of Cytotoxic T Cells Is Limited and
Involves Dynamic Interactions and T Cell Cooperativity. Immunity
2016; 44: 233–45.
Hodi FS, O’Day SJ, McDermott DF, Weber RW, Sosman JA, Haanen
JB, et al. Improved survival with ipilimumab in patients with metastatic melanoma. N Engl J Med 2010; 363: 711–23.
Ise W, Kohyama M, Nutsch KM, Lee HM, Suri A, Unanue ER, et al.
CTLA-4 suppresses the pathogenicity of self antigen-specific T cells
by cell-intrinsic and cell-extrinsic mechanisms. Nat Immunol 2010;
11: 129–35.
Iwama S, De Remigis A, Callahan MK, Slovin SF, Wolchok JD,
Caturegli P. Pituitary expression of CTLA-4 mediates hypophysitis
secondary to administration of CTLA-4 blocking antibody. Sci
Transl Med 2014; 6: 230ra45.
Johnson DB, Sullivan RJ, Ott PA, Carlino MS, Khushalani NI, Ye F,
et al. Ipilimumab therapy in patients with advanced Melanoma and
preexisting autoimmune disorders. JAMA Oncol 2016; 2: 234–40.
BRAIN 2016: Page 11 of 12
12
| BRAIN 2016: Page 12 of 12
Steinman L. Conflicting consequences of immunity to cancer versus
autoimmunity to neurons: insights from paraneoplastic disease.
Eur J Immunol 2014; 44: 3201–5.
Tuzun E, Zhou L, Baehring JM, Bannykh S, Rosenfeld MR, Dalmau J.
Evidence for antibody-mediated pathogenesis in anti-NMDAR encephalitis associated with ovarian teratoma. Acta Neuropathol
2009; 118: 737–43.
Van Allen EM, Miao D, Schilling B, Shukla SA, Blank C, Zimmer L,
et al. Genomic correlates of response to CTLA-4 blockade in metastatic melanoma. Science 2015; 350: 207–11.
L. M. Yshii et al.
Waterhouse P, Penninger JM, Timms E, Wakeham A, Shahinian A,
Lee KP, et al. Lymphoproliferative disorders with early lethality in
mice deficient in Ctla-4. Science 1995; 270: 985–8.
Williams TJ, Benavides DR, Patrice KA, Dalmau JO, de Avila AL, Le
DT, et al. Association of autoimmune encephalitis with combined
immune checkpoint inhibitor treatment for Metastatic cancer.
JAMA Neurol 2016; 73: 928–33. doi:10.1001.
Wing K, Onishi Y, Prieto-Martin P, Yamaguchi T, Miyara M,
Fehervari Z, et al. CTLA-4 control over Foxp3 + regulatory T cell
function. Science 2008; 322: 271–5.
Downloaded from http://brain.oxfordjournals.org/ by guest on September 7, 2016
#!!+ $" $*
$ #
+ $*
! +*073)074"!) "$ !
* ) " ) +
$ ) ! 51,53)55)72)0//)01/* ) ! ! % " 67)075*!)
# )!)
$
*
$) " ! $%$ $* &! + 38 78 + #$
-
.$
- .* "!) $ $ +3 " $ $*
! !*
006
$%# *$&$%%%% #% %3$!;?=?$
$ $$% # % %& # %# &% $ % &#%# &$ % 2 &# 1 %3$! ;? $ & %
%# %& ## (% #&&# % 2 %#$%1=?$(#
% !#%* %# % %& # &% (# $ % $&% % % % 2 %%*!$ $%%# +%$%(# #
%%3%& #&#$! $2&#%# $$%%(%$%&*# #+ &$ ( %* $%#% %% % % !
$$$% #%& ##% 8=<2$$*!# '*;?$%%
!$% %#% #&% 1##&%%% %%& #$%!# %
%#$&#''8=<18==2&#%# #1( &%#%%%%#% %(
%3$!;?=?$($$$#* #%%%#% # $$%
&% #&% $2##$&%$(# %%#$ &$
#&% &%$1(!#%6$)!#$$$ $3%2%$ 1;?$)%%% $% !# #%#
% #&% $*!# '%#$&#''9819:2% 1! ;?$$
$$%% ' % #8=>18>72%*1,#%2!#$% &$
&$ 63% $$ 4635 #' * % '9 !# %# $ %%& #$&# $8>82
($ $#'% &%&
#$! $ $% % &#* %& # ($ %'2 $ ($ * & % & % #2 (# % *!$$ % % # $ &# * !%'%#$# -'%3$!;?=?$%%#1
%# #1 % &% %3 % $%2 ! #%%*1 % %*!$ %3$! $ (# % & % 2 ,# % 2
# & % # &$ ) ## ( #$ %# %
2#% &# %;?=?$$%63(#' '
%$!# $$8>82
%# # !# ! $ %% ;? $ !* #% # % $$
&#$ ! =? $ % "&# % # &% $1 #$ %#
88=
#%"&&$$"$$$%"#$.$#$$
"#%$ $ & $ %$"$& # $$ "## $ $"$$$
").$"$%"/# :#$&$
$ "# " # 7 # " $" ( "## %#
&& $"#"$ $ $ # !%#$ $$ ' "## )
" $&):#%".
$"#$)-%"-$"#"$*&/# 7=:=
# "$$ $ $" $ $%" %$ '# $ #%$ $ % $. $ $ $) $"$ $ $")
" $" /7 '# $) $ " % $". - 59065 1:7<2 $ $"$ '$ $/7 & ""
$'"#$/$"$##'$"$$$
"%. %" $ " "&%# #$%# #' $$ $/$%" /7
$" ))$%/"$&"#&$#-%
%$%$)-
" $$#79. - %$% ) )#$# # "!%$ # $ $//7$" )7:."&"-$'##%$% )$#$"
$$% $$"#&"$)" "$83.#
#"&$# "# $ ) $## $$ $ % $") ##
) $"%$ $ $ & $ $$#. $- # ##$
'$$$%"$"4;5.#$%) $$#$"$'$$/
/7$#$$/7$" )"##:= "$
"/# :="# #78.$)-$#
#'$$$"$)$$(:=#$%"##""$'$
$$"#%"&&"$" $$#4;6.%#-) $$)-$$#
% $ ## % $/$%" "# ## %$ )
$) "# $ ##$) $ "$ #/"$& $" #. #
) $ '$ ) "# "# %"$"
44;
!$ *"$%% &'!$/%%!& & %%!%$+ '$%- $% & !! &! $& % %" !$ %. '%- !'$ $%'&% !& ! +
%'%& && /7 &$"+ "$!!& &/&'!$ % $%"! % !' &!
'&%! &&&' "! &"&)+%+"+ "!$& &$!
0%"! & !'%1(!" &.
!& !'$ !%- ;= % )$ & "!"'&! &$& &
- %'%& && &% % $ & "$! & ' !"! & $( '$! &! . %&!! +%% ! & $ $' ! !'$ $($ ,+"$!' ;=% !%"$!*&+&! '$! %.%%
! !$ &! & %&!! % "!%&/!$& $ %"% ! "& &%98-99. '$ ! !$ '$&$ %'%& && ;= % "+ &!$ $! %"+ %% *"$%% '$ %. !'
! %&$& && '$ % *"$%% %% !'$ ! &$
'&! )&/2 -! $ "$(!'%%&'%4<7.
!$!($-!'$%&
% $! "& &% )& & *"$ & ! %!) %! &$&
'$! % ! &&)&&)!!$!$;=%%'& !'%+.%"! &%!'&
"!%%!!"$&! !$ -&'$&&)%$ &+%!) &! $%
& "$!&+ ! &$& & !% ! ($ &!
4<8. '$&$!$- %&$! "$!'&! ! /2 + &$& !$ + $'/
&$& ;=%!'&&.%!''$&$"$!!&
%%
*"$%%! + '$! %- &'$ $ $ & !$ %'%"& &! +
& /%" ;= %. &$!$ %"'& && &% "&! !$)$ !!" + %! & " ' %. - ! %&'+ $"!$& /2% &'$ &!"& &%;:.'&!$%'$&$"$!"!%&&&
/2 ' ! 43 &% & $$'& & ! 6= ;= % &! & %'%#' &+ & ! /! &! )& "!& &
$%.
453
# ! !"!!% "!! !! !!)!!&"!! !!
""!$!" & !!!" $!
! ! !&) "" !! !
!& ! #& ) &! !&!
!"!*!# ()
!&("! """!" ) !! %!& !! " ! !! $ ! ! & ! !#! ) !#! ! ! !# & "! " ! ) !" !!*!"" ! !&!!"!
"!&(!!(! !&!#!"!"!&)
!&(! !# "" !!"$!
"!! !! !!!! ) +$,
!" $!"!!" & !'!(
!& "! ! ) ! "" ! ( ! !!!" $!!! !&!! $
!"! "!%!! *!#!&)
&( " ! ! ! ! " ! !"! * ! ) ! #!
! " " ! & !& ! ! #! ! " " &( $ ! !! "( "
!!&)
"!! ))!*1" &!!!
& "!)"! 14 !&
! !&34 !!!"! (!
"##!34!-"/2.)
$#($!!"!!!$* *!#!&
!&#" $! !!" & !! !)&"! ("!))
/0/
"$!" & %
'
%(
α
#&
γ
α
#&
()
&)
()
&)
&)
()
()
()
()
&)
α
! γ
# %
%*,+,
% ! & # ' ! & % ! % ! $ !
!%#
# " % !
!
%
$*,+,%"
#+,
"
%
())
$"&% #&&"+$"&
###"(!(#&6878""!$!#% #
##78"!##!"#!#"+!%!),
1 "" # # ( (#" # !!"" # ""+
$!#!!) & "& ## ,6 !#" # % # +
# #"" ! ##" # $#$! & # #!######!!&####,#$!$#(+$!
& #"# #! ( !( !% &( $" " ! *
(##("#/6#!+$! !%$""#$")
&$"#"#(#!###"#!###
# /603,#! &" ,!$#( $" ( #! 78 " # !"" #
372+ #" !,#%# ," " &!
#!"!!#' !""$!"*#"$"#," "-#$#$!#"#%##".&$"#% $!+#!!" $####"#(&$" !%#
# $! + &%!) #" ! ! # "##" & $" &!
## !%#!#" # !"!%##(##,
#$!$#(+!##$!"#' !""%"/603,
#!$#!#!
,3
,3+"$!(#$"#!#
% ,3 ! ,3 # !$#" #!$ # ! + !!) #
&$#!"###"##"#!##"#&$"!#
!%#!###+
%!#"") $!#! "#$" # # $# # '#
"#!(##+$!#!!)&#%"##
&"!!" "!#!,#%#"" !$!
#"#"( !"##78"#"#
345
%
$"&
" " ! "% $ # " ! % ! %
" & !%
$ &%
&)
"!"%
$ " ! & %
'()
?6
!$.*+,!&4 6 6 !" % #%6 :$+.!* &64 @>>G;6
'!5?>6?>?D8GEF7>7?@7AE>CFD7>6>>>>@7>
@6
%(+14664!1463 &46 *,'/*5
&&,&(,!.
!%%-&*+('&++6(((@D>B9@?:@>>A;6
A6
+4 6 64 ! ,%&4 6 6 3 !$$!4 6 # # #%6
:$+.!*-&*+4@>?C;6
B6
&/14 6 64 *.*+4 64 $('*,4 6 3 $'% !#4 6 #%& )"
"' # %!" " !!6 :*$& !&4 @>>?;6
'!5?>6????8"6?BDE7@BGB6?GGC6,>>?@>60
C6
+ !#/4 64 4 6 3 **4 6 6 *-$,+ !&,*$$-$* 7
%!,4,1(
!&,**'&7(&&,!&&,!%%-&!,16"# EFF9G@
:@>>G;6
D6
!&46"(
+)-!*'*
+('&+,'*A,!.,!'&&1(
*'-,!'& !& , +('&+ ' -$,-* '1,+ ,' ,*!$ '&
++&*+ 1$!7!7 & 1$!7!76 ( #( @CGC9@D>?
:@>??;6
E6
*$-&4 64 -%-&++'&4 6 6 3 **, 4 6 &,!%!*'!$ ((,!+
!%('*,&,!&!&&,!%%-&!,16!&
# AGB@9AGC?:@>??;6
F6
&24 6 &+!&+5 &,!%!*'!$ ((,!+ ' !&&, !%%-&!,16 "( $(
#(E?>9@>:@>>A;6
G6
&466&,!%!*'!$*,!.'01&&&!,*'&+(!+5'&(,+&
'&,*'.*+!+6"($( (F@>9FA@:@>>B;6
?>6
!&463')-!+,4667$$,'$*&5&,*$&(*!( *$6 ( !"((?9?C:@>?@;6
??6
*&/$4664*%&4663 *(466 E%!$1*.!+!,6#(
$(#(C?C9BF:@>>C;6
?@6
&,'-*'-,4631146!07'7, 7+,5-&!)-'&,*!-,!'&+'<=$$+
,'!%%-&'$'16"($(#(FF9?>>:@>?A;6
?@C
<>5
13553*+'&3552%+'&355!*'&"
&$%%,"'&& %%$,
$$+5=<;9=;<A:5
<?5
+3 5 5 -$,'*1 $$+4 *'%%&,"'&+ ,' +"%($"1 ,!
&'%&$,-*5
>;B8>;C9=;<>:5
<@5
!-3 53 %&3 5 2 -$3 5 5 "*&,","'& ' ,'* ? $$
('(-$,"'&+5
??@8?CD9=;<;:5
<A5
-*',,' "$$3 5 5 2 "$$3 5 5 ,-*$ & (,". '0(>E
-$,'*1 $$+4 '* ' ,! % '* "."+"'& ' '*7 A=A8A>@9=;;D:5
<B5
-#!*%3553!'-353*%3552"35?E$$+4"*&,","'&
&-&,"'&+5<8<=9=;<=:5
<C5
-"355<>?($-+<>B-$'+,"%-$,"'&"&-+'%+'*%"&
"& ? $$+ ,' (*' *% 1,','0" !< "*&,","'&5 >@@@8A?9=;<<:5
<D5
!& 3 5 2 .&3 5 5 CE $$+4 '', '$"*+ ' ,! %%-& 1+,%5
<A<8<AC9=;<<:5
=;5
&++&3 5 5 ?E $$+ * *)-"* '* +'&*1 0(&+"'& &
%%'*1"&CE$1%(!'1,+5
C@=8C@A9=;;>:5
=<5
"$/3553*,3552!355!%-$,",*'$'?9E:$$+
"&C9E:$$%%'*15
<;=8<<9=;<A:5
==5
.&3 5 5 $("& ,! C9E: 6$$ *+('&+5 @D@8
A;=9=;;?:5
=>5
-*,+35?E$$!$("%("*+CE$$$,"'&"&-1*'++6
(*+&,,"'& ' +$6&," &+ & .'*+ -,'"%%-&",15 =;@B8=;A=9<DDB:5
=?5
&&,,3553*'&3553*%$"+353"$$*3552,!355
&-,"'&
'CE1,','0"$1%(!'1,*+('&+1*'++6(*"%"& *)-"*+' &,
?E$$!$(5
A@8B;9<DDB:5
=@5
-%%','353,,"3553$$*+3531&3552
/+#"35?E$$+
+-(('*, 1,','0" $1%(!'1, (*"%"& 1 '&,*'$$"& $1%(! &' "&(-,5
CB?D8@?9=;<<:5
<=A
@D5
*+$$!&'3 5 # %'#!&* & & !%%,&!+0 0 ,!!& &!- FH $$* +' *!+* ' BH $$6&)!+! $$ !&+)+!'&5 FG>8FGC
9@>>D:5
@E5
&!1,#3 5 # ,%') "+!'& 0 !& !-' %!&!*+)+!'& ' &+!6@C 9
&+)$,#!&6@ (+')=: '&'$'&$ &+!'05 A?@F8
A?AA9?GGG:5
@F5
&355,$+')0$$**,(()**+,%')6*(!!F$$0+'+'/!!+0
+ )', 6;+< *!&$* !& -!-'5 # # # B?G8B@B
9@>>C:5
@G5
')&+'&3 5 5 2 - 3 5 5 BH @CH %%,&'),$+')0 $$*
,(()** '$0$'&$ $$ +!-+!'& & !+)' 0 & !!+!& &+)$,#!& @
)',+!'&5#!##'@FE8@GD9?GGF:5
A>5
&!* !3 53 )-)!3 53 %, !3 5 2 #, !3 5 '/(AH &+,)$
),$+')0 $$* ())&+!$$0 ')% )+* '& &)!+! $$* !& -!+)'
&+!-$0!& !!++ !)%+,)+!'&5#
######?>??A8
F9@>>F:5
A?5
)'$$355 $'#'!%%,& #('!&+*!&&)!%%,&'+ )(05
# #@C@8@DB9@>?@:5
A@5
'$$)353+)*353&)*'&3552, )''355%%,& #('!&+*!&
,+'!%%,&!+05 ?@@8?AG9@>?A:5
AA5
)%3 5 2 $$!*'&3 5 5 %%,& #('!&+ +)+!& !& &) + )(04
'.) '%!&+!'& *+)+!* .!+ ,)+!- ('+&+!$5 @>C8@?B
9@>?C:5
AB5
)%&35
5#&%&+'+ 6?!%%,&'!& !!+')0)(+')0
&'-$ E %!$0 %%) $* +' &+!- ),$+!'& ' $0%( '0+
+!-+!'&5#!##
?>@E8AB9@>>>:5
AC5
&*'%355@F36B&+ !)$!&*4 ''*. +&+'. '%7
"?DG8?EE9@>>>:5
AD5
,)* !355#)&*6&'0+'*!*'F>&FD4%'$,$)*!*')
+ $$6/+)!&*!,&+!'&'6B5%)($#&#D>>8A9@>??:5
AE5
)&!*'3 5 5 # 6? ),$+* + -$'(%&+3 %!&+&&3 &
?@E
)#($#$#)&)!($&-!!'1!!!967;38?4866?51
9>1
*$!/ 1 1 ! $'' $ 2: !' ($ "''* !-"%$%&$!&($# #
(! ")!($&# ('') '(&)($#/ &*!# &(! #(* &)!($&-
&$!$2:1 ;:73;:=47??;51
9?1
(&$)'/ 1 ! -"%$%&$!&(* '$&&' +( &!- !(!(- #
"#(#(!2:1?>;3?>>47??;51
:61
#(! $&/ 1 1 . $"%'$#/ 1 1 ( ( #0 &!#! &($#! $&
2:#27!$ '#&"")#$(&%-1!!8;3
9?4867951
:71
$/ 1 1 ! "%&$* )&**! +( %!")" # (#(' +(
('((!#$"1
=773894867651
:81
& #/ 1 ! $"# *$!)" # %!")" $& $#$(&%- #
#(&(!#$"1
!!!!8939:4867;51
:91
$'($+/ 1 1 ! *$!)" # %!")" *&')' %!")" #
#(&(!#$"1
!!!!7;6:866;968;66?4867;51
::1
"%'$#/11!2%##(%!($#$()"$&2#!(&(#&)!($&-
!!'$2#'(-$#(22:(&%-#'("!#$"1!!
!7<?;3=764867951
:;1
*'($&/ 1 ! #(22: (&%- &$#' ( "!#$"2&(*
>@!!&'%$#'18;:&78>4867:51
:<1
$#/111.!-##/
11%%$&()#'()($"")#'$&&'%$(#((
- "")#2 %$#( #($&' #(22: # #(2271 4867:51
:=1
&(&#/ 1/ $'(#/ 1/ &#(/ 1/ &)((/ 121 . *& / 1
"")# &!( *&' *#(' ''$( +( #(22: #($'0
'-'("(&*+#"(2#!-''1!4867951
:>1
+"/ 1 ! ()(&- ,%&''$# $ 2: (' -%$%-'('
$#&-($"#'(&($#$2:!$ ##($-1!!!
896&:;2896&:;4867:51
:?1
$)&/ 1 1 . !'(&' -/ 1 1 2(' $ %$#( #($&2'
$"#($#(&%-1!!!
96<39794867<51
78>
?:3
!!"(1 3 3 (($)$# $ *)$""*# #%!)( ) $"#
""*# %$#)
#)$'')"#)$')())#'3
=;@A6=;A?7<:;@83
?;3
##$)1 3 '#$%!() #*'$!$ (.#'$"2 %')! %%'$3 @7<:;<83
?<3
!"*1 3 0 $(#!1 3 3 '#$%!() (.#'$"( $ ) 3 =<A6>:7<::B83
?=3
'#1 3 31 #!1 3 3 0 '#!1 3 3 **) $')! '!!'
#')$##
)(!)$#$'#$"93
?C6A?7;C?;83
?>3
'#!!1330$(#'133'#$%!()(.#'$"(#+$!+#)#'+$*(
(.()"3;?>=6?>7<::=83
??3
!"*131*'#*-1331'!!1331'(1330$(#'133))$#$
) #)4* #)$. # ) ('*" $ %)#)( ,) ("!! !! !*# #'44
&*#)))+,()'#!$)#!.((3?>>6?<7;CC:83
?@3
$!#*+$1 3 3 )!). $ #)4* #)$( # ) #$(( $
%'#$%!()(#($'.#*'$%).3CA@6B:7;CCB83
?A3
!"*1 31 '*(1 31 $(#!*"1 3 3 0 $(#'1 3 3 #)4*44(($)
%'#$%!() #%!$".!)(5(#($'. #*'$#$%).3 !#! ()*. $
A;%)#)(3?C6A<7;CC<83
?B3
'*(1 3 $""# #$() ')' $' %'#$%!()
#*'$!$! (.#'$"(3 ;;=?6;;>:
7<::>83
?C3
,($"4+(1 3 "')4)$# .()# .#'$"3 ;AA6;B:7<::>83
@:3
!"*1 31 *'#*-1 3 31 $(#!*"1 3 31 '*(1 3 0 $(#'1 3 3
))$# $ ) #)4* #)$. # (% '$#( $ ) #'+$*( (.()"
# )*"$' '$" %)#)( ,) %'#$%!() #%!$".!)(5(#($'.
#*'$#$%).3;A?A6@>7;CC;83
@;3
'('1 3 31 "$1 3 1 1 0 #.1 3 3 $!/)$# $
#)$. # ) #)'! #'+$*( (.()" $ %)#) ,) %'#$%!()
;<C
&(!$'%0$'&,)"+"*5
;?B=7A8;CC;95
@<5
$)+3553,*+"&3552)&$$355++"'&&+)+%&+'+"-+
$$* "& +! ))'*("&$ $," ' (+"&+* ."+! ()&'($*+" )$$)
&)+"'&5
C7;A8<:::95
@=5
)&$3 5 %%,&'!"*+'!%"$ &$0*"* ' &+"6,6**'"+
()&'($*+"&(!$'%0$"+"*5
?:C7;?8<::<95
@>5
$)+3 5 5 ,%')6*("" #"$$) $$* "& ()&'($*+" )$$)
&)+"'&5
;=<;7>8;CCB95
@?5
')+*3 5 5 +"&+* ."+! $,& &) & ()&'($*+" ,
*0&)'%!)'),6*(""+0(<BD$$*5
<:><7
<:?;8<::C95
@@5
"&355
%%,&'(+!'$' 0',+'&+"'06**'"+&(!$"+"*4
$,*')(+!' &*"*5;@<<7=B8<:;<95
@A5
& 353)0353.*'%6-"*353"&&+352,))035
8695
<<>7<<@8;CB;95
@B5
%"++3 5 5 )&'($*+" )$$) +/" , +' ,+'&+"'"*
"&*+$,+%+(+')5
<;7<A8<:::95
@C5
,)&,/3553"!352'*&)355,+'&+"'0*0&+!*"*"&+!&+)$
&)-',* *0*+% ' (+"&+* ."+! ()&'($*+" *0&)'%*5 ;:B?7;:C;8;CC:95
A:5
,3 5 53 .++3 5 5 2 +!"*'&3 5 5 **"- +)&*) ' %)+6+'&
%0*+!&" *0&)'% "&,* "!0)'(0)""& *&*"+"-"+0 ' "& %',*
%'+')&)-+)%"&$*5
;:?@7@C8;CCB95
A;5
$"෠+!"*'&355**"-+)&*)'%)+6+'&*0&)'%+'
%" "&,* "!0)'(0)""& *&*"+"-"+0 ' &,)'%,*,$) +)&*%"**"'&5 ?@A7?A@8<::<95
A<5
,#,& 3 53 & $3 5 53 & 3 53 .*'%6-"*3 5 2 "&&+3 5 **"-
+)&*)'%)+6+'&%0*+!&"*0&)'%."+!
)'%%&+'%',*
($+*+!()*0&(+"%%)&+"-1'&*5
A@=@7>:8;CB=95
A=5
;=:
& 3 53 .*'%6-"*3 53 )"')3 5 2 )03 5 &+"'"* +' %'+') &)-
+)%!&$*4 & $+)'( 0*!'$'!$ *+,0 ' ,%& %0*+ &! *0&)'%
+)&*))+'%',*5>>@8?@9<DC>:5
B?5
(!$$&35
%)+6+'&*0&)'%
!& !!+*+)&*%!++))$*-!
7=E &&$*5@B@8@BD9=;<@:5
B@5
!1$6)-$$'3 5 5 2 &#'-!3 5 +!6()*'& *0&)'%4 !&*! +* !&+' '%($/ ,+'!%%,& !*'))5 C?;8C?C
9=;<?:5
BA5
$%,3 5 )&'($*+! &+!66%+ 0$66*()++ )(+')
&( $!+!***'!+.!+ '-)!&+)+'%5=@8>A9=;;B:5
BB5
!&&+353!&3553
)&!3552+)*35,+'&+!'!***'!+.!+ !*** ' + 4 . -$'(%&+* & ,+,) $$&*5 B@D8BB=9=;<<:5
BC5
 53  53 &')3 5 2 *,"!3 5 )!$ +' *+$!* & &!%$
%'$ ' ()&'($*+! )$$) &)+!'& .!+ &+!6' &+!'05 <5
',* *+)!&* )!& !)&+ %'$,$* ()', &+!'!* '&
!%%,&!1+!'& .!+ )'%!&&+ ' ()'+!&3 ,+ ' &'+ ,* ,)#!&" $$
$'**5
D@8<;;9<DD@:5
BD5
!$$-!* %!++3 5 3 &$03 5 5 2 '*&)3 5 5 %%,&!1+!'& .!+ + ()&'($*+! &( $'%0$!+!* &+!& , '* &'+ ,* &,)'$'!
!**!&%!5<CB>8C9<DD@:5
C;5
)(&+!)3 5 5 -!&+!'& .!+ , !& !!+* )'.+ ' &,)'$*+'%!&%!5
=C<D8=?9<DDC:5
C<5
',**,3 5 $$ )*('&* +' ,6 ((+!* !& (+!&+* .!+ &+!6,
*0&)'%5=><8A9=;;@:5
C=5
&0 !35
$$6%!+,+'!%%,&!+0!&()&'($*+!&,)'$'!$
*0&)'%*.!+ &+!6,&+!'!*5<A=8B9<DDD:5
C>5
&3 5 53 $%,3 53 '3 53 '*&)3 5 5 2 & 3 $%, 3 ' 3 5 5
&$0*!* ' + *,$** !*+)!,+!'& & !&$%%+')0 !&!$+)+* !&
(+!&+*.!+ &+!6,6**'!+()&'($*+!&( $'%0$!+!*5
<?;8<?B9<DD?:5
C?5
'$+1353$%,353'*&)3552'*&$3556$$)(+')&$0*!*!&
<><
',"7-++(",)*'()%+,"')!%(&0%","+6==@B8A<
9=EED:6
DA6
"%-3663('1%17-'"363"'%362"))36-*('++,* ,+(*
%%+"',!'*.(-++0+,&6?=A8?>@9><=?:6
DB6
+!""3 63 -*3 63 *'*7%',3 6 2 "%-3 6 -*('+ ' %%+5
'*+,'"' ,!"+ "',*,"(' (* "'%&&,(*0 '-*(%( "% "+++6
>C=>8>C><9><=A:6
DC6
(*,+3 6 6 +,*-,". $ %(() &", 0 =< "'
',*% '*.(-+ +0+,& "'%&&,(*0 "++6 B=E8B>E
9><=A:6
DD6
-' 3 6 6 7;7
'-"% *(,"' =< 9
7=<4 =<:7""', "
.% (% (* 7=< "' ,(* %% '*,"(' ' *"$"' 6 ?=EA8?><@9><=B:6
DE6
' "(%"%%(3 6 6 -&' "',**('7"'-"% )*(,"' =< "+ )(,',
"'!"",(*(' "( '+"+"'.".(6
=AA8B>9=EEA:6
E<6
!*"+,'+'3 6 63 &(+3 63 ((+3 63 !*"+,'+'3 6 6 2 !(&+'3 6 6
=< "+ ,! $0 %" ' (* ? (' DF ,(* %%+ "'.(%. "'
"&&-' +-*."%%' ( ,! %0&)!(0," !(*"(&'"' ","+ ."*-+7"',
',*%'*.(-++0+,&6@>?A8@?9><<B:6
E=6
!' 3 63 !'3 6 63 -3 63 "&('3 6 6 2 %"'3 6 6 ? &",+
* "('7+)"" ',"."*% %% ,*"$"' /",!"' ,! ',*% '*.(-+ +0+,&
-*"' +,"%."*-+')!%","+6
>B@=8>B@E9><<D:6
E>6
,*+('3 63 (+'%-&3 6 63 (,'"+3 6 2 (+'*3 6 6 *'()%+,"
*%%* '*,"('6 6 %"'"% '%0+"+ ( AA ',"7( ',"(07)(+",".
),"',+6=E?=8C9=EE>:6
E?6
'*+('3 6 63 (+'%-&3 6 6 2 (+'*3 6 6 *'()%+," *%%*
'*,"('5 %"'"%7"&&-'(%( "% (**%,"('+6 AAE8BC
9=EDD:6
E@6
*'%3 6 6 2 *+!*3 6 6 ',"("+ ,( *%%* -*$"'# %%+ "'
),"',+/",!)*'()%+,"*%%* '*,"(''(.*"'*"'(&6
B<E8B=?9=ED?:6
=?>
EA5
'))!3 5 53 &3 53 )&$$3 5 53 $%,3 5 2 )&$$3 5 5 ('*+6
+)&*)!(+!'&$ ),$+')0 % &!*% )*+)!+* /()**!'& ' + ()&'($*+! )$$) &)+!'& &+!& )> +' !%%,& ()!-!$
+!**,*5!!=@<B9=A:=EEC;5
EB5
#&'3553)#3553'))!3552)&$$355 0+'($*%!,)#!&"
'&'&,)$ &+!& )> '.&6),$+* 60 ,&+!'&4 %($!+!'&* ')
&,)'&$&+,%')$$*,)-!-$5!><DC9><EC:=EEE;5
EC5
7'&'-&3 5 53 !$)3 53 ',+,)3 5 53 #3 5 5 2 )&$$3 5 5 '&'&,)$ &+!& )> !* &'-$ 8 +)+ + + +* !& %!+'*!* +'
),$+60+)+&*!&%%%$!&+,%')$$*5
:><=<;5
ED5
)&$$3 5 53 $)+3 5 5 2 )&$$3 5 5 )>3 +)+ &+!& ' &+,)$$0
',))!& ,%& +,%') !%%,&!+03 !* .!$0 /()** !& 0&'$'!$
+,%')*5!>=?B9>=?E:><<<;5
EE5
')'.*#!3 5 53 (10&*#!3 53 '.#6)#.!+13 5 2 ! $#3 5
)&'($*+! &,)'$'!$ *0&)'%* **'!+ .!+ '-)!& +,%')*5
EE9=<D:><=A;5
=<<5 03 5 5 ! D ('*!+!- 6$$ !&!$+)+!'& !& + &++ &,$,* '
()&'($*+! )$$) &)+!'&5 ! ! =?B9=@<
:><<E;5
=<=5 )* &,)&3 5 ! &$%%+')0 !&!$+)+* & '%($+ *& '
,)#!&" $$* !& &+!6'6**'!+ ()&'($*+! )$$) &)+!'&5
!A=E9A>A:=EEB;5
=<>5 +')*+!&3 53 )'**&*3 5 5 2 $)3 5 5 ')( '$'!$ &
!%%,&' !*+' %!$
)+)!1+!'&
'
()&'($*+!
)$$)
&)+!'& **'!+ .!+ 0' &+!'!*5 B@9BC:><<E;5
=<?5 !'%++'3 5 ! ,6,+ )$$) &)+!'& .!+ &+!6'
,+'&+!'!*4!%%,&' !*+' %!$&$0*!*'+ !%%,&)+!'&!&+ &+)$&)-',**0*+%5!!!@BD9C@:=EEC;5
=<@5 ,)+3 53 &"3 53 ,&3 53 )% %3 5 5 2 $)3 5 5
)&'($*+! > & > &+!'!* + ,)#!&" $$ $!,%
=??
!(&(,-,",7E@B:EB?;?=>A<7
>=B7 "!%+5 7 7 ? '-"(",6 0 %2+ "' +'()%,-"
+%%+ '+-"('7;?=>@<7
>=C7 $'(5 7 7 4 +'%%5 7 7 !"++!2 ( . "'"' )+(-"', "'
/%()"' '.%-'.+(',7@=?A:@D;>FFD<7
>=D7 ("'(05 75 &)(,5 75 (5 7 7 4 !"-5 7 ! %/ ' )+(.- (
+(,()!"%5 +*."+ "' '.+(',5 !, -!+ (',',., &(-",7 >BD=:?;>FEE<7
>=E7 ("'(0574!"-57!+-+"3-"('',)-"%",-+".-"('(-!
)+(-"' .+"' +(,()!"% &%'( ,-+ /%()&'-7 AA@:
C>;>FF><7
>=F7 ++('8"33(3+(5 7 4 (%( ''"5 7 (% ( . ' (-!+ 8"'"' )+(-"', "' '.+% /%()&'- ' )%,-""-27 >?>:>?C;?==?<7
>>=7 (%( ''"574++('8"33(3+(57
78)+(-"'"'-+-"(','('-+(%
( & ,-"%"-2 "' '.+(',7 AE>:AEF
;?==E<7
>>>7 %%'57.+(&(-,1)+,,"('"'+"'.+(',/"%-"/
-"%"3-"('(-!(' @999&7;?=>@<7
>>?7 .#"0+57.'-"('%'"+-"'-+-"('-0'-!"'"' )+(-"'.'-"/$->7
>FAA:>FB@;?=>?<7
>>@7 ,,!"&5 75 +,!"&5 75 &&(-(5 75 $,!"-5 7 4 $&(-(5 7
2-()%,&" %(%"3-"(' ", +*."+ (+ -! &&&%"' 8%"$ )+(-"'
.-("'.'.+('%"+'-"-"('7CCD:CE@;>FFF<7
>>A7 '$5 75 "' 5 7 4 '$5 7 -, ( '-"'.+('% '-"(", +(&
)-"'-, 0"-! )+'()%,-" '.+(%( "% ,2'+(& (' )+"&+28.%-.+
'.+(',7?B:@=;?==A<7
>>B7 '%25775&"--5775%&.574(,'+577.'-" ',6-"/"-20"-!
.'-"(",5-.&(+1)+,,"('5'&#(+"&&.'( '","-,7
>=?:>>=;>FFB<7
>>C7 %&.5 7 #(+ !",-((&)-""%"-2 )+(-"',5 '-"8. '-"(",5 '
>@A
$&"#$ '( "$ #!- (' " ")&# '(#! " '! )"
"&2BB5:9B6:BB>72
::@2 &)'02 "(3)3''#($&"#$ '("$ #!- ('C1" -''
#;99$("('2::<A5::=A6;99:72
::A2 &)'0 2 !!)"#'(#! " -'' # ( !!)" &(#" " (
"&*#)''-'(!"$&"#$ '("$ #!- ('2;:B5;;;
6:BB972
::B2 # (.0 2 20 #'"&0 2 20 !)0 2 / &)'0 2 &"#$ '(
"$ #!- ('1 " )$( # ( (' # ( "(3) !!)" &'$#"'
#"("&*#)''-'(!"()!#)&2 :<<5?
6:BB@72
:;92 #"%)(0 2 # #" 3 ' " ## " (&( ('')' # $("('
+("(3)'-"&#!2 :995:9>6;99;72
:;:2 )&"(022"&3# # $$ A=:5A=@6:B>@72
:;;2 )""0 2 20 &)0 2 20 0 20 0 2 2 / &&0 2 2 "&
!!)"#("1&#!!!)"#')&* "(#()!#&'$2 BB:5BBA6;99;72
:;<2 (&(0 2 20 &("-0 2 / !-(0 2 2 &#&" " "(&&#"3!!
(*(' "$""( - #"(&# ()!#& "((#"0 &#+(0 " !('(''2
:B;5@6;99:72
:;=2 0220&'020 022/&&022"""**#&#+(
"&''("(#&(#"#()!#& ',$&''"#!""("(*
8
&$(#&'2==@5=>?6:BB=72
:;>2 *"" &'()!#&')&* ""$&#&"3"(
!2 :@A:5B96:BB?72
:;?2 "&"0 2 8 " -!$#-(' $&*"( $&!&- ()!#)&
* #$!"( " '$ ()!#)& !!)"#"(-2 ::9@5::::
6;99:72
:;@2 (#" "&
"'(()(
6
72
&(&*
;9:?
* (1
(($144+++2"&2#*4#)(3"&4)"&'(""4+(3'3"&2
:;A2 ##$&0 2 2 / )'!"0 2 2 "!
:<>
#!/0+!"#!,9$!""#"<A??F=9
@AH9 &7994$$%&7
9&'$'0%,+!%%-&'$'08 &*:!%%-&!,0
0$9$#(@;@?<A?@B=9
@B?9 !&7 97 $+'&7 97 !,*7 9 9 4 *!&7 9 '*!!&+ ' &*
*'-+,&++&.'$.!$!,09#!))-.)@F;B?<A?@@=9
@B@9 & &7 9 4 '-++&+7 9 9 ++'*!+ ,' , *!%8 -&,!'&+ ' $$+
*-!,,', -%'*!*'&.!*'&%&,9!B?H;BAA<A?@A=9
@BA9 $-#7994'-++&+799""$(9@ABB;
@ACF<A?@E=9
@BB9 ,*7 9 4 !,1%&7 9 9 *'&! !&$%%,!'& & &*9 (
-"#!.)A@F;AAE7AAH:ABA<A??A=9
@BC9 -&&7 9 97 $7 9 9 4 *!*7 9 9 !%%-&'!'$'0 ' &*
!%%-&'+-*.!$$&&!%%-&'!,!&9$#(@BF;@CG<A??C=9
@BD9 #7 97 $7 9 9 4 *!*7 9 9 *'$+ ' > !& (*',,!'& !&+,
,-%'* .$'(%&, & &* !%%-&'!,!&9 (# !&# #!
%&"HD;@?H<A??A=9
@BE9 *&!+1#!/!17 97 '!++'&&+7 97 '-,,7 97 '%!2*7 9 4 %!:
'-!7 9 '$ ' %'#!&+ & %'#!& *(,'*+ !& + (!& , ,'*( +', &,!,-%'*!%%-&*+('&+9!"!EBAD;
EBBA<A?@A=9
@BF9 3 **7 9#) -%'-*:!%%-& $$ !&,*,!'&+ %'-$, 0 %'#!&+9
' !# ))!)AEH;AH?<A??G=9
@BG9 ((0797'-#7994*!799GI$$!0!&.!&,!'&&
!++9
#))<A??G=9
@BH9 ,!7 9 4 -%*7 9 &*:!%%-& )-!$!*!-%8 -+,!'&+ -&&+/*9
!!%!#A?H;A@F<A?@@=9
@C?9 $#/!$$7 97 *$+7 9 9 4 &,'.&!7 9 %'$*!& & ('$*!1
!&$%%,!'&!&, !&!,!,!'&&(*'%',!'&'%$!&&,!++9!
A@@;A@F<A??D=9
@C@9 -++ &797*!!'&7994 !"++&799$,!&:H!&,-%'*!'$'08
"# ' %-$,!($ ,*+9 # (" # * %&" !
@BE
<BB8<C@9=;<>:3
<?=3 )'&(1 3 ! ()* %( %)*(+*) %( * ##) *& '( $ %*(#+" %
<>8)(* %?E##)** # ***+$&(,#&'$%*3! !!
<;>B8<;?B9=;;B:3
<?>3 (13!(&')%*') %'(&*))#+%*$&*('+* ()'&%) %()*%(3!=?A@8=?BD9=;<<:3
<??3 &,13!
4? %+)*') %'(&*)* , */ %*+$&(4))& *
$(&')*&'(&$&*%((&-*% %,) &%3!=?<8=@@
9=;<;:3
<?@3 ##/(1 3 31 $)&%1 3 0 ( )1 3 3 =4$ * %* 4*+$&+( $$+% */2
( %&(&5
<8<<9=;;B:3
<?A3 #(*1330(%##133(%&'#)* %+(&#& #%(* &%)2"/)
*&*+$&+( $$+% */3
!!>A8??9=;;?:3
<?B3 &)%#+$1 3 3 (%&'#) % +*& $$+%&#& %!+(/ & * %(,&+)
)/)*$2*%* 4+)/%(&$3!<DD8=<=9<DD>:3
<?C3 (+)1 3 ! %* 4+ %* & ) % '* %*) - * )$##4## #+% %(2
))& * &%- *&$'#*()'&%)*&*('/% $'(&,)+(, ,#3!!
!=CAA8=CB=9<DDB:3
<?D3 &&'(1 3! ')&#&%+)4/&#&%+)4*. /%(&$ % +(&#)*&$F2
)*&'*&#& *+()'&(*(&$* #(%6)%((&+'3!
!!A=>8A=D9=;;<:3
<@;3 "/1
33(,#)%*(, #)&+*& $$+% */2 )*&( #!&+(%/(&$
)&,(/*&( )&,(/3!!=@<8=@C9=;<;:3
<@<3 %1 3 +*& $$+% */2 (&$ #" -*( ,( *& (+#*&(/ +%* &%3 !
!<8D9=;<?:3
<@=3 +*& $$+% ))) &&( %* % &$$ **1 9:3 (&()) %
+*& $$+% ))))((&())3* &%#
%)* *+*)&#*3<8<=D
9=;;@:3
<@>3 $( % +*& $$+% #* )) ))& * &%3
%3 , ## *2
**'277---3(3&(3
<@?3 &&'(1331/%+$1330&$()133%*
%) *) %*' $ &#&/
<>B
'-,'!%%-&!+++5
%(*'.*.$&+,!%,+&&*+,&!&
'$-+,*!&'!+++6>FD:?=D;?=>=<6
>BB6 '+4 6 6 *!,!'& & (*.&,!'& ' -,'!%%-& !++ !& , ?>+,
&,-*15*.!/&(*.!/6A=@:
A=C;?=>C<6
>BC6 '.*%&46-,'!%%-&$$*+('&++!&, &,*$&*.'-++1+,%6
!
!!@F@:A=D;?==F<6
>BD6 .!+'&463!%'&46-,'!%%-&!+++6
@A=:@B=;?==><6
>BE6 (,+4 6 , '$'! &,'%1 ' , (&*+ !& "-.&!$ !,+ %$$!,-+6
C>F:C@@;>FCB<6
>BF6 -+*4 6 6 ! *.&,!'& ' 0(*!%&,$ $$*! &( $'%1$!,!+
;< !& , 9 %'-+ 1 / '$ '1 -$,*.!'$, !**!,!'&6 ! !
" !%'&$#>?DC:>?E>;>FEA<6
>C=6 &$4 6 6 64 *&-4 64 '!,*4 6 3 4 6 6 1&&! *&+* '
-,'!%%-& !,+ *'% !,! %! ,'
$, 1 &'&,+5
)-!*%&, '* ', @A 8 & 1,7? G $$+6 !! E?@:E@?
;>FED<6
>C>6 &7-&463&'46,,!'&'-,'!%%-&$$+(*'$!*,!&,'%1$!&
+! (*',!& & +$,!'& ' $$ $!&+ , , %!, 0(*!%&,$
-,'!%%-& &( $'%1$!,!+ ;< !& %!6 >?=B:>?=F
;>FE@<6
>C?6 *,7*&&2466 &!+%+'-,'!%%-&!,1!&, &,*$&*.'-+
+1+,%5 !+,-*& ' &,-*$ -,'!%%-&!,14 !&,!'-+ &,+4 $$
'&,*!-,!'&
&
&,!'1
+!&,-*+6
@A=:@C>;?=>A<6
>C@6 $+'&466!$$(,'**'++7,!.!,1,/&!%!$*'*!&
& $ (,!+ &$-&+ !. $$ '(-$,!'& !2 & -,'!%%-&!,16
FB:>=D;?=>B<6
>CA6 &-$14 64 #4 64 !+!*#4 6 3 !2!+4 6 *'$ ' &*!,! $$+ !&
-,'!%%-&!,16
!!!BCC:DD;?=>@<6
>CB6 $*,4664, +&463*&$$46&*!,!$$%,-*,!'&!+*)-!*
>@E
%')'%((5)%"'/)%$%AC""(4
%%:9:96:9:@7;99:84
:??4 ))"2 4 4 = ""(3 "$$ ) %#$ $ %$ % *)%##*$5
#) $"##)%$ $ ) 4 $ $ # =;:6
=<97;99A84
:?@4 -$2 42 ')$5"%$"2 42 '(2 4 4 1 "*2 4 4 %" % A ""
(*()($)&)%$((%#*")&"("'%((4%<@>A6<@?<
7;9::84
:?A4 ")'2 42 $)#'2 42 *" '"$2 42 $5'$0%( 2 . 1
!*24AC""($*)%##*$).('+,%#('%#)#
((*%$*)%##*$).)4%%%?;=6?<:7;99>84
:?B4 *#$$242$2
442*'241((#$$24.)%)%-".#&%.)(
$*)%##*$$$')+(((4
%<:<6<:B
7;99;84
:@94 #2 4 42 (#*(($2 4 4 1 *$(!.2 4 4 *")%'. ""( &'+$)
)()'%&*)%##*$).)'%*%*))"(&$%#4
%%
:B:6:B@7;99@84
:@:4 *"%%$244%
##*$%"%&'+"$)$)'"$'+%*((.()#$
)"%%5'$'''4%%!%:<6;:7;9:<84
:@;4 $(%%2441$"')24$)%#"$""*"'((%##*$
(*'+""$ $ ) $)'" $'+%*( (.()#4 % % % ?;<6<>
7;9:;84
:@<4 )/2 4 1 $"')2 4 '$ '''(3 '%(()"! ),$ %#&"- ))
*$)%$($'$( *$)%$(4%%
=B<6>9?7;9:>84
:@=4 #(!2 4 % '$)" '%"( % #'%" $ #%$%.)( $ )
$"#$)'"$'+%*((.()#4%"%%:><<6=B7;9:=84
:@>4 "2 4 % $ $)$5(& &),. %' A ""( '%(( ) "%%5
'$'''4%"%%;9;<6<97;99@84
:@?4 "*2442%$2442'(2441$)#'24*)%')+A""(
$ %'$5(& *)%##*$).3 #'$ )')( %' )'&*)
$)'+$)%$4#:6?7;99;84
:@@4 ((#$$2 4 &)%"%. % #*")&" ("'%(( $ )( +%"*)%$4 %
:<B
>C@B8A=9>FFF:4
>DE4 2 4 42 (&&2 4 4 4 1 ))#$$2 4 4 *%"%" #$)#) $
&(%()),#+"*&")"(%))4
>E@8>F@9?=>B:4
>DF4 $"(*2 4 1 $)%%2 4 4 &*+(2 (-"2 (%))3 "" % *%
(*"%%5($((()4 BDF8BEF9?=>?:4
>E=4 (*$5"%$"2 4 (*%$ % $&"*%$ E "") $*% *
$*(" $(,%+) )/)*# ) &$$* %$ * ;A<>5$*($4 @@=?8@@>?9?=>B:4
>E>4 "*$/242+$242+!!241**""24+**$3"%))%;A$*($
.&())%$($*""/*)*%#$%>$>D"")4 C>DC8F9?=>>:4
>E?4 %*##(24 >D"/#&%/*)*(*%*$*("$(,%+))/)*#
$&$$*"/%;A$*($.&())%$+($4 ?ACB8
DC9?=>>:4
>E@4 "2454 +*%$*%/5%%)*5""(*,*%$$**(*%($
*(()#$)**%$%+*%##+$))4 @@?@8@@?E9?=>C:4
>EA4 +$$$#242(+)242$()%$241%)$(244(*"(*(0*%$
% * +(!$ "" $*$) $ &($%&")* (""( $(*%$4
>>C@8>>CE9>FEC:4
>EB4 (+)242"!%$2442%(%$5(%241%)$(244$)%(/$+(%$%&*/
$ )#"" "" "+$ $(4 $*$+(%$" $*%/ ** ")% (*) -* *
*+#%(4 AB8B?9>FEC:4
>EC4 !242(!-242*-242241(%)24
$+*%$%/*%*%.
"/#&%/*) )& %( &($%&")* (""( $(*%$5))%*
$*$$,,%/##+$0*%$4 ?FD8@=?9?==>:4
>ED4 (0%2 4 4 +#%(5)& AG "") , # %( 6&%)*5"$)$7
(%" $ #* $*5*+#%( ##+$*/4 C=AD8C=BB
9?===:4
>EE4 %)241(#$244AG5"""&$**+#%(#"+)('+(%(
((+*#$* $ /*%"/* +$*%$ % EG "/#&%/*)4 >A=
>9<>3>9==4867651
7>?1 (%%/ 1 . '-"%/ 1 2& !"&! #% !"'"" & 2
'# %"1;;93;<:47??851
7?61 #%&"/1> # %"'#(!#%2&&#' 2"'"
&)%&,: &""%#+$%&&'! $'#%1
76>6376>?4867;51
7?71 %/ 1 1 & '%'" "(%#" $%"#$ &' "'"
!' '(!#% %'#" " '%% ('#!!("', *' (!#% ')'#"198:6398;74867:51
7?81 "# '/ 1 1/ (%/ 1 1 . (/ 1 1 !!("#$'#"&& #
$%"#$ &'"(%# # &,"%#!&&&#'*'"'2("'#&0
" "''(!#% !!(" %&$#"& #" *%,1 8=9>:4867951
7?91 '#/1>@ &
" '%'*'""% &'&&%#"#&'
'#%"(!"# #%' "%19:?739:?:47??>51
7?:1 #"" /11/("/11/'*"/1.'-/118245"8245
%( '% % #"2'%!$%&&#"" !'!#'#% %""1
<=>:3<=>?4866?51
7?;1 / 1 ")# " $', # ,'#'#+ & & !' "
")# )& ,"! "'%'#"& " ##$%')',1 8993
8:;4867<51
7:7
#!"$
"%$
REVIEW
PAPER TYPE
OncoImmunology 2:12, e27384; December 2013; © 2013 Landes Bioscience
Immunopathogenesis of paraneoplastic
neurological syndromes associated
with anti-Hu antibodies
A beneficial antitumor immune response going awry
Béatrice SL Pignolet1,2,3,4, Christina MT Gebauer1,2,3, and Roland S Liblau1,2,3,4,*
1
INSERM-UMR1043; Toulouse, France; 2CNRS, U5282; Toulouse, France; 3Universite de Toulouse; UPS; Centre de Physiopathologie Toulouse Purpan (CPTP); Toulouse, France;
4
CHU Toulouse Purpan; Toulouse, France
Keywords: anti-Hu syndrome, autoimmunity, cancer, central nervous system, paraneoplastic neurological disorder
Abbreviations: BDNF, brain-derived neurotrophic factor; CNS, central nervous system; CSF, cerebrospinal fluid;
DRG, dorsal root ganglia; ELAV, embryonic lethal abnormal visual; PBMC, peripheral blood mononuclear cell;
PEM, paraneoplastic encephalomyelopathy; PND, paraneoplastic neurological disorder;
PSN, paraneoplastic sensory neuronopathy; SCLC, small-cell lung cancer; TCR, T cell receptor
Paraneoplastic neurological disorders (PNDs) are syndromes that develop in cancer patients when an efficient antitumor immune response, directed against antigens expressed
by both malignant cells and healthy neurons, damages the
nervous system. Herein, we analyze existing data on the mechanisms of loss of self tolerance and nervous tissue damage
that underpin one of the most frequent PNDs, the anti-Hu syndrome. In addition, we discuss future directions and propose
potential strategies aimed at blocking deleterious encephalitogenic immune responses while preserving the antineoplastic potential of treatment.
Introduction
Paraneoplastic neurological disorders (PNDs) are neurological manifestations associated with cancer that do not originate
from tumor growth or the metabolic, infectious and toxic complications of malignancy and/or its treatment. This group of syndromes is highly diverse in terms of tissue damage and clinical
signs. PNDs develop in the frame of naturally occurring antitumor immune responses. The targets of such an immunological
response against malignant cells are self antigens physiologically expressed by the normal nervous system and ectopically
expressed by cancer cells. One of the most frequent PND is the
paraneoplastic encephalomyelopathy/paraneoplastic sensory
neuronopathy (PEM/PSN). PEM/PSN has also been named
anti-Hu antibody-associated (or simply anti-Hu) syndrome, after
*Correspondence to: Roland S Liblau; [email protected]
Submitted: 10/28/2013; Revised: 11/29/2013; Accepted: 12/01/2013; Published
Online: 12/10/2013
Citation: Pignolet BSL, Gebauer CMT, Liblau RS. Immunopathogenesis of
paraneoplastic neurological syndromes associated with anti-Hu antibodies:
A beneficial antitumor immune response going awry. OncoImmunology
2013; 2:e27384; http://dx.doi.org/10.4161/onci.27384
www.landesbioscience.com
its linkage with high circulating levels of anti-Hu antibodies has
been appreciated.
Clinical Aspects of the Anti-Hu Syndrome
In 85% of the cases, the anti-Hu syndrome is associated with
lung cancer, mostly small-cell lung cancer (SCLC). More rarely,
it develops in association with extrathoracic neoplasms such as
neuroblastoma or intestinal, prostate, breast, bladder, and ovary
carcinomas. Some patients affected by the anti-Hu syndrome
present more than one primary cancer. Neurological manifestations compatible with the diagnosis of PEM/PSN have been
observed in 1.4% of 432 SCLC patients and much more rarely in
individuals bearing other types of cancer.1,2
A polyclonal antibody response against nuclear antigens
expressed in the central nervous system (CNS), enteric neurons
and dorsal root ganglion neurons, but not in other adult normal tissues was first identified in 1985 in 2 patients presenting
SCLC associated with subacute sensory neuropathy.3 The expression “anti-Hu antibodies” was coined based on the first 2 letters
of the surname of these patients. Anti-Hu antibodies were soon
detected in multiple patients manifesting a rapid development of
diverse neurological manifestations, including sensory neuropathy, cerebellar ataxia, limbic encephalitis, brainstem encephalitis,
myelitis, or intestinal pseudo-obstruction. Anti-Hu antibodies
are in fact frequently detected in multiple of the above-mentioned
syndromes occurring in a paraneoplastic context. Interestingly,
high titers of anti-Hu antibodies are absent in SCLC patients
who do not exhibit neurological disorders.
Of major clinical importance, these neurological manifestations precede the diagnosis of the cancer in more than 80% of the
cases. Therefore, the detection of high circulating titers of antiHu antibodies in patients with a neurological condition indicates
a paraneoplastic syndrome and should lead to a very thorough
search of the underlying neoplasm. In some instances, the tumor
OncoImmunology
e27384-1
is discovered only post-mortem or never, indicating either a complete disease regression4 or the occurrence of such autoimmune
neurological manifestations independent of neoplasia. Indeed,
cases of limbic encephalitis associated with anti-Hu antibodies
but not with cancer have been described in children.5 A spontaneously regressing or occult neuroblastoma cannot be formally
excluded in these rare cases.
Interestingly, tumors exhibit a significantly less severe course
and a lower propensity to generate metastases in patients with
PEM/PSN than in patients who do not develop PNDs.6,7 The
effect on tumor spread and overall survival is however moderate, and only 30% of patients survive for more than 2 y.7,8 In
as much as 60% of the cases, the prognosis of the patients is
determined by the outcome of the neurological disorders rather
than by tumor progression.9 Of note, SCLC patients who do
not manifest PNDs but harbor low titers of anti-Hu antibodies
experience tumors of low stage, frequently respond to therapy,
and live longer than cancer patients not producing anti-Hu antibodies.10,11 These findings reinforce the hypothesis that effective
antitumor immune responses targeting Hu antigens may be dissociated from autoimmune manifestations.
As anti-Hu antibodies bind to antigens expressed both in
malignant cells and healthy neurons, it was tempting to hypothesize that the anti-Hu syndrome could be an autoimmune disease
triggered by cancer. This is reminiscent of vitiligo, developing in
certain cases of melanoma,12 although in the case of PNDs, the
cells targeted by the autoimmune process belong to a different
tissue than their malignant counterparts, i.e., the immunoprivileged CNS.
Hu Antigens
Hu antigens in healthy neurons
The search for the molecular targets of anti-Hu antibodies led
to the identification of 3 proteins of approximate molecular weight
of 35–38 KDa expressed in the CNS. In malignant cells, the 38
KDa band is not detected. Screening a cDNA expression library
from the human cerebellum with the sera of patients affected
by the anti-Hu syndrome allowed for the cloning of the highly
homologous genes HuD (official name: ELAV like neuron-specific
RNA binding protein 4, ELAVL4), HuC, (official name: ELAV
like neuron-specific RNA binding protein 3, ELAVL3) and HuB
(official name; ELAV like neuron-specific RNA binding protein
2, ELAVL2; also known as Hel-N1). The Hu family actually consists of 4 members: HuA (official name: ELAV like RNA binding
protein 1, ELAVL1; also known as HuR), HuB, HuC, and HuD.
These proteins share extensive homology and are highly-conserved across species.13 HuA, the most divergent, is ubiquitously
expressed13,14 and is not recognized by paraneoplastic antibodies.
In contrast, HuB, HuC, and HuD expression is restricted to neurons, which all express one or more of these proteins.13
The Hu proteins are highly homologous to the Drosophila
melanogaster nuclear protein ELAV (embryonic lethal abnormal
visual), which plays a key role in neuronal development.15,16 HuB,
HuC, and HuD operate as neuron-specific RNA-binding proteins. They contain 3 distinct RNA recognition motifs that bind
e27384-2
to AU-rich sequences, which often characterize the 3′ untranslated region of mRNAs and control their expression.17 Indeed,
the Hu proteins have been implicated in mRNA stabilization
and RNA turnover.18,19 Among various target mRNAs, HuD has
recently been shown to bind, hence stabilizing, the brain-derived
neurotrophic factor (BDNF)-coding mRNA.20 Moreover, neuronal Hu proteins have been shown to bind pre-mRNA species, thus
regulating their alternative splicing.21 HuD is highly expressed in
the nucleus, but also translocates to the cytoplasm, where it localizes within small granules.22 The cytoplasmic localization of HuD
appears to be essential for neuronal differentiation.23 In addition,
HuD has been shown to interact with AKT1 to trigger the outgrowth or neurites.24 Thus, Hu proteins, in particular HuD, have
a major impact on multiple key neuronal processes.
Hu antigens in malignant cells
Whereas HuB, HuC, and HuD are all expressed in CNS neurons, HuD is Hu antigen most frequently expressed by SCLC
cells. This is a consistent observation in SCLC patients, irrespective of whether they develop PEM/PSN or not.6,25 The HuDcoding mRNA has also been detected in SCLC cell lines.26 No
somatic mutations or deletions/insertions affecting HuD have
been observed in SCLC cell lines or tumors, including those
from patients with PEM/PSN.27–29 However, a fine analysis of
the post-translational modifications of HuD in cancer cells from
patients developing or not PNDs has not been performed to date.
Indeed, malignant cell-specific post-translational modifications
of HuD may favor the development of an immune response that
cross-reacts with neuronal Hu proteins. Moreover, the possible
function(s) of HuD in the tumor biology, if any, has not been
uncovered so far. SCLC and many cancers associated with PEM/
PSN exhibit a neuroectodermal origin. The neuroectoderm
includes the neural crest (melanocytes, dorsal root ganglia, ganglia of the autonomous nervous system, adrenal glands, Schwann
cells,…) and the neural tube (brain, spinal cord, retina, neurohypophysis). As a result, most SCLCs are composed of cells with
a neuroendocrine phenotype, characterized by elevated expression levels of L-dopa decarboxylase, neuron-specific enolase,
and neuropeptides.30 These features resemble those of neural
crest-derived endocrine cells disseminated in the normal bronchial mucosa. Such a shared embryonic origin could explain the
expression of HuD by SCLC cells.
Autoimmune responses against Hu proteins
Humoral responses
The serum of patients with the anti-Hu syndrome reacts with
HuB, HuC, and HuD. Since HuD is the only Hu protein consistently expressed by SCLCs,25 it is the most likely initiator of
autoimmune response against Hu antigens.
The presence of anti-HuD antibodies can be revealed using
a large variety of techniques. The initial screening is generally
performed by indirect immunohistochemistry on frozen sections
of healthy human or rodent cerebral cortex, which results in a
strong nuclear and weak cytoplasmic staining in the presence of
anti-HuD antibodies (Fig. 1A). To firmly identify the antigenic
targets, immunoblotting is performed as a complementary test
OncoImmunology
Volume 2 Issue 12
(Fig. 1B), using either neuronal
nuclear extracts or recombinant
HuD.31–33 ELISA can also be used,
but its sensitivity appears to be
lower than that than of immunoblotting on purified HuD.33
The titers of circulating antiHu antibodies usually ranges
from 2000 to 64 000 fold dilution
in patients with PEM/PSN.32,34
Elevated serum titers of anti-Hu
antibodies provide a highly valuable
diagnostic biomarker. Conversely,
low levels of anti-Hu antibodies can
be detected in the absence of PNDs
in 16 to 22.5% of SCLC patients
and in less than 1% of patients with
other malignancies.10,33,35
The anti-HuD IgG response is
polyclonal and subclass distribution analyses revealed that antiHu IgGs belong predominantly to
the IgG1 and IgG3 isotypes.34,36,37
Figure 1. Detection of autoantibodies associated with the anti-Hu syndrome. (A) Patient sera containing
The HuD domains encompassing
Hu-specific autoantibodies specifically recognize neurons in the central nervous system (CNS) (magnifiresidues 90–101 and 171–206 are
cation 200 ×). Briefly, hippocampal (left panels) and cerebellar (right panels) rat slices (EuroImmun) were
recognized by all anti-Hu serum
incubated with serum from either an individual not affected by paraneoplastic neurological disorders
samples. Conversely, the 223–234,
(PNDs) (negative control), either a patient with a confirmed anti-Hu syndrome (positive control), or a subject suspected to suffer from the anti-Hu syndrome, followed by the detection of bound IgG using biotinyl235–252, and 354–373 epitopes
ated goat anti-human IgG, ABC and VIP kits (Eurobio). The test serum turned out to contain anti-neuron
only react with sera of some patients
antibodies exhibiting a staining pattern compatible with that of anti-Hu antibodies. (B) The molecular
38
with the anti-Hu syndrome.
identification of the specificity of such neuron-specific IgGs is made by immunoblotting-based diagnostic
The titers of anti-Hu antibodtests. Patient-derived serum (1/100 dilution) and cerebrospinal fluid (when available) are incubated on a
ies in the cerebrospinal fluid (CSF)
membrane stripped (right panel) with paraneoplastic neurological syndrome-associated antigens, including amphiphysin, CV2, PNMA2 (Ma2/Ta), Ri, Yo, and Hu proteins (EuroImmun). Upon washing, bound IgGs
vary from 100 to 4000 fold diluare detected using alkaline phosphatase-conjugated anti-human IgG antibodies and their position is contion, pointing to intrathecal synfronted to a reference scheme.
32,39,40
Indeed, when adjusted
thesis.
to the same IgG concentration, the
CSF/serum anti-Hu antibody index is > 1 in 86% of patients a study documented the expression of Hu-related antigens on the
with paraneoplastic encephalomyelopathy.39 In patients exhibit- surface of SCLC and neuroblastoma cell lines.45 Whether neuing a CSF/serum antibody index > 1.5, a strong indication of rons exhibit a similar expression pattern of Hu proteins is curthe oligoclonal intrathecal synthesis of HuD-specific IgGs was rently undetermined.
obtained using isoelectric focusing followed by immunoblotting
Experimentally, the contribution of anti-Hu antibodies to
on HuD-loaded nitrocellulose membranes.41 Collectively, these the development of PEM/PSN has been investigated in vitro, in
findings indicate that anti-HuD autoantibodies are produced cell cultures, and in vivo, upon injection of human antibodies
intrathecally in patients with robust CNS involvement. However, to laboratory animals. In vitro, monoclonal antibodies specific
patients presenting with isolated PSNs do not exhibit intrathe- for HuD have been shown to promote the apoptotic demise of
cal anti-Hu antibody synthesis.32 Interestingly, plasmapheresis neuroblastoma cell lines and primary myenteric neurons.46 The
succeeds in reducing the levels of anti-Hu autoantibodies in the serum or IgG preparations from patients with the anti-Hu synserum but not in the CSF.39
drome could also kill human HuD-expressing cell lines and
Anti-Hu antibodies persist over time in the serum of SCLC primary rodent neurons, a phenomenon that was accelerated
patients with PEM/PSN while SCLC patients who do not in the presence of the complement system.46–48 However, this
develop PND remain seronegative.42 Importantly, 8–40% of observation is not universal, and the lack of cytotoxic effects of
the patients with PEM/PSN and anti-Hu antibodies also harbor anti-Hu positive sera on HuD + cancer cells or primary murine
neurons has also been reported.49,50 Moreover, even when neuroautoantibodies targeting other neural antigens.35,43,44
Functional properties of anti-Hu antibodies
nal cytotoxicity was observed, the specificity of the pathogenic
Since anti-Hu antibodies target intracellular antigens, their autoantibodies was questioned, as the patients’ IgGs, but not an
pathogenic and antitumor potential is questionable. Interestingly, anti-HuD monoclonal antibody tested alongside, mediated such
www.landesbioscience.com
OncoImmunology
e27384-3
an effect.48 As discussed above, the serum of patients with PND
often contain multiple neuron-targeting autoantibodies, some of
which recognize surface receptors. Therefore, unless proper specificity assays are conducted, for instance upon pre-absorbing IgG
preparations on recombinant HuD, formal conclusions regarding
the impact of anti-Hu antibodies on neuronal viability are difficult to reach.
The intravenous administration of IgGs from patients with
PEM/PSN and high titers of anti-Hu antibody to mice did not
result in any CNS lesion.51,52 In addition, all attempts to generate rodent models of the anti-Hu syndrome upon immunization
with recombinant HuD failed to induce any signs of disease,
CNS inflammation or neuronal degeneration, despite the development of high circulating titers of anti-HuD antibodies.51,53
Thus, although the presence of high anti-Hu titers in PND
patients represents a highly valuable diagnostic tool, their role in
disease pathogenesis appears at best dubious. Nevertheless, these
autoantibodies reflect a strong autoimmune/antitumor immune
response in which autoreactive T cells, specific for HuD or other
self antigens, are likely to be involved.
T cell responses
The peripheral blood mononuclear cells (PBMCs) of SCLC
patients with the anti-Hu syndrome exhibit an accumulation of
activated HLA-DR+ CD4 + T cells and memory CD45RO + CD4 +
helper T cells as compared with anti-Hu antibody-negative
SCLC patients.54,55 An increase in activated CD8 + T cells in
these patients has also been reported.55 CD25brightCD4 + FOXP3 +
T cells of untested immunosuppressive potential are elevated
in SCLC patients regardless of the development of PEM/PSN.
However, a reduced expression of FOXP3-, transforming growth
factor β1 (TGFβ1)- and cytotoxic T lymphocyte-associated protein 4 (CTLA4)-coding mRNAs has been detected in regulatory
T cells from SCLC patients with PEM/PSN, suggesting a defect
in their immunosuppressive activity.56 Consistent with the pleiocytosis observed in diagnostic CSF analyses,57 increased amounts
of T cells, mostly memory CD4 + and CD8 + T cells, characterize
the CSF of patients with the anti-Hu syndrome.58
The involvement of (most often circulating) autoreactive T
cells in the anti-Hu syndrome has been investigated using a variety of methodological approaches. The PBMCs of SCLC patients
with high anti-Hu antibody titers proliferate more vigorously in
response to HuD and secrete abundant interferon γ (IFNγ), but
not IL-4, as compared with PBMCs from SCLC patients without
anti-Hu antibodies.54 HuD is therefore a likely antigenic target
for primed autoreactive CD4 + T cells, presumably of the TH1
subtype, implicating cell-mediated immunity in the anti-Hu syndrome. However, CD4 + T-cell depletion, purification or blockade experiments using anti-HLA class II antibodies have not yet
been performed, and would be needed to unambiguously identify
the responding cell type.
CD8 + T cells are considered to be the killer cell by excellence
and are suspected to play a key pathogenic role in paraneoplastic
cerebellar degeneration, another type of PND.59,60 In addition,
solid tumors can express high level of MHC class I molecules
and accumulating data indicate that MHC class I molecules can
be upregulated on neurons, in particular during inflammatory
e27384-4
conditions.61 Thus, both cancer cells and neurons could be the
targets of CD8 + T cells. However, in the past decade, efforts to
identify HuD-specific CD8 + T cells in SCLC patients with the
anti-Hu syndrome, using a combination of cytokine release assays
and flow cytometry based on HLA:HuD peptide tetramers, have
yielded conflicting observations. Indeed, some investigators have
reported negative results,62,63 while others have found consistent
evidence for such HuD-specific CD8 + T cells.64–66 This discrepancy may relate to the methodological approaches employed by
these groups. Alternatively, it could be connected to timing, as
the PBMCs of patients assessed within the first 3 mo of PEM/
PSN onset exhibited more robust IFNγ ELISPOT responses to
HuD-derived peptides than the PMBCs of patients tested later.65
Finally, the abovementioned discrepancy may reflect the assay
used for the detection of HuD-specific CD8 + T cells. Indeed,
in a study involving 4 HLA-A03:01-expressing patients with the
anti-Hu syndrome, the PBMCs of only one were found to exhibit
a classical cytotoxic profile with IFNγ secretion in response to
the HuD140–148 peptide. Surprisingly, the PBMCs of 2 patients
displayed a robust production of interleukin (IL)-5 and IL-13
in response to HuD164–172 stimulation, but almost undetectable
cytotoxicity or IFNγ production.67 Of note, the PBMCs of none
of the control subjects exhibited any type of response to HuDderived peptides. These data suggest that anti-HuD CD8 + T-cell
responses could be skewed toward a type 2, non-cytotoxic, profile
in some patients with the anti-Hu syndrome, a pattern that could
be easily missed using usual functional assays. However, whether
the type of CD8 + T-cell response observed in PBMCs is reflective
of what occurs within neoplastic lesions and in the nervous system is unknown. If so, how the effective antitumor response and
neurological damage could be mechanistically explained?
Finally, it is possible that autoreactive T cells in the anti-Hu
syndrome recognize additional or alternative neuronal antigens.
Indeed, although antigens recognized by autoantibodies and
autoreactive T cells largely overlap in most organ-specific autoimmune diseases, this is not necessarily the case.68 This aspect
has not yet received adequate attention.
How is immune tolerance to neuronal Hu antigens broken
in patients with PEM/PSN?
Studies performed in mice revealed that HuD-specific CD8 +
T cells can be elicited upon immunization with recombinant
adenoviruses expressing full-length HuD.69 However, the need
for adjuvants and for further in vitro stimulation to detect HuDspecific CD8 + T cells point to a reduced frequency of HuDspecific T-cell precursors, their limited functional avidity, and/or
to the existence of robust immunosuppressive network that operate in vivo to maintain these cells under control. The robust ex
vivo CD8 + T-cell response generated in HuD-deficient, but not in
wild-type, mice provided direct evidence for partial induction of
tolerance to HuD under physiological conditions.69 Interestingly,
HuD is expressed, although at low levels, by MHCIIhigh thymic medullary epithelial cells and thymic CD8 + dendritic cells
(http://immgen.org/). Importantly, patients with the anti-Hu
syndrome do not manifest autoimmune reactions in tissues other
than the nervous system, underlining the selective breakdown
of tolerance to HuD, but not other Hu antigens such as HuA.
OncoImmunology
Volume 2 Issue 12
However, up to 40% of patients with the antiHu syndrome harbor autoantibodies specific for
other neuronal proteins, such as the P/Q type
voltage-gated calcium channel (associated with
Lambert–Eaton myasthenic syndrome), indicating that self sensitization is not exquisitely
directed to Hu antigens.43
Given the constant expression of HuD by
SCLC cells, it is currently unclear why some
patients develop PEM/PSN whereas others do
not. Parameters intrinsic to the tumor and/
or to the host may contribute to this range of
variability. In patients with SCLC and the antiHu syndrome, MHC class I molecules were
detected by immunohistochemistry at moderate or high levels in the neoplastic lesions of
13 out of 15 cases, whereas such levels were
observed in none of 11 SCLC patients who did
not develop PEM/PSN. In addition, the focal
expression of HLA-DR was more frequent in
Figure 2. Immunopathogenesis of the anti-Hu syndrome. An anti-Hu syndrome occurs when
tumors from SLCL patients with the anti-Hu
a vigorous immune response develops against the normally neuron-restricted antigen HuD
syndrome than in patients without (6/15 vs
ectopically expressed by an underlying tumor, most often small-cell lung carcinoma (SCLC).
42
0/11). As a cause or consequence of this HLA
Tissue-resident dendritic cells capture antigens derived from malignant cells, including HuD
expression pattern, tumors from PND patients
(A). After the homing of these dendritic cells to tumor-draining lymph nodes, tumor-associmay be heavily infiltrated with inflammatory
ated antigens, including HuD, are processed and presented to activate antigen-specific CD4+
70
and CD8+ T cells (B). The activation of tumor-specific T cells may also occur within neoplastic
cells. However, a thorough comparison of the
lesions.
In either case, tumor-specific T cells can reach neoplastic lesions. As cancer cells somecellular and molecular immune signature of
times express MHC class I molecules and likely present HuD-derived peptides, they become
neoplastic lesions from patients who developed
attractive targets for HuD-specific CD8+ T cell killing. Partial (or in rare cases complete) control
or not PNDs has not yet been performed. This
of the tumor growth is therefore afforded (C). In parallel, the HuD-specific T cells activated
is highly relevant since the type, density, and
in tumor-draining lymph nodes and/or within neoplastic lesions, circulate and acquire the
capacity to cross the blood-brain-barrier (D). In the central nervous system (CNS), neurons
location of tumor-infiltrating immune cells as
can also express MHC class I molecules, in particular under inflammatory conditions, and can
well as the expression of genes related to immutherefore present peptides derived from the highly homologous HuD, HuB, HuC proteins.
nological functions carry prognostic and predicThus, neurons become additional targets for HuD-specific CD8+ T cells, resulting in neuronal
71
tive value. As mentioned earlier, either cancer
tissue damage and the related paraneoplastic neurological manifestations (E).
cell-specific post-translational modifications of
HuD and an unusual antigen processing within
neoplastic lesions could favor the development of autoimmune 15% of SCLC patients harbor low circulating titers of anti-Hu
responses targeting neuronal Hu. Such mechanisms have been antibodies in the absence of neurological manifestations, HuDimplicated in tissue-specific autoimmune diseases in non-para- specific immune responses might need to exceed a minimal
neoplastic contexts.68,72,73 As for host factors, the HLA-DR3 and threshold to overcome the relative immune privilege of the CNS.
HLA-DQ2 have been associated with the anti-Hu syndrome in Above such a threshold, the HuD-specific immune response is
one study,74 but not in a second one assessing only DR alleles.75 expected to involve the CNS, as documented by the intrathecal
To date, no other genetic polymorphisms have been associated synthesis of HuD-specific IgGs,41 as well as by the detection of
HuD-specific CD8 + T cells in the CSF.67 This chronic autoimwith PEM/PSN.
Here is a plausible scenario for the development of an auto- mune reaction ultimately leads to neuronal destruction and fixed
immune reaction against Hu proteins in patients with cancer of neurological disability (Fig. 2). The stabilization of neurological
neuroectodermal origin. Although all SCLCs express HuD, the signs as well as the disappearance of anti-Hu antibodies has been
cross-presentation of HuD by dendritic cells and the activation of associated with complete tumor response to therapy.7,76 These data
an efficient anti-Hu T-cell response is expected to occur only in suggest that malignant cells fuel the autoimmune process through
a subset of patients, based on the available T-cell repertoire and the release of tumor-associated antigens.
genetic polymorphisms impacting on the magnitude and quality
Mechanisms of Tissue Damage
of the immune response, such as those within the HLA locus. The
in the Nervous System
priming of a T-cell response specific for HuD (and possibly other
onconeural antigens) may be sustained within the neoplastic lesion
The anti-Hu paraneoplastic syndrome is a heterogeneous disitself, owing to the ability of malignant cells to express MHC molecules, possibly resulting in the inhibition of tumor growth. Since order with highly diverse clinical and pathological manifestations
www.landesbioscience.com
OncoImmunology
e27384-5
in terms of lesion sites, inflammatory infiltrates, and neuronal
damage. Despite this heterogeneity, a good correlation exists
between the location and magnitude of neuronal loss or tissue
damage and the type and severity of the clinical signs. Variable
regions of the nervous system can be affected, with a preferential targeting of the hippocampus, lower brain stem, spinal
cord, and dorsal root ganglia (DRG).9,77,78 However, the cortex,
medulla, amygdala, putamen, cingulate gyrus, and pons can also
be affected.77,78 Neuropathological lesions are usually more widespread than anticipated based on clinical data. In the affected
areas, neuronal loss, axonal damage, reactive gliosis, and microglial nodules are conspicuous.79 In contrast, there is no evidence of
astrocyte and oligodendrocyte loss or demyelination.79 Ongoing
neuronal apoptosis is either lacking or only occasionally detected,
possibly a result of the subacute/chronic course of the disease or
the post-mortem origin of the tissue under investigation.77,79
In patients with PEM/PSN, IgG deposits are detected in the
nervous tissue, predominantly in the nuclei of CNS and DRG
neurons, and to a lesser degree in the cytoplasm.10,37,80 This cellular distribution is highly reminiscent of the staining pattern
observed with anti-Hu antibodies. The extraction of IgGs deposited in nervous tissues revealed that at least part of these IgGs
are indeed anti-Hu antibodies. In some patients, abundant IgG
deposits have been detected on the neuronal surface,37 suggesting
the co-existence of additional anti-neuron autoantibodies. The
amount of anti-Hu IgGs in specific areas of the nervous system is
higher than its serum counterpart.80 However, the major clinical
signs do not correlate with the localization of anti-Hu IgGs, as
assessed by histology.78,80 Furthermore, in mice transferred with
IgG from patients affected by the anti-Hu syndrome, intraneuronal IgG deposits were no longer detected if the animals were perfused before brain tissue processing.51 The question of whether
the anti-Hu IgGs deposited in the neuronal tissue of patients
with PEM/PSN represents an artifact or a phenomenon of potential pathogenic relevance is therefore raised. Irrespective of this
issue, which requires further investigation, the complement system does not seem to play a significant role in the pathogenesis
of the anti-Hu syndrome. Indeed, parenchymal C3 immunoreactivity is weak or absent and no C9neo staining (a marker of
complement-mediated tissue injury) is observed in affected brain
areas.37,77,79,81
Inflammatory infiltrates are commonly found in DRG as
well as in the CNS perivascular space and parenchyma. They are
mainly composed of T cells, whereas natural killer (NK) cells are
absent.37,77,79,81 B cells are occasionally detected in the perivascular cuffs and meninges but they rarely infiltrate the brain parenchyma. In inflamed tissues, macrophages are mostly restricted
to the perivascular space, whereas CD68 + microglial cells are
found in the parenchyma.37,77,82,83 Among T lymphocytes, CD4 +
T cells are mainly located in perivascular areas, whereas CD8 +
T cells represent by far the major component of the parenchymal infiltrates.37,77,79,82,83 CD8 + T cells usually form clusters and
frequently localize around neurons.77,79 Immunohistochemical
analyses revealed a close contact of cytotoxic granule-containing
T cells with neurons in the brain tissue or DRG of patients with
the anti-Hu syndrome, with, in some instances, indentation of
e27384-6
the neuronal surface by the “attacking” CD8 + T cells.83 MHC
class I molecules has been shown to be expressed on neurons in
the inflamed nervous tissue from patients with PEM/PSN.79,84
In this context, the close apposition of CD8 + T cells with neurons and the polarization of membranous CD107a79 may reflect
a cognate, antigen-dependent, in vivo interaction leading to the
neuronal demise. In addition, CD8 + T cell-derived IFNγ has
recently been demonstrated to promote the loss of dendrites and
synapses, underlying the need to assess presence of this cytokine
(or phosphorylated signal transduction and activator of transcription 1, STAT1) in brain sections from patients affected by the
anti-Hu syndrome.85 In these individuals, the amount of reactive
microglia is increased in all affected areas of the CNS. Microglial
cells participate in the clusters of inflammatory cells in the gray
matter and, together with CD8 + T cells, surround neurons.77
Collectively, these observations strongly suggest that a cytotoxic CD8 + T cell-mediated attack contributes to neuronal death
and axonal damage that characterize the anti-Hu syndrome, and
therefore to its neurological manifestations. However, it remains
to be determined whether these CD8 + T cells are Hu-specific.
Studies of the specificity of tissue-derived TCRs should help
resolve this question. To date, the analysis of TCR β chain usage
by immunohistochemistry has revealed an overrepresentation
of certain Vβ families in 3 out of 5 patients with PEM/PSN.
Lesion-infiltrating T cells expressing the expanded Vβ families were mostly CD8 + T cells. Interestingly, in some patients,
similarly expanded Vβ sequences were detected in the CSF or
affected areas of the nervous system as well as within neoplastic
lesions.76,86
Future Directions
Future investigations to obtain better insights into the mechanisms leading to antitumor immunity and nervous tissue autoimmunity in patients with PEM/PDN should integrate the in-depth
molecular analysis of tissue samples (neoplastic lesions as well as
neural tissue) and the development of relevant animal models.
In turn, this new knowledge should assist the development of
effective immunotherapies, which are dearly needed for patients
suffering from the anti-Hu syndrome.
The mechanisms that trigger anti-Hu antibody-associated
PNDs are not yet elucidated but appear tightly linked to the
development of a partly efficient antitumor immune response.
The comparison of the type, density, and location of tumorinfiltrating immune cells in SCLC patients who developed or
not an anti-Hu syndrome, complemented by gene-expression
profiling studies, may identify signatures that are predictive of
improved tumor control and/or PND development. Confronted
to data emerging from a wide variety of cancers,71 this information will help investigators to assess whether the magnitude
and functional orientation of intratumoral adaptive immune
responses correlate with development of the anti-Hu syndrome.
Similarly, the immune reaction developing in the nervous tissue
of patients with PEM/PDN needs to be dissected at the molecular level using unbiased approaches. Given the dramatic and subacute course of the neurological disease in many patients with the
OncoImmunology
Volume 2 Issue 12
anti-Hu syndrome, post-mortem tissues are available in which
neurons are actively targeted by the immune system. A thorough
investigation of the antigen specificity of CNS-infiltrating CD8 +
T cells using a combination of tissue laser microdissection, TCR
cloning and antigen screening76,87 will inform whether HuD is
the key antigenic target for pathogenic T cells or whether alternative/additional autoantigens are involved.
Animal models represent valuable tools to test hypotheses
regarding the initiation and the effector mechanisms of human
autoimmune diseases, as well as for the development of new
therapeutic strategies. A valid animal model for the anti-Hu syndrome should recapitulate the following features: (1) the existence
of one or more antigens that are expressed by both malignant
cells and normal neurons; (2) the development of a detectable
immune response against such shared antigens; (3) the inhibition of tumor growth by this antitumor immune response; (4)
the immune infiltration of the nervous system as well as neuronal
death and its related clinical consequences as a result of the antitumor/autoimmune response. To date, no animal model of the
anti-Hu syndrome has been successfully developed. Attempts to
mimic the human disease through the transfer of patient-derived
IgGs or the deliberate immunization of experimental animals
with HuD have resulted in high titers of circulating anti-HuD
antibodies but no neuropathological lesions.51,88 Interestingly, a
mouse strain bearing a conditional deletion of both Trp53 and
Rb1 in the lung develops Hu-expressing SCLCs. Although about
15% of these mice also develop high titers of anti-Hu antibodies
in the serum, no neurological signs become manifest.89 Similarly,
the adoptive transfer of rat TH1 cells specific for an onconeural
antigen led to meningeal and perivascular CNS inflammation
but failed to induce neuronal damage or overt clinical manifestations in recipient animals.90 Therefore, a robust animal model is
still needed to pinpoint the immunological mechanisms leading
to neurological tissue damage in patients with the anti-Hu syndrome, and to test therapeutic strategies aimed at blocking the
encephalitogenic immune response without affecting productive
antitumor immunity.
References
1.
2.
3.
4.
Darnell RB, Posner JB. Observing the invisible: successful tumor immunity in humans. Nat Immunol
2003; 4:201; http://dx.doi.org/10.1038/ni0303-201;
PMID:12605223
Seute T, Leffers P, ten Velde GP, Twijnstra A.
Neurologic disorders in 432 consecutive patients
with small cell lung carcinoma. Cancer 2004;
100:801-6; http://dx.doi.org/10.1002/cncr.20043;
PMID:14770437
Graus F, Cordon-Cardo C, Posner JB. Neuronal
antinuclear antibody in sensory neuronopathy
from lung cancer. Neurology 1985; 35:538-43;
PMID:2984600;
http://dx.doi.org/10.1212/
WNL.35.4.538
Darnell RB, DeAngelis LM. Regression of
small-cell lung carcinoma in patients with paraneoplastic neuronal antibodies. Lancet 1993;
341:21-2;
PMID:8093269;
http://dx.doi.
org/10.1016/0140-6736(93)92485-C
www.landesbioscience.com
5.
6.
7.
8.
An early diagnosis of PEM/PSN is possible since the antiHu antibody provides a highly specific biomarker. The effective
treatment of the underlying tumor represents the main but not
the sole facet of PEM/PSN management. Indeed, a wealth of data
suggests that immunotherapy should be initiated before neurological symptoms have reached their plateau. To date, various
approaches have been used, ranging from high-dose corticosteroids, to intravenous immunoglobulins and cyclophosphamide,
but they have provided benefit to a few patients.7,44,91 A study
showed no detectable adverse effects of these immunotherapies
on tumor control or patient survival, although it was underpowered to detect the negative impact of a given intervention.7 Based
on the information detailed above, pointing at CD8 + T cells as
key immune effectors of the neurological tissue damage experienced by patients with the anti-Hu syndrome, an early and
aggressive targeting of these cells should be envisioned. Approved
molecules preventing the entry of T cells into the nervous system,
such as anti-α4 integrin antibodies or functional antagonists of
the sphingosine-1-phosphate receptor, represent very attractive
possibilities in this respect.92–94 In addition, given the deleterious
role of IFNγ in CD8 + T cell-mediated neurological disorders,85,95
IFNγ blockade could also constitute a valuable strategy, provided
that it does not interfere with anticancer therapy. Conversely, the
blockade of immune checkpoints96 should be tested with utmost
caution in patients bearing tumors potentially associated with the
anti-Hu syndrome, as they may unleash a dramatic neurological
autoimmunity, in particular among individuals with detectable
anti-Hu antibodies.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Acknowledgments
We thank Jean-Yves Delattre from ICM, Pitié-Salpetrière,
Paris for the Figure 1, Daniel Gonzalez-Dunia for critical reading of the manuscript and ARC, INSERM and Région MidiPyrénées for financial support.
Honnorat J, Didelot A, Karantoni E, Ville D,
Ducray F, Lambert L, Deiva K, Garcia M, Pichit
P, Cavillon G, et al. Autoimmune limbic encephalopathy and anti-Hu antibodies in children without cancer. Neurology 2013; 80:2226-32; http://
d x.doi.org /10.1212 / W NL .0b013e318296e9c3 ;
PMID:23658383
Dalmau J, Graus F, Rosenblum MK, Posner JB.
Anti-Hu--associated
paraneoplastic
encephalomyelitis/sensory
neuronopathy.
A
clinical study of 71 patients. Medicine (Baltimore)
1992; 71:59-72; PMID:1312211; http://dx.doi.
org/10.1097/00005792-199203000-00001
Keime-Guibert F, Graus F, Broët P, Reñé R,
Molinuevo JL, Ascaso C, Delattre JY. Clinical outcome of patients with anti-Hu-associated encephalomyelitis after treatment of the tumor. Neurology
1999; 53:1719-23; PMID:10563618; http://dx.doi.
org/10.1212/WNL.53.8.1719
Monstad SE, Drivsholm L, Storstein A, Aarseth JH,
Haugen M, Lang B, Vincent A, Vedeler CA. Hu and
voltage-gated calcium channel (VGCC) antibodies related to the prognosis of small-cell lung cancer. J Clin Oncol 2004; 22:795-800; http://dx.doi.
org/10.1200/JCO.2004.01.028; PMID:14990634
OncoImmunology
9.
10.
11.
12.
13.
Graus F, Keime-Guibert F, Reñe R, Benyahia B,
Ribalta T, Ascaso C, Escaramis G, Delattre JY.
Anti-Hu-associated paraneoplastic encephalomyelitis: analysis of 200 patients. Brain 2001; 124:113848; PMID:11353730; http://dx.doi.org/10.1093/
brain/124.6.1138
Dalmau J, Furneaux HM, Gralla RJ, Kris MG, Posner
JB. Detection of the anti-Hu antibody in the serum of
patients with small cell lung cancer--a quantitative
western blot analysis. Ann Neurol 1990; 27:54452;
http://dx.doi.org/10.1002/ana.410270515;
PMID:2163235
Graus F, Dalmou J, Reñé R, Tora M, Malats N,
Verschuuren JJ, Cardenal F, Viñolas N, Garcia
del Muro J, Vadell C, et al. Anti-Hu antibodies in
patients with small-cell lung cancer: association with
complete response to therapy and improved survival.
J Clin Oncol 1997; 15:2866-72; PMID:9256130
Byrne KT, Turk MJ. New perspectives on the role
of vitiligo in immune responses to melanoma.
Oncotarget 2011; 2:684-94; PMID:21911918
Okano HJ, Darnell RB. A hierarchy of Hu RNA
binding proteins in developing and adult neurons. J
Neurosci 1997; 17:3024-37; PMID:9096138
e27384-7
14. Ma WJ, Cheng S, Campbell C, Wright A, Furneaux
H. Cloning and characterization of HuR, a ubiquitously expressed Elav-like protein. J Biol Chem
1996; 271:8144-51; PMID:8626503; http://dx.doi.
org/10.1074/jbc.271.14.8144
15. Robinow S, Campos AR, Yao KM, White K. The
elav gene product of Drosophila, required in neurons, has three RNP consensus motifs. Science
1988; 242:1570-2; PMID:3144044; http://dx.doi.
org/10.1126/science.3144044
16. Robinow S, White K. Characterization and spatial distribution of the ELAV protein during
Drosophila melanogaster development. J Neurobiol
1991;
22:443-61;
http://dx.doi.org/10.1002/
neu.480220503; PMID:1716300
17. Chung S, Jiang L, Cheng S, Furneaux H.
Purification and properties of HuD, a neuronal
RNA-binding protein. J Biol Chem 1996; 271:1151824; PMID:8626712; http://dx.doi.org/10.1074/
jbc.271.19.11518
18. Bolognani F, Perrone-Bizzozero NI. RNA-protein
interactions and control of mRNA stability in neurons. J Neurosci Res 2008; 86:481-9; http://dx.doi.
org/10.1002/jnr.21473; PMID:17853436
19. Perrone-Bizzozero N, Bolognani F. Role of HuD
and other RNA-binding proteins in neural development and plasticity. J Neurosci Res 2002; 68:1216; PMID:11948657; http://dx.doi.org/10.1002/
jnr.10175
20. Allen M, Bird C, Feng W, Liu G, Li W, PerroneBizzozero NI, Feng Y. HuD promotes BDNF
expression in brain neurons via selective stabilization of the BDNF long 3’UTR mRNA. PLoS One
2013; 8:e55718; http://dx.doi.org/10.1371/journal.
pone.0055718; PMID:23383270
21. Ince-Dunn G, Okano HJ, Jensen KB, Park WY,
Zhong R, Ule J, Mele A, Fak JJ, Yang C, Zhang C,
et al. Neuronal Elav-like (Hu) proteins regulate RNA
splicing and abundance to control glutamate levels
and neuronal excitability. Neuron 2012; 75:106780; http://dx.doi.org/10.1016/j.neuron.2012.07.009;
PMID:22998874
22. Anderson KD, Merhege MA, Morin M, Bolognani
F, Perrone-Bizzozero NI. Increased expression and
localization of the RNA-binding protein HuD and
GAP-43 mRNA to cytoplasmic granules in DRG
neurons during nerve regeneration. Exp Neurol
2003; 183:100-8; PMID:12957493; http://dx.doi.
org/10.1016/S0014-4886(03)00103-1
23. Kasashima K, Terashima K, Yamamoto K, Sakashita
E, Sakamoto H. Cytoplasmic localization is required
for the mammalian ELAV-like protein HuD to
induce neuronal differentiation. Genes Cells
1999; 4:667-83; PMID:10620013; http://dx.doi.
org/10.1046/j.1365-2443.1999.00292.x
24. Fujiwara T, Fukao A, Sasano Y, Matsuzaki H,
Kikkawa U, Imataka H, Inoue K, Endo S, Sonenberg
N, Thoma C, et al. Functional and direct interaction
between the RNA binding protein HuD and active
Akt1. Nucleic Acids Res 2012; 40:1944-53; http://
dx.doi.org/10.1093/nar/gkr979; PMID:22075994
25. Manley GT, Smitt PS, Dalmau J, Posner JB. Hu
antigens: reactivity with Hu antibodies, tumor
expression, and major immunogenic sites. Ann
Neurol 1995; 38:102-10; http://dx.doi.org/10.1002/
ana.410380117; PMID:7541976
26. Cho JH, Noguchi M. Expression of HuD (a paraneoplastic encephalomyelitis antigen) mRNA in
lung cancer. J Korean Med Sci 1997; 12:305-10;
PMID:9288629
27. Carpentier AF, Voltz R, DesChamps T, Posner JB,
Dalmau J, Rosenfeld MR. Absence of HuD gene
mutations in paraneoplastic small cell lung cancer
tissue. Neurology 1998; 50:1919; PMID:9633765;
http://dx.doi.org/10.1212/WNL.50.6.1919
e27384-8
28. D’Alessandro V, Muscarella LA, la Torre A, Bisceglia
M, Parrella P, Scaramuzzi G, Storlazzi CT, Trombetta
D, Kok K, De Cata A, et al. Molecular analysis of
the HuD gene in neuroendocrine lung cancers. Lung
Cancer 2010; 67:69-75; http://dx.doi.org/10.1016/j.
lungcan.2009.03.022; PMID:19410329
29. Sekido Y, Bader SA, Carbone DP, Johnson BE, Minna
JD. Molecular analysis of the HuD gene encoding a
paraneoplastic encephalomyelitis antigen in human
lung cancer cell lines. Cancer Res 1994; 54:4988-92;
PMID:8069866
30. Gazdar AF, Carney DN, Becker KL, Deftos LJ, Liang
V, Go W, Marangos PJ, Moody TW, Wolfsen AR,
Zweig MH. Expression of peptide and other markers in lung cancer cell lines. Recent Results Cancer
Res 1985; 99:167-74; PMID:2999915; http://dx.doi.
org/10.1007/978-3-642-82533-0_17
31. Graus F, Elkon KB, Cordon-Cardo C, Posner JB.
Sensory neuronopathy and small cell lung cancer.
Antineuronal antibody that also reacts with the
tumor. Am J Med 1986; 80:45-52; PMID:2417479;
http://dx.doi.org/10.1016/0002-9343(86)90047-1
32. Vega F, Graus F, Chen QM, Poisson M, Schuller
E, Delattre JY. Intrathecal synthesis of the
anti-Hu antibody in patients with paraneoplastic encephalomyelitis or sensory neuronopathy:
clinical-immunologic
correlation.
Neurology
1994; 44:2145-7; PMID:7969974; http://dx.doi.
org/10.1212/WNL.44.11.2145
33. Verschuuren JJP, Perquin M, ten Velde G, De Baets
M, Vriesman PB, Twijnstra A. Anti-Hu antibody titre
and brain metastases before and after treatment for
small cell lung cancer. J Neurol Neurosurg Psychiatry
1999; 67:353-7; PMID:10449558; http://dx.doi.
org/10.1136/jnnp.67.3.353
34. Blaes F, Klotz M, Funke D, Strittmatter M, Kraus
J, Kaps M. Disturbance in the serum IgG subclass
distribution in patients with anti-Hu positive paraneoplastic neurological syndromes. Eur J Neurol
2002; 9:369-72; PMID:12099920; http://dx.doi.
org/10.1046/j.1468-1331.2002.00416.x
35. Monstad SE, Knudsen A, Salvesen HB, Aarseth
JH, Vedeler CA. Onconeural antibodies in sera
from patients with various types of tumours.
Cancer Immunol Immunother 2009; 58:1795-800;
http://dx.doi.org/10.1007/s00262-009-0690-y;
PMID:19294382
36. Greenlee JE, Boyden JW, Pingree M, Brashear HR,
Clawson SA, Keeney PM. Antibody types and IgG
subclasses in paraneoplastic neurological syndromes.
J Neurol Sci 2001; 184:131-7; PMID:11239946;
http://dx.doi.org/10.1016/S0022-510X(01)00442-7
37. Jean WC, Dalmau J, Ho A, Posner JB. Analysis of
the IgG subclass distribution and inflammatory infiltrates in patients with anti-Hu-associated paraneoplastic encephalomyelitis. Neurology 1994; 44:140-7;
PMID:8290049;
http://dx.doi.org/10.1212/
WNL.44.1.140
38. Sodeyama N, Ishida K, Jaeckle KA, Zhang L,
Azuma A, Yamada M, Mizusawa H, Wada Y. Pattern
of epitopic reactivity of the anti-Hu antibody on
HuD with and without paraneoplastic syndrome.
J Neurol Neurosurg Psychiatry 1999; 66:979; PMID:9886463; http://dx.doi.org/10.1136/
jnnp.66.1.97
39. Furneaux HF, Reich L, Posner JB. Autoantibody
synthesis in the central nervous system of patients
with paraneoplastic syndromes. Neurology 1990;
40:1085-91;
PMID:2356009;
http://dx.doi.
org/10.1212/WNL.40.7.1085
40. Graus F, Vega F, Delattre JY, Bonaventura I, Reñé
R, Arbaiza D, Tolosa E. Plasmapheresis and antineoplastic treatment in CNS paraneoplastic syndromes with antineuronal autoantibodies. Neurology
1992; 42:536-40; PMID:1312683; http://dx.doi.
org/10.1212/WNL.42.3.536
OncoImmunology
41. Rauer S, Kaiser R. Demonstration of anti-HuD
specific oligoclonal bands in the cerebrospinal fluid
from patients with paraneoplastic neurological
syndromes. Qualitative evidence of anti-HuD specific IgG-synthesis in the central nervous system. J
Neuroimmunol 2000; 111:241-4; PMID:11063845;
http://dx.doi.org/10.1016/S0165-5728(00)00391-X
42. Dalmau J, Graus F, Cheung NK, Rosenblum MK,
Ho A, Cañete A, Delattre JY, Thompson SJ, Posner
JB. Major histocompatibility proteins, anti-Hu antibodies, and paraneoplastic encephalomyelitis in
neuroblastoma and small cell lung cancer. Cancer
1995; 75:99-109; PMID:7804984; http://dx.doi.
org/10.1002/1097-0142(19950101)75:1<99::AIDCNCR2820750117>3.0.CO;2-I
43. Pittock SJ, Kryzer TJ, Lennon VA. Paraneoplastic
antibodies coexist and predict cancer, not neurological syndrome. Ann Neurol 2004; 56:715-9; http://
dx.doi.org/10.1002/ana.20269; PMID:15468074
44. Sillevis Smitt P, Grefkens J, de Leeuw B, van den Bent
M, van Putten W, Hooijkaas H, Vecht C. Survival
and outcome in 73 anti-Hu positive patients with
paraneoplastic encephalomyelitis/sensory neuronopathy. J Neurol 2002; 249:745-53; http://dx.doi.
org/10.1007/s00415-002-0706-4; PMID:12111309
45. Torà M, Graus F, de Bolòs C, Real FX. Cell surface
expression of paraneoplastic encephalomyelitis/sensory neuronopathy-associated Hu antigens in smallcell lung cancers and neuroblastomas. Neurology
1997; 48:735-41; PMID:9065557; http://dx.doi.
org/10.1212/WNL.48.3.735
46. De Giorgio R, Bovara M, Barbara G, Canossa M,
Sarnelli G, De Ponti F, Stanghellini V, Tonini M,
Cappello S, Pagnotta E, et al. Anti-HuD-induced
neuronal apoptosis underlying paraneoplastic
gut dysmotility. Gastroenterology 2003; 125:709; PMID:12851872; http://dx.doi.org/10.1016/
S0016-5085(03)00664-4
47. Greenlee JE, Parks TN, Jaeckle KA. Type IIa (‘antiHu’) antineuronal antibodies produce destruction
of rat cerebellar granule neurons in vitro. Neurology
1993; 43:2049-54; PMID:8413965; http://dx.doi.
org/10.1212/WNL.43.10.2049
48. Schäfer KH, Klotz M, Mergner D, Mestres P,
Schimrigk K, Blaes F. IgG-mediated cytotoxicity
to myenteric plexus cultures in patients with paraneoplastic neurological syndromes. J Autoimmun
2000;
15:479-84;
http://dx.doi.org/10.1006/
jaut.2000.0454; PMID:11090247
49. Hormigo A, Lieberman F. Nuclear localization of anti-Hu antibody is not associated with
in vitro cytotoxicity. J Neuroimmunol 1994;
55:205-12;
PMID:7829670;
http://dx.doi.
org/10.1016/0165-5728(94)90011-6
50. Tanaka K, Ding X, Tanaka M. Effects of antineuronal antibodies from patients with paraneoplastic
neurological syndrome on primary-cultured neurons.
J Neurol Sci 2004; 217:25-30; PMID:14675605;
http://dx.doi.org/10.1016/j.jns.2003.08.006
51. Sillevis Smitt PA, Manley GT, Posner JB.
Immunization with the paraneoplastic encephalomyelitis antigen HuD does not cause neurologic disease in
mice. Neurology 1995; 45:1873-8; PMID:7477985;
http://dx.doi.org/10.1212/WNL.45.10.1873
52. Uchuya M, Graus F, Vega F, Reñé R, Delattre JY.
Intravenous immunoglobulin treatment in paraneoplastic neurological syndromes with antineuronal autoantibodies. J Neurol Neurosurg Psychiatry
1996; 60:388-92; PMID:8774401; http://dx.doi.
org/10.1136/jnnp.60.4.388
53. Sakai K, Gofuku M, Kitagawa Y, Ogasawara T, Hirose
G. Induction of anti-Purkinje cell antibodies in vivo
by immunizing with a recombinant 52-kDa paraneoplastic cerebellar degeneration-associated protein. J
Neuroimmunol 1995; 60:135-41; PMID:7642741;
http://dx.doi.org/10.1016/0165-5728(95)00063-8
Volume 2 Issue 12
54. Benyahia B, Liblau R, Merle-Béral H, Tourani JM,
Dalmau J, Delattre JY. Cell-mediated autoimmunity in paraneoplastic neurological syndromes with
anti-Hu antibodies. Ann Neurol 1999; 45:162-7;
PMID:9989617;
http://dx.doi.org/10.1002/15318249(199902)45:2<162::AID-ANA5>3.0.CO;2-R
55. de Beukelaar JW, Sillevis Smitt PA, Hop WC,
Kraan J, Hooijkaas H, Verjans GM, Gratama JW.
Imbalances in circulating lymphocyte subsets in
Hu antibody associated paraneoplastic neurological
syndromes. Eur J Neurol 2007; 14:1383-91; http://
d x.doi.org /10.1111/j.1468 -1331.20 07.01986.x ;
PMID:18028190
56. Tani T, Tanaka K, Idezuka J, Nishizawa M.
Regulatory T cells in paraneoplastic neurological syndromes. J Neuroimmunol 2008; 196:166-9;
http://dx.doi.org/10.1016/j.jneuroim.2008.03.002;
PMID:18455243
57. Psimaras D, Carpentier AF, Rossi C; PNS
Euronetwork. Cerebrospinal fluid study in paraneoplastic syndromes. J Neurol Neurosurg Psychiatry
2010;
81:42-5;
http://dx.doi.org/10.1136/
jnnp.2008.159483; PMID:19324868
58. de Jongste AH, de Graaf MT, van den Broek PD,
Kraan J, Smitt PA, Gratama JW. Elevated numbers of
regulatory T cells, central memory T cells and classswitched B cells in cerebrospinal fluid of patients with
anti-Hu antibody associated paraneoplastic neurological syndromes. J Neuroimmunol 2013; 258:85-90;
http://dx.doi.org/10.1016/j.jneuroim.2013.02.006;
PMID:23566401
59. Albert ML, Darnell JC, Bender A, Francisco LM,
Bhardwaj N, Darnell RB. Tumor-specific killer cells
in paraneoplastic cerebellar degeneration. Nat Med
1998; 4:1321-4; http://dx.doi.org/10.1038/3315;
PMID:9809559
60. Santomasso BD, Roberts WK, Thomas A, Williams
T, Blachère NE, Dudley ME, Houghton AN, Posner
JB, Darnell RB. A T-cell receptor associated with naturally occurring human tumor immunity. Proc Natl
Acad Sci U S A 2007; 104:19073-8; PMID:18045792;
http://dx.doi.org/10.1073/pnas.0704336104
61. Liblau RS, Gonzalez-Dunia D, Wiendl H, Zipp F.
Neurons as targets for T cells in the nervous system.
Trends Neurosci 2013; 36:315-24; http://dx.doi.
org/10.1016/j.tins.2013.01.008; PMID:23478065
62. de Beukelaar JW, Verjans GM, van Norden Y,
Milikan JC, Kraan J, Hooijkaas H, Sintnicolaas
K, Gratama JW, Sillevis Smitt PA. No evidence for
circulating HuD-specific CD8+ T cells in patients
with paraneoplastic neurological syndromes and Hu
antibodies. Cancer Immunol Immunother 2007;
56:1501-6; http://dx.doi.org/10.1007/s00262-0070295-2; PMID:17597332
63. de Jongste AH, de Graaf MT, Martinuzzi E, van den
Broek PD, Kraan J, Lamers CH, Mallone R, Gratama
JW, Sillevis Smitt PA. Three sensitive assays do not
provide evidence for circulating HuD-specific T cells
in the blood of patients with paraneoplastic neurological syndromes with anti-Hu antibodies. Neuro
Oncol 2012; 14:841-8; http://dx.doi.org/10.1093/
neuonc/nos118; PMID:22591661
64. Plonquet A, Garcia-Pons F, Fernandez E, Philippe
C, Marquet J, Rouard H, Delfau-Larue MH,
Kosmatopoulos K, Lemonnier F, Farcet JP, et al.
Peptides derived from the onconeural HuD protein can elicit cytotoxic responses in HHD mouse
and human. J Neuroimmunol 2003; 142:93-100;
PMID:14512168;
http://dx.doi.org/10.1016/
S0165-5728(03)00269-8
65. Rousseau A, Benyahia B, Dalmau J, Connan F,
Guillet JG, Delattre JY, Choppin J. T cell response
to Hu-D peptides in patients with anti-Hu syndrome. J Neurooncol 2005; 71:231-6; http://dx.doi.
org/10.1007/s11060-004-1723-1; PMID:15735910
66. Tanaka M, Tanaka K. Pathogenesis and treatment
of paraneoplastic neurologic syndrome. Expert
Rev Neurother 2002; 2:901-9; http://dx.doi.
org/10.1586/14737175.2.6.901; PMID:19810923
www.landesbioscience.com
67. Roberts WK, Deluca IJ, Thomas A, Fak J, Williams
T, Buckley N, Dousmanis AG, Posner JB, Darnell
RB. Patients with lung cancer and paraneoplastic
Hu syndrome harbor HuD-specific type 2 CD8+ T
cells. J Clin Invest 2009; 119:2042-51; http://dx.doi.
org/10.1172/JCI36131; PMID:19509467
68. Meresse B, Malamut G, Cerf-Bensussan N. Celiac
disease: an immunological jigsaw. Immunity
2012;
36:907-19;
http://dx.doi.org/10.1016/j.
immuni.2012.06.006; PMID:22749351
69. DeLuca I, Blachère NE, Santomasso B, Darnell
RB. Tolerance to the neuron-specific paraneoplastic HuD antigen. PLoS One 2009; 4:e5739;
http://dx.doi.org/10.1371/journal.pone.0005739;
PMID:19492067
70. Rosenblum MK. Paraneoplasia and autoimmunologic
injury of the nervous system: the anti-Hu syndrome.
Brain Pathol 1993; 3:199-212; PMID:8293180;
ht t p : //d x .doi.or g /10.1111/j.1750 -3 639.19 93.
tb00747.x
71. Galon J, Angell HK, Bedognetti D, Marincola
FM. The continuum of cancer immunosurveillance: prognostic, predictive, and mechanistic
signatures. Immunity 2013; 39:11-26; http://
d x . d o i . o r g /10 .1016 / j . i m m u n i . 2 013 . 0 7. 0 0 8 ;
PMID:23890060
72. Marrack P, Kappler JW. Do MHCII-presented neoantigens drive type 1 diabetes and other autoimmune
diseases? Cold Spring Harb Perspect Med 2012;
2:a007765; http://dx.doi.org/10.1101/cshperspect.
a007765; PMID:22951444
73. Sollid LM, Jabri B. Celiac disease and transglutaminase 2: a model for posttranslational modification
of antigens and HLA association in the pathogenesis of autoimmune disorders. Curr Opin Immunol
2011;
23:732-8;
http://dx.doi.org/10.1016/j.
coi.2011.08.006; PMID:21917438
74. de Graaf MT, de Beukelaar JW, Haasnoot GW,
Levering WH, Rogemond V, Didelot A, Honnorat
J, Gratama JW, Smitt PA. HLA-DQ2+ individuals are susceptible to Hu-Ab associated paraneoplastic neurological syndromes. J Neuroimmunol
2010; 226:147-9; http://dx.doi.org/10.1016/j.jneuroim.2010.05.035; PMID:20547426
75. Uchuya M, Fleury A, Graus F, Costagliola D, Liblau
R, Merle-Beral H, Théodorou I, Delattre JY. Lack of
association between human leukocyte antigens and
the anti-Hu syndrome in patients with small-cell lung
cancer. Neurology 1998; 50:565-6; PMID:9484403;
http://dx.doi.org/10.1212/WNL.50.2.565
76. Pellkofer HL, Voltz R, Goebels N, Hohlfeld R,
Dornmair K. Cross-reactive T-cell receptors in
tumor and paraneoplastic target tissue. Arch Neurol
2009; 66:655-8; http://dx.doi.org/10.1001/archneurol.2009.56; PMID:19433667
77. Bernal F, Graus F, Pifarré A, Saiz A, Benyahia B,
Ribalta T. Immunohistochemical analysis of antiHu-associated paraneoplastic encephalomyelitis.
Acta Neuropathol 2002; 103:509-15; http://dx.doi.
org/10.1007/s00401-001-0498-0; PMID:11935268
78. Dalmau J, Posner JB. Neurologic paraneoplastic
antibodies (anti-Yo; anti-Hu; anti-Ri): the case for a
nomenclature based on antibody and antigen specificity. Neurology 1994; 44:2241-6; PMID:7991105;
http://dx.doi.org/10.1212/WNL.44.12.2241
79. Bien CG, Vincent A, Barnett MH, Becker AJ,
Blümcke I, Graus F, Jellinger KA, Reuss DE, Ribalta
T, Schlegel J, et al. Immunopathology of autoantibody-associated encephalitides: clues for pathogenesis. Brain 2012; 135:1622-38; http://dx.doi.
org/10.1093/brain/aws082; PMID:22539258
80. Dalmau J, Furneaux HM, Rosenblum MK, Graus
F, Posner JB. Detection of the anti-Hu antibody in
specific regions of the nervous system and tumor
from patients with paraneoplastic encephalomyelitis/
sensory neuronopathy. Neurology 1991; 41:175764; PMID:1944905; http://dx.doi.org/10.1212/
WNL.41.11.1757
OncoImmunology
81. Graus F, Campo E, Cruz-Sanchez F, Ribalta T,
Palacin A. Expression of lymphocyte, macrophage
and class I and II major histocompatibility complex
antigens in normal human dorsal root ganglia. J
Neurol Sci 1990; 98:203-11; PMID:1700807; http://
dx.doi.org/10.1016/0022-510X(90)90261-K
82. Antoine JC, Mosnier JF, Honnorat J, Convers P,
Absi L, Lapras J, Michel D. Paraneoplastic demyelinating neuropathy, subacute sensory neuropathy,
and anti-Hu antibodies: clinicopathological study
of an autopsy case. Muscle Nerve 1998; 21:8507; PMID:9626244; http://dx.doi.org/10.1002/
( S I C I ) 10 9 7- 459 8 ( 19 9 8 0 7 ) 21 : 7< 85 0 : : A I D MUS2>3.0.CO;2-5
83. Wanschitz J, Hainfellner JA, Kristoferitsch W,
Drlicek M, Budka H. Ganglionitis in paraneoplastic
subacute sensory neuronopathy: a morphologic study.
Neurology 1997; 49:1156-9; PMID:9339709; http://
dx.doi.org/10.1212/WNL.49.4.1156
84. Plonquet A, Gherardi RK, Créange A, Antoine
JC, Benyahia B, Grisold W, Drlicek M, Dreyfus P,
Honnorat J, Khouatra C, et al. Oligoclonal T-cells
in blood and target tissues of patients with antiHu syndrome. J Neuroimmunol 2002; 122:1005; PMID:11777548; http://dx.doi.org/10.1016/
S0165-5728(01)00452-0
85. Kreutzfeldt M, Bergthaler A, Fernandez M, Brück
W, Steinbach K, Vorm M, Coras R, Blümcke I,
Bonilla WV, Fleige A, et al. Neuroprotective intervention by interferon-γ blockade prevents CD8+ T
cell-mediated dendrite and synapse loss. J Exp Med
2013; 210:2087-103; http://dx.doi.org/10.1084/
jem.20122143; PMID:23999498
86. Voltz R, Dalmau J, Posner JB, Rosenfeld MR. T-cell
receptor analysis in anti-Hu associated paraneoplastic encephalomyelitis. Neurology 1998; 51:114650; PMID:9781545; http://dx.doi.org/10.1212/
WNL.51.4.1146
87. Siewert K, Malotka J, Kawakami N, Wekerle H,
Hohlfeld R, Dornmair K. Unbiased identification of
target antigens of CD8+ T cells with combinatorial
libraries coding for short peptides. Nat Med 2012;
18:824-8;
http://dx.doi.org/10.1038/nm.2720;
PMID:22484809
88. Carpentier AF, Rosenfeld MR, Delattre JY, Whalen
RG, Posner JB, Dalmau J. DNA vaccination with
HuD inhibits growth of a neuroblastoma in mice.
Clin Cancer Res 1998; 4:2819-24; PMID:9829748
89. Kazarian M, Calbo J, Proost N, Carpenter CL,
Berns A, Laird-Offringa IA. Immune response
in lung cancer mouse model mimics human antiHu reactivity. J Neuroimmunol 2009; 217:38-45;
http://dx.doi.org/10.1016/j.jneuroim.2009.08.014;
PMID:19765830
90. Pellkofer H, Schubart AS, Höftberger R, Schutze N,
Pagany M, Schüller M, Lassmann H, Hohlfeld R,
Voltz R, Linington C. Modelling paraneoplastic CNS
disease: T-cells specific for the onconeuronal antigen
PNMA1 mediate autoimmune encephalomyelitis
in the rat. Brain 2004; 127:1822-30; http://dx.doi.
org/10.1093/brain/awh205; PMID:15201193
91. Oh SJ, Dropcho EJ, Claussen GC. Anti-Hu-associated
paraneoplastic sensory neuropathy responding to
early aggressive immunotherapy: report of two cases
and review of literature. Muscle Nerve 1997; 20:157682; PMID:9390671; http://dx.doi.org/10.1002/
( SIC I )1097- 4598 (199712 ) 2 0 :12 <1576 : : A I D MUS13>3.0.CO;2-Z
92. Brinkmann V, Billich A, Baumruker T, Heining
P, Schmouder R, Francis G, Aradhye S, Burtin P.
Fingolimod (FTY720): discovery and development of
an oral drug to treat multiple sclerosis. Nat Rev Drug
Discov 2010; 9:883-97; PMID:21031003; http://
dx.doi.org/10.1038/nrd3248
e27384-9
93. Ifergan I, Kebir H, Alvarez JI, Marceau G, Bernard
M, Bourbonnière L, Poirier J, Duquette P, Talbot
PJ, Arbour N, et al. Central nervous system recruitment of effector memory CD8+ T lymphocytes during neuroinflammation is dependent on α4 integrin.
Brain 2011; 134:3560-77; http://dx.doi.org/10.1093/
brain/awr268; PMID:22058139
94. Planas R, Jelčić I, Schippling S, Martin R, Sospedra
M. Natalizumab treatment perturbs memory- and
marginal zone-like B-cell homing in secondary lymphoid organs in multiple sclerosis. Eur J Immunol
2012;
42:790-8;
http://dx.doi.org/10.1002/
eji.201142108; PMID:22144343
e27384-10
95. Scheikl T, Pignolet B, Dalard C, Desbois S, Raison
D, Yamazaki M, Saoudi A, Bauer J, Lassmann H,
Hardin-Pouzet H, et al. Cutting edge: neuronal recognition by CD8 T cells elicits central diabetes insipidus. J Immunol 2012; 188:4731-5; http://dx.doi.
org/10.4049/jimmunol.1102998; PMID:22504649
96. Riley JL. Combination checkpoint blockade--taking
melanoma immunotherapy to the next level. N Engl
J Med 2013; 369:187-9; http://dx.doi.org/10.1056/
NEJMe1305484; PMID:23724866
OncoImmunology
Volume 2 Issue 12
! "" !)( &! !( # !%( ( !
"( !( ("!!(!!!
"
" """$(,*+-
+--
3302
Guillaume Martin-Blondel et al.
DOI: 10.1002/eji.201545632
Eur. J. Immunol. 2015. 45: 3302–3312
Migration of encephalitogenic CD8 T cells into
the central nervous system is dependent
on the α4β1-integrin
Guillaume Martin-Blondel ∗1,2,3 , Béatrice Pignolet ∗2,3,5 , Silvia Tietz4 ,
Lidia Yshii2,3 , Christina Gebauer2,3 , Therese Perinat4 , Isabelle Van
Weddingen2 , Claudia Blatti4 , Britta Engelhardt ∗∗4 and Roland Liblau ∗∗2,3
1
Department of Infectious and Tropical Diseases, Toulouse University Hospital, Toulouse,
France
2
INSERM U1043 - CNRS UMR 5282, Centre de Physiopathologie de Toulouse Purpan (CPTP),
Toulouse, France
3
Université Toulouse III, Toulouse, France
4
Theodor Kocher Institute, University of Bern, Bern, Switzerland
5
Department of Clinical Neurosciences, Toulouse University Hospital, Toulouse, France
Although CD8 T cells are key players in neuroinflammation, little is known about their
trafficking cues into the central nervous system (CNS). We used a murine model of CNS
autoimmunity to define the molecules involved in cytotoxic CD8 T-cell migration into the
CNS. Using a panel of mAbs, we here show that the α4β1-integrin is essential for CD8
T-cell interaction with CNS endothelium. We also investigated which α4β1-integrin ligands expressed by endothelial cells are implicated. The blockade of VCAM-1 did not
protect against autoimmune encephalomyelitis, and only partly decreased the CD8+
T-cell infiltration into the CNS. In addition, inhibition of junctional adhesion molecule-B
expressed by CNS endothelial cells also decreases CD8 T-cell infiltration. CD8 T cells may
use additional and possibly unidentified adhesion molecules to gain access to the CNS.
Keywords: α4β1-Integrin r CD8 T cell r Junctional adhesion molecule-B r Migration r Neuroinflammation
Additional supporting information may be found in the online version of this article at the
publisher’s web-site
Introduction
The central nervous system (CNS) is considered as a unique
immune-privileged environment allowing a basal immune surveillance under physiological conditions, and restraining potentially
deleterious inflammatory reactions in disease states [1, 2]. A tight
control of the trafficking of immune cells toward the CNS is a
Correspondence: Dr. Roland Liblau
e-mail: [email protected]
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
major parameter contributing to this immune-privileged status
[3]. Indeed, circulating immune cells have to cross protective barriers using a complex multistep cascade that involves distinct trafficking cues both at the surface of the CNS endothelial cells and
of immune cells [4].
The current knowledge regarding T-cell migration into the CNS
derives mainly from CD4 T cells whereas little is known for CD8
∗
These authors contributed equally to this work.
These authors are co-principal investigators of this work.
∗∗
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 3302–3312
T cells. Under inflammatory conditions, either due to autoimmune
responses or infection, the inflamed blood-brain barrier (BBB)
endothelium upregulates the expression of adhesion molecules
(selectins and cell adhesion molecules of the immunoglobulin
superfamily). Several surface molecules expressed by CD4 T cells,
such as P-selectin glycoprotein ligand-1, αLβ2, α4β1, CD6, or α6β1,
regulate sequential steps for transmigration that include tethering,
rolling, capture, firm adhesion, and finally diapedesis of bloodborne circulating T cells across the endothelial layer [4]. Antigen recognition in the subarachnoidal spaces then allow T cells
to migrate through the glia limitans superficialis into the CNS
parenchyma, leading to clinical disease [5]. In this scenario, a
pivotal role for the interaction between the α4β1-integrin heterodimer expressed by activated T helper 1 CD4 cells, and vascular
cell adhesion protein 1 (VCAM-1), its main ligand on BBB endothelial cells, has been demonstrated [6–10]. However, as Th17 CD4
cells were shown to infiltrate the brain in the absence of α4integrin in an αLβ2-dependent manner [10, 11], α4-independent
routes to the CNS exist for other crucial T-cell subsets.
Although cumulative evidence points to a key role for CD8
T cells in several inflammatory CNS disorders such as MS, autoimmune encephalitis, or immune reconstitution inflammatory syndrome (IRIS) affecting the CNS [12–14], little is known about
trafficking of CD8 T cells into the CNS. Interaction between
P-selectin glycoprotein ligand-1 and P-selectin contributes to the
recruitment of human CD8 T cells in brain vessels [15]. CD8
T-cell migration is not affected by blocking interactions between
αLβ2/ICAM-1, ALCAM/CD6, PECAM-1/PECAM-1, or CCL2/CCR2,
while all of them were previously shown to partake in the recruitment of other immune cell populations to the CNS [16, 17]. The
conflicting results about neutralization of α4-integrin in EAE and
in coronavirus-induced encephalitis, restricting or not CD8 T-cell
infiltration of the CNS, suggest that these cells may use alternative
and possibly unidentified adhesion molecules to gain access to the
CNS, raising the potential for selective control of their trafficking
into the brain [10, 17, 18].
Using a murine model of CNS autoimmunity, the aim of our
study was to define the role of α4-integrins in the CD8 T-cell
migration across the BBB during neuroinflammation, and to specify which of the heterodimers containing the α4-integrin subunit,
namely α4β1 and α4β7, is implicated.
Results
α4β1-Integrin blockade protects CamK-HA mice from
developing CD8 T-cell-mediated encephalomyelitis
CamK-HA mice selectively express the Haemagglutinin (HA) of
the Influenza virus in neurons under the control of the calmodulin
kinase promoter. These mice, but not control littermates, exhibited severe encephalomyelitis characterized by weight loss, neurological signs, and death in 40–50% of recipients after the adoptive transfer of 5 × 106 in vitro generated cytotoxic HA-specific
CD8 T cells. Diabetes insipidus caused by the CD8-mediated
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Cellular immune response
destruction of arginine-vasopressin hypothalamic neurons was a
prominent clinical manifestation in the surviving CamK-HA recipients [19]. Endogenous CD4 and CD8 T cells also infiltrated the
CNS of CamK-HA mice developing encephalomyelitis (Supporting
Information Fig. 1A–B). However, because CD4 T cell-depleted
recipients underwent weight loss and diabetes insipidus, endogenous CD4 T cells are not required for disease development (Supporting Information Fig. 1C–D).
To delineate in this model the role of α4-integrin in CD8 T-cell
migration to the CNS, we first showed that in vitro differentiated
cytotoxic HA-specific CD8 T cells express both α4- and β7-integrin
subunits, and the α4β7-integrin heterodimer (Fig. 1A). Because
there is no mAb against the α4β1-integrin heterodimer, we used
an in vitro binding assay to indirectly show that in vitro differentiated cytotoxic HA-specific CD8 T cells express the α4β1-integrin
heterodimer. While HA-specific CD8 T cells untreated or treated
with a control IgG bind to recombinant ICAM-1 and VCAM-1,
an anti-α4-integrin mAb completely inhibited binding to VCAM-1
(one-way ANOVA, p < 0.00001), but did not affect binding to
ICAM-1 (Fig. 1B). As VCAM-1 is the main ligand of the α4β1integrin heterodimer, this suggests that HA-specific CD8 T cells
express the functional α4β1-integrin heterodimer.
We then assessed whether treatment of CamK-HA mice with
anti-α4-integrin mAb could protect against CD8 T-cell-mediated
encephalomyelitis. Therefore, we treated CamK-HA recipients
with an anti-α4-integrin or a control IgG at day 0, 4, and 8 after
the adoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells.
Compared to recipients receiving the control IgG, CamK-HA recipients treated by anti-α4-integrin mAb lost less weight (one-way
ANOVA, p < 0.0001) and showed no death (0/10 versus 5/10,
Log-rank test, p = 0.006). In addition, survivors experienced less
diabetes insipidus (2/10 versus 4/5) (Fig. 1C–E). Since α4-integrin
is a subunit shared by both α4β1- and α4β7-integrin heterodimers,
we then investigated which one is involved in CD8 T-cell migration into the CNS. Currently no mAb is available that specifically
recognizes the α4β1-integrin heterodimer, while the DATK32 mAb
recognizes and blocks specifically the α4β7-integrin heterodimer
[7]. We therefore treated CamK-HA recipients with this anti-α4β7integrin mAb. Recipients underwent the same clinical phenotype
as mice receiving the control mAb. Indirectly, this strongly suggests that the α4β1-integrin is the essential heterodimer for activated CD8 T-cell migration into the CNS in our model. However,
α4-integrin blockade did not fully abrogate the neurological signs
induced by HA-specific CD8 T-cell transfer in CamK-HA mice as
significant weight loss developed when compared to control littermates (Fig. 1C), and central diabetes insipidus was detected in
20% of treated recipients.
Blockade of the α4β1-integrin reduces CD8 T-cell
infiltration and microglial activation in the CNS
We next investigated the impact of α4β1-integrin blockade on CNS
inflammatory infiltrate composition and tissue damage. Eight days
after the adoptive transfer of 5 × 106 cytotoxic HA-specific CD8
www.eji-journal.eu
3303
3304
Guillaume Martin-Blondel et al.
Eur. J. Immunol. 2015. 45: 3302–3312
Figure 1. α4β1-integrin blockade protects
CamK-HA mice from developing CD8 T-cellmediated encephalomyelitis. (A) FACS analysis of α4-integrin subunit, β7-integrin subunit,
and α4β7-integrin heterodimer expression on in
vitro differentiated cytotoxic HA-specific CD8
T cells (one experiment representative of three
experiments of in vitro differentiation of HAspecific cytotoxic CD8 T cells).(B) In vitro binding assay of cytotoxic HA-specific CD8 T cells
to recombinant ICAM-1 or VCAM-1 IgG and
a control protein (DNER-IgG), after pretreatment with isotype control rat IgG2b or antiα4-integrin-IgG. Pooled data from three independent experiments, each point representing
the mean of triplicates. One-way ANOVA ****p <
0.00001. (C and D) Adoptive transfer at day 0 of
5 × 106 cytotoxic HA-specific CD8 T cells in nontransgenic mice or in CamK-HA mice treated at
day 0, 4, and 8 by an anti-α4, an anti-α4β7, or a
control IgG mAb. Impact on the weight (C) and
on survival (D) of the recipient mice is shown.
(C) One-way ANOVA ***p < 0.0001. (D) Log-rank
(Mantel–Cox) test *p < 0.01. (E) Incidence of diabetes insipidus among survivors at day 24 after
the adoptive transfer of 5 × 106 cytotoxic HAspecific CD8 T cells in nontransgenic mice or
in CamK-HA mice treated at day 0, 4, and 8 by
an anti-α4, an anti-α4β7, or a control IgG mAb.
Diabetes insipidus is defined using dipsticks by
a urine-specific gravity ࣘ 1010 on three consecutive days. (C), (D), and (E) are pooled data from
three independent experiments, each involving three to five mice per group. Data represent
mean ± SEM.
T cells, CamK-HA recipients treated with an anti-α4-integrin mAb
or a control IgG were sacrificed and their CNS-infiltrating cells
were analyzed by flow cytometry. A drastic reduction in the number of CD45high Thy1.2+ T cells infiltrating the CNS was observed
in recipients treated with the anti-α4-integrin mAb (1333 ± 263
versus 35 452 ± 5748 cells/CNS, respectively, Mann–Whitney test,
p < 0.0001; Fig. 2A–B). Ex vivo analysis of splenocytes showed
that the anti-α4-integrin mAb did not deplete CD8 T cells in the
periphery, and even promoted the accumulation of transferred
cells in the secondary lymphoid organs (Supporting Information
Fig. 2A–B). Moreover, ex vivo analyses and restimulation with the
cognate HA peptide showed that the anti-α4-integrin mAb also
did not affect activation of transferred CD8 T cells collected from
spleen and lymph nodes (Supporting Information Fig. 2C–F). In
the CNS, we observed a decrease in microglial activation, evaluated by MHC class II expression on CD45int CD11b+ cells, in
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
recipients treated by the anti-α4-integrin mAb (MFI for MHC class
II 589 ± 127 versus 6825 ± 1172, Mann–Whitney test, p = 0.0002;
Fig. 2C–D). Histological analysis also corroborated the marked
reduction in the parenchymal CD8 T-cell infiltration in recipients treated by the anti-α4-integrin mAb-treated animals (Mann–
Whitney test, p = 0.0002; Fig. 2E–G), while some meningeal CD8
T cells could still be detected. Antagonization of α4β1-integrin,
therefore inhibits CD8 T-cell infiltration and microglial activation
in the CNS parenchyma of recipient CamK-HA mice.
VCAM-1 blockade retains the clinical phenotype and
only partly decreases CD8 T cell CNS infiltration
To further investigate how α4β1-integrin contributes to CD8 T cell
trafficking to the CNS, we investigated which ligand expressed
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 3302–3312
Cellular immune response
Figure 2. Blockade of the α4β1-integrin reduces T-cell infiltration and microglial activation in the CNS. (A–D) FACS analysis of CNS-infiltrating
cells at day 8 after adoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells in CamK-HA mice treated at day 0 and 4 by an anti-α4 or a control
IgG mAb. (A) Illustration of the gating strategy. (B) Absolute number of CD45high Thy1.2+ T cells infiltrating the CNS. Each dot shows an individual
animal. Mann–Whitney test *** p < 0.0001. (C) Overlay of MHC class II expression on CD45int CD11b+ cells in mice treated by a control IgG (black line),
or anti-α4 mAb (red line). One representative out of three independent experiments is shown. (D) The MFI of MHC class II expression on CD45int
CD11b+ microglial cells is shown. Mann–Whitney test *** p = 0.0002. Each dot shows an individual animal. (B and D) are pooled data from three
independent experiments, each involving three to five mice per group. Data represent mean ± SEM. (E–G) Brain CD8 T-cell infiltration at day 8 after
adoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells in CamK-HA mice treated at day 0 and 4 by a control IgG (E) or an anti-α4-integrin
mAb (F; bar = 50 μm). (G) Histological scoring for parenchymal CD8 T-cell infiltration. Pool of three independent experiments, each involving three
to five mice per group. Mann–Whitney test *** p = 0.0002. Data represent mean ± SEM.
on brain microvascular endothelial cells may interact with α4β1integrin. First, we blocked in vivo VCAM-1, the major ligand for
α4β1-integrin [20], using two distinct mAbs. As both mAbs provided identical results (Fig. 3A), the two groups were pooled in
Figure 3B and C. CamK-HA recipients treated by anti-VCAM-1 mAb
lost more weight (one-way ANOVA, p < 0.0001) and developed
diabetes insipidus more frequently (9/11 versus 1/6, chi-square
test with Yates’ correction, p = 0.036) compared to mice treated by
the anti-α4-integrin mAb (Fig. 3A–C). Clinical outcomes (weight
loss, diabetes insipidus, and death) were not significantly different between recipient mice treated with the anti-VCAM-1 mAbs or
with the control IgG.
To assess the impact of VCAM-1 inhibition on CD8 T-cell infiltration of the CNS, and to unambiguously identify and enumerate the transferred cells, CD45.1+ HA-specific CD8 T cells were
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
injected in CD45.2+ CamK-HA mice (Fig. 3D). Flow cytometry
analysis of CNS-infiltrating cells from CamK-HA recipients 8 days
after the adoptive transfer revealed a significant reduction in the
number of transferred CD45.1+ CD8 T cells in mice treated with
anti-VCAM-1 mAbs compared to mice receiving the control IgG
(7990 ± 1862 versus 14 331 ± 1582 cells, Mann–Whitney test,
p = 0.01; Fig. 3E). However, VCAM-1 blockade reduced the number of CNS-infiltrating transferred CD8 T cells to a much lesser
extent than the use of anti-α4-integrin mAb (161 ± 48 cells, Mann–
Whitney test, p < 0.0001). Collectively, these data indicate that
blockade of VCAM-1 partially inhibits the α4β1-dependent migration of CD8 T cells across the BBB, but does not protect mice from
developing CNS tissue damage, suggesting that additional vascular ligands of α4β1-integrin might be implicated in CD8 T cell
trafficking into the CNS.
www.eji-journal.eu
3305
3306
Guillaume Martin-Blondel et al.
Eur. J. Immunol. 2015. 45: 3302–3312
Figure 3. VCAM-1 blockade retains the clinical phenotype and only partly decreases CD8 T cell CNS infiltration. (A–C) Adoptive transfer of 5 ×
106 cytotoxic HA-specific CD8 T cells in CamK-HA mice treated at day 0, 4, and 8 by an anti-α4-integrin, a control IgG, anti-VCAM-1 (clone 429
or 6C7.1), or an anti-JAM-B mAb. Impact on the weight (A), survival (B), and on development of diabetes insipidus (C). Pool of two independent
experiments, each involving three to six mice per group. (A) One-way ANOVA ***p < 0.0001. (B) Log-rank (Mantel–Cox) test, ns. Data represent mean
± SEM. (D–F) FACS analysis of CNS-infiltrating cells at day 8 after adoptive transfer of 5 × 106 CD45.1+ cytotoxic HA-specific CD8 T cells in CD45.2+
CamK-HA mice treated at day 0 and 4 by a control IgG, an anti-α4-integrin, an anti-VCAM-1 (clone 6C7.1), an anti-JAM-B, or both an anti-VCAM-1
and anti-JAM-B mAbs. (D) Illustration of the general gating strategy. (E) Absolute number of CD45.1+ CD8+ T cells infiltrating the CNS. Pool of two
to three independent experiments using three to five mice per group. Mann–Whitney test, *p < 0.05, **p < 0.001, ***p < 0.0001. Data represent mean
± SEM. (F) Percentage of CD45. 1+ CD8+ T cells that are CD44+ CD62L− and that produce IFN-γ and TNF-α. Pool of two independent experiments
using two to three mice per group. One-way ANOVA, ns. Data represent mean ± SEM.
JAM-B is a ligand for α4β1-integrin implicated in CD8
T-cell migration to the CNS
Because junctional adhesion molecule-B (JAM-B) had been
reported to be a ligand for α4β1-integrin on endothelial cells
[21], we assessed the contribution of JAM-B as another putative
BBB endothelial ligand for α4β1-integrin in CD8 T-cell migration
into the CNS. Indeed, CNS microvascular endothelial cells express
JAM-B in addition to PECAM-1 (Fig. 4). We investigated whether
JAM-B could be potential ligand for α4β1-integrin expressed on
CD8 T cells. We treated CamK-HA recipients with an anti-JAM-B
mAb at day 0, 4, and 8 after the adoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells. While CamK-HA recipients treated
by the anti-JAM-B mAb displayed significantly less weight loss
compared to recipients treated by control IgG or anti-VCAM-1
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
mAbs, they displayed the same incidence of diabetes insipidus and
death (Fig. 3A–C). Flow cytometry analysis of the CNS of CamKHA recipients treated by anti-JAM-B mAb showed a significant
decrease in the number of infiltrating CD45.1+ CD8 transferred
cells compared to mice receiving the control IgG (7016 ± 2029
versus 14 331 ± 1582 cells/CNS, Mann–Whitney test, p = 0.017;
Fig. 3E). This decrease was similar to that achieved when blocking VCAM-1 (Mann–Whitney test, ns), but clearly inferior to the
inhibition achieved by the anti-α4-integrin mAb (Mann–Whitney
test, p = 0.0017; Fig. 3E). Increased dose of anti-JAM-B mAb
did not improve the reduction of CNS-infiltrating CD45.1+ CD8+
transferred cells, suggesting that saturating concentrations of the
antibody were obtained (Supporting Information Fig. 3). Therefore, JAM-B expressed by BBB endothelial cells might represent a
ligand for α4β1-integrin-mediated migration of CD8 T cells into
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 3302–3312
Cellular immune response
Figure 4. CNS microvascular endothelial cells express JAM-B in addition to PECAM-1. (A–C) Immunofluorescence staining for JAM-B in the
mouse CNS was evaluated on cryosections (6 μm) of brains of CamK-HA mice day 8 after adoptive transfer of 5 × 106 cytotoxic HA-specific
CD8 T cells. Double immunofluorescence staining of JAM-B (A) and PECAM-1 (B) show colocalization of JAM-B and PECAM-1 staining (C) on
all vessels in the mouse cortex. Arrowheads point to representable JAM-B positive (A) and JAM-B/PECAM-1 double positive vessels (C). (D–F)
Double immunofluorescence staining of JAM-B (D, arrowheads) and VCAM-1 (E) show a colocalization of JAM-B and VCAM-1 (F) on blood vessels
(arrowhead), however JAM-B immune staining can additionally be detected on endothelial cells staining negative for VCAM-1. (F) Arrowheads with
stars point to JAM-B positive vessels that do not stain positive for VCAM-1. (G–I) Isotype control staining with rabbit IgG control antibody (G) and
PECAM-1 (H) shows no staining for the rabbit IgG (G and I). The variability in background with the anti-JAM-B antibody observed in (A), (D), and (J)
is related to the area in the CNS and the inflammatory status of the brain. All sections were counter-stained with DAPI to show cell nuclei. Bars
are 50 μm. Panel shown above constitutes one representative staining; in total three individual tissues were processed.
the CNS. In order to test the hypothesis that VCAM-1 and JAM-B
are complementary ligands for α4β1-integrin, we treated recipients with both anti-JAM-B and anti-VCAM-1 mAbs. Coadministration of both mAbs did not demonstrate a synergistic reduction in
the number of CNS-infiltrated CD45.1+ CD8 transferred T cells
(Fig. 3E). We finally investigated the phenotype of CD8 T cells
that entered the CNS of CamK-HA recipients after blockade of α4integrin, α4β7-integrin, VCAM-1, or JAM-B. Whereas their absolute numbers differed importantly between groups, the proportion
of transferred CD45.1+ CD8 T cells that are CD44+ CD62L− , and
that produce both IFN-γ and TNF-α did not significantly differ
between groups (Fig. 3F).
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Discussion
Molecular cues used by CD8 T cells to migrate into the CNS are
poorly defined. Using a murine model of CNS autoimmune neuroinflammation, we showed that the migration of cytotoxic CD8
T cells to the CNS relies on the α4β1-integrin heterodimer. We also
showed that VCAM-1 and JAM-B expressed by BBB endothelial
cells are likely implicated in this process, but that their inhibition
is insufficient to completely block CD8 T-cell infiltration into the
CNS or to mitigate the clinical encephalomyelitis signs.
Two studies using animal models of neuroinflammation and
in vitro transmigration assays demonstrated that blocking the
www.eji-journal.eu
3307
3308
Guillaume Martin-Blondel et al.
α4-integrin decreases migration of CD8 T cells across CNS vascular structures [17, 18]. However, because the α4-integrin is common to α4β1- and α4β7-integrin heterodimers [22], it is unknown
which one is implicated. Our model showed that blockade of
α4-integrin, but not of the α4β7-integrin heterodimer, prevents
encephalomyelitis and tissue damage by interfering with cytotoxic
CD8 T-cell entry into the CNS. These results strongly suggest that
the α4β1-integrin is the essential heterodimer for the interaction of
activated CD8 T cells with the BBB. Similarly, blocking α4-integrin
can abrogate the development of EAE mediated by encephalitogenic CD4 Th1 cells [7–10]. Those cells critically rely on β1integrin to accumulate in the CNS during EAE [6]. Moreover,
blocking the α4β7-integrin heterodimer fails to inhibit EAE development in mice and Rhesus monkeys [7, 23], and ectopic expression of the α4β7-integrin ligand MAdCAM-1 in CNS endothelial
cells fails to trigger CNS recruitment of α4β7-expressing T cells
[24]. Thus, α4β1-integrin rather than α4β7-integrin mediates both
CD4 and CD8 T-cell interaction with CNS endothelium. However, as α4-integrin blockade did not totally abrogate clinical signs
and CNS infiltration of transferred CD8 T cells in our model, an
α4β1-independent route, although accessory, remains operative.
Its molecular bases are still to be determined.
The most studied brain endothelial ligand for α4β1-integrin is
VCAM-1 [20]. VCAM-1 is constitutively expressed at low level on
the BBB endothelium, and mediates both the initial capture and
the subsequent G-protein-dependent arrest of CD4 Th1 cells upon
interaction with the α4β1-integrin [8]. Expression of VCAM-1
is upregulated in inflammatory conditions on endothelial cells
of the BBB and of the blood-leptomeningeal barrier, as well as
on choroid plexus epithelium of the blood-cerebrospinal fluid
barrier, further increasing α4β1/VCAM-1-mediated T-cell adhesion to inflamed CNS endothelium [25, 26]. It was previously
shown that VCAM-1 blockade inhibits clinical or histopathological signs of EAE mediated by encephalitogenic CD4 Th1 cells [7].
In a model of OVA-expressing Listeria monocytogenes infection,
access of OVA-specific CD8 T cells to the CNS was inhibited by the
antibody-mediated blockade of VCAM-1 to the same extent as did
the α4-integrin blockade [18]. Unexpectedly, blockade of VCAM1 in our model only had a partial effect on CD8 T-cell migration
to the CNS, as the number of CNS-infiltrated CD8 T cells was
reduced by 46% compared to mice treated by the control IgG
(Fig. 3D). This decrease was not clinically relevant as recipients
treated with different clones of anti-VCAM-1 mAb experienced
weight loss, death, and diabetes insipidus to the same extent as
mice treated by the control IgG. Therefore, VCAM-1 blockade was
not sufficient in our model to inhibit α4β1-expressing CD8 T-cells
migration into the CNS. Several differences between our study and
that of Young et al. [18] might explain those discordant results,
including the genetic background of the mice, BALB/c or (BALB/c
× C57BL6) F1 versus C57BL6/J, the localization of the HA and
OVA antigens in different cells, neurons and oligodendrocytes,
respectively, and the state of differentiation of the encephalitogenic CD8 T cells (terminally differentiated highly cytotoxic versus shortly activated CD8 T cells). Moreover, the L. monocytogenes
infection within the CNS in this model might induce additional
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Immunol. 2015. 45: 3302–3312
triggers including increased expression of VCAM-1 at the BBB,
allowing for increased VCAM-1-dependence of CD8 T-cell migration into the CNS. It was suggested that natalizumab, a humanized
mAb against the human α4 subunit of α4β1-integrin and α4β7,
might also affect CD4 and CD8 T-cell expression of α4-integrinunrelated molecules such as CD62L, CXCR3, and αLβ2 in longterm treated natalizumab patients [27, 28]. Here, we have used
a very short treatment. In addition, the high specificity of PS/2
for the murine α4-integrin subunit makes this antibody unlikely
to cross-react with other integrin subunit or unrelated molecules
such as selectins. Indeed, PS/2 recognizes the functional epitope
B2 on the α4-integrin subunit and was shown to specifically block
α4β1-mediated lymphocyte binding to VCAM-1 and fibronectin as
well as α4β7-dependent binding to VCAM-1 and MAdCAM-1 in
vitro [29, 30]. Another explanation could be that, in our model,
VCAM-1 is not the sole, or even not the main, ligand for α4β1integrin.
In that respect, we investigated if other known α4β1-integrin
ligands might be implicated. At least two additional vascular ligands have been described, the CS1 domain of a spliced variant of
fibronectin [31, 32], and JAM-B [21, 33]. Since no reliable blocking antibody against CS1 domain is currently available, the role
of fibronectin in the migration process of CD8 T cells could not
be explored yet. Because α4β1–JAM-B interaction has only been
investigated in vitro or in vivo in skin microvasculature [21], and
because JAM-B is expressed by the BBB in our model, we focused
on this putative ligand for CD8 T-cell migration to the CNS. Members of the classical JAM family are transmembrane type 1 proteins
with two immunoglobulin domains highly expressed in cells that
present well organized tight junctions, such as the endothelium
of the BBB [34]. JAM-A, interacting with αLβ2-integrin, is implicated in cell migration to the CNS. A blocking mAb directed to
JAM-A significantly inhibited leukocyte infiltration in the CSF and
the brain parenchyma in a model of cytokine-induced meningitis [35]. However, those results were not confirmed in infectious
meningitis [36]. JAM-B plays a central role in the regulation of
paracellular permeability [34], but also impacts T-cell rolling and
firm adhesion [21]. Although a lack of JAM-B expression at steady
state on brain endothelial cells was suggested [37], we show that
JAM-B is expressed on brain endothelial cells in our murine model
of CNS autoimmunity. Because blockade of JAM-B was associated
to a partial protection against encephalomyelitis and a significant
reduction in the number of infiltrated CD8 T cells, however to a
lesser extent than α4β1-integrin blockade, our data suggest that
JAM-B participates to the CD8 T-cell migration process to the CNS.
The discovery of the role of α4β1–VCAM-1 interaction in
T-cell migration to the CNS led to the development of natalizumab, which has proven to be highly beneficial in relapsingremitting MS [38]. Unfortunately, natalizumab is associated with
an increased risk of developing progressive multifocal leukoencephalopathy (PML), an opportunistic disease of the CNS caused
by John Cunningham (JC) virus infection of oligodendrocytes
[39]. Development of PML following natalizumab therapy likely
relies on a multifactorial scenario including permissiveness for
active JC virus replication and impaired immune surveillance
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 3302–3312
[40–43]. Compared with untreated MS patients, natalizumab
treatment induces a decrease in cerebrospinal fluid CD4 and CD8
T cells [44, 45]. Because CD4 and CD8 T cells are crucial in
controlling JC virus reactivation and dissemination [46, 47], our
results suggest that development of PML is, at least in part, due to
natalizumab-mediated inhibition of CNS immunosurveillance by
JC virus-specific CD8 T cells. Furthermore, natalizumab-associated
PML in MS patients is often complicated after natalizumab withdrawal by IRIS, darkening again the prognosis [48]. Although CD4
T cells might participate [49], a clear dominance of CD8 T cells
in CNS-infiltrates has been observed in natalizumab-associated
PML-IRIS occurring in patients with MS [50], reminiscent of the
PML-IRIS pathology described in HIV-infected patients [51]. This
indirectly supports the idea that the discontinuation of natalizumab allows migration of CD8 T cell to the CNS.
Migration of encephalitogenic CD8 T cells to the CNS is
dependent on the α4β1-integrin. α4β1-Integrin blockade in MS
is beneficial but exposes to opportunistic viral infections due to
the disruption of CNS immune surveillance. Because CD8 T cells
requirements for CNS migration are distinct from those of other
immune cells, future work should help identify novel molecular targets to block specifically CNS recruitment of destructive
immune cells while leaving the migration of protective immune
cell subsets into the CNS unaffected.
Materials and methods
Mice
The CL4-TCR transgenic mouse line expresses an H-2Kd -restricted
TCR (Vα10; Vβ8.2) against the Influenza virus HA transmembrane
peptide amino acids 512–520 (IYSTVASSL) [52]. The CamK-iCre
[53] and the Rosa26tm(HA)1Lib [54] mice have been described previously. CamK-HA mice were obtained by crossing the CamK-iCre
transgenic mice with the Rosa26tm(HA)1Lib mice [19]. Cre-mediated
genomic DNA recombination and the resulting transcription of HA
occurred only in CamK-HA mice and were confined to the brain
and spinal cord [19]. Mice were backcrossed at least six times
on the BALB/c background. In some experiments, to benefit from
a congenic marker allowing the distinction between transferred
HA-specific CD8 T cells (CD45.1) and recipient T cells (CD45.2),
donor and recipient mice on a (BALB/c × C57BL6) F1 background
were used. Of note, the number of T cells infiltrating the CNS of
CamK-HA mice did not differ between the BALB/c and the (BALB/c
× C57BL6) F1 backgrounds (Supporting Information Fig. 4). All
mice were 6–9-week-old at the onset of the experiments. Mice
were kept under specific pathogen-free conditions. This study was
carried out in strict accordance with EU regulations and with the
recommendations of the French national chart for ethics of animal experiments (articles R 214-87–90 of the “Code rural”). The
protocol was approved by the committee on the ethics of animal experiments of the région Midi-Pyrénées (permit numbers:
04-U563-DG-06 and MP/18/26/04/04). All procedures were per
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Cellular immune response
formed under deep anesthesia as described below and all efforts
were made to minimize animal suffering.
In vitro differentiation and adoptive transfer of
HA-specific cytotoxic CD8 T cells
HA-specific cytotoxic CD8 T cells were generated as previously
described [55]. Briefly, 5.105 purified naive CD8 T cells from CL4TCR mice were stimulated with 5.106 irradiated syngeneic splenocytes in DMEM supplemented with 10% FCS (Life Technologies,
Paisley, Scotland) containing 1 mM HA peptide, 1 ng/mL IL-2, and
20 ng/mL IL-12. On day 5, cells were collected by Ficoll density
separation and 5 × 106 living cytotoxic CD8 T cells were injected
intravenously in recipient mice. Cells routinely contained >98%
CD8+ CD3+ Vβ8.2+ T cells and >95% of them produce high levels
of granzyme B and IFN-γ.
Antibodies used for in vivo experiments
mAbs were injected intravenously. Entotoxin-free rat mAb
against mouse α4-integrin (clone PS/2, IgG2b, 250 μg/injection),
α4β7-integrin (clone DATK32, IgG2a, 500 μg/injection),
VCAM-1 (clone 6C7.1, IgG1, 250 μg/injection), and
antiendoglin (control IgG, clone MJ7/18, IgG2a, 250 μg/
injection) were produced in B.E.’s lab. The rat anti-CD4-depleting
mAb (clone GK1.5, IgG2b, 500 μg/injection) was produced in
R.L.’s lab. The anti-VCAM-1 clone 429 (IgG2a, 100 μg/injection)
and the anti-JAM-B clone 150005 (IgG2a, 100 μg/injection,
or 200 μg/injection where indicated) were purchased from
eBioscience and R&D Systems, respectively.
Purification of mononuclear cells
Mice were deeply anesthetized and perfused with 20 mL of PBS.
For purification of mononuclear cells, brains were collected in
PBS and dissociated using a glass Potter. Brain suspensions were
enzymatically digested for 1 h at 37°C in RPMI 1640 medium
(Invitrogen) containing collagenase D (1 mg/mL), and DNase
I (10 mg/mL). The digested suspensions were filtered (70 mm
cell strainer, Falcon), CNS-infiltrating mononuclear cells were collected after Percoll density separation and directly used for FACS
staining. For purification of mononuclear cells from spleen and
cervical draining lymph nodes, organs were collected in PBS and
dissociated using a glass Potter. After red blood cell lysis, mononuclear cells were used for FACS staining.
Ex vivo restimulation of HA-specific CD8 T cells
Mononuclear cells from spleen and cervical lymph nodes (4 ×
106 ) were plated in a 24-well plate for 6 h and restimulated
with 1 μM of HA peptide or of H-2Kd -binding noncognate antigen
www.eji-journal.eu
3309
3310
Guillaume Martin-Blondel et al.
(Cw3 peptide, RYLKNGKETL). GolgiPlugTM (BD Pharmingen) was
added for the last 2 h before mononuclear cells were used for FACS
staining.
FACS analysis
In vitro differentiated cytotoxic HA-specific CD8 T cells were
stained using a viability dye and anti-CD8α (53-6.7, BD Pharmingen), anti-α4-integrin (hybridoma supernatant, clone PS/2), antiβ7-integrin (hybridoma supernatant, clone FIB504), or anti-α4β7integrin heterodimer (hybridoma supernatant, clone DATK32).
Mononuclear cells were stained using a viability dye and antiCD45 (30-F11, BD Pharmingen), anti-CD45.1 (A20, Biolegend),
anti-CD45.2 (104, BD Pharmingen), anti-CD11b (M1/70, eBioscience), anti-Thy1.2 (53-2.1, eBioscience), anti-CD4 (RM4-5,
BD Pharmingen), anti-CD8 (53-6.7, BD Pharmingen), anti-MHC
class II (M5/114.15.2, eBioscience), anti-CD44 (IM7, Biolegend),
anti-CD62L (MEL-14, BD Pharmingen), and anti-CD25 (PC61,
BD Pharmingen) mAbs. After fixation and permeabilization, cells
were intracellularly stained for IFN-γ (XMG1.2, BD Biosciences)
and TNF-α (MP6-XT22, BD Pharmingen). Data were collected on
an LSRII or FACSCalibur (Becton Dickinson) and analyzed with
FlowJo software (Tree Star).
In vitro binding assay system
Wells of diagnostic microscope slides (ER-202W-CE24, Thermo
Scientific) were coated with protein A (20 μg/mL in PBS pH 9)
for 1 h at 37°C. After protein A incubation, wells were washed
three times with PBS (pH 7.4) and blocked with 1.5% BSA in PBS
for 30 min at 37°C. Subsequently, wells were washed once with
PBS (pH 7.4) and recombinant proteins (100 nM) were incubated
for 2 h at 37°C (recombinant DNER-Fc chimera, R&D 2254-DN;
recombinant mouse ICAM-1-Fc chimera R&D 796-IC; recombinant
VCAM-1-Fc chimera, R&D 643-VM). After recombinant proteincoating, wells were washed twice with PBS (pH 7.4) and blocked
with 1.5% BSA in PBS for 30 min at room temperature.
To perform the in vitro binding assay, HA-specific cytotoxic
CD8 T cells were collected at 5 × 106 cells/mL in assay medium
(DMEM, 25 mM HEPES, 5% calf serum, 2% L-glutamine) and
incubated with either the blocking antibody (PS/2, 10 μg/mL) or
the isotype control antibody (rat IgG2b, 10 μg/mL) for 20 min
at room temperature. Antibodies were washed away by centrifugation for 3 min at 1400 rpm. Diagnostic microscope slides were
placed on a rotating platform and 20 μL cell suspension (1 × 105
cells/well) was added and incubated on the recombinant proteins
for 30 min. Slides were washed twice with PBS and fixed in 2.5%
v/v glutaraldehyde in PBS.
The number of adherent cells was evaluated by counting bound
cells per field of view under the microscope using a grid ocular.
Immunofluorescence staining
Preparation of mouse tissue and staining procedures were performed as published previously [56]. Briefly, mice were perfused
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Immunol. 2015. 45: 3302–3312
with PBS or 1% formaldehyde in PBS through the left ventricle of
the heart. Dissected tissues were embedded in Tissue-Tek (Sakura,
the Netherlands), frozen, and stored at −80°C. For immunofluorescence staining of JAM-B, 6 μm cryostat sections were fixed
with ice-cold methanol for 20 s, followed by blocking with blocking buffer (2% BSA, 1% FCS, 1% donkey serum in PBS). Subsequently, primary rabbit anti-JAM-B antibody (αJB829 1:250;
kindly provided by Beat Imhof, Geneva, Switzerland) and either
rat antimouse PECAM-1 (Mec 13.3, 20 μg/mL) or rat antimouse
VCAM-1 (6C7.1, 10 μg/mL) were incubated with the sections
for 1 h. In between and after antibody incubation, sections were
washed with PBS. Sections were then incubated with secondary
antibodies goat antirat Alexa 488 (1:200, Invitrogen MP A11006)
and donkey antirabbit Cy3 (1:200, JIR 111-165-144) and DAPI
(0.5 μg/mL, Invitrogen D3571) for 1 h and coverslipped with
Mowiol (Sigma–Aldrich, USA). For immunofluorescence staining
of CD8, cryostat sections were fixed in ethanol for 10 min at
4°C, followed by acetone for 1 min at room temperature. Subsequently, sections were dried for 30 min at room temperature.
Blocking solution, skimmed milk (5% in TBS) was incubated for
20 min. Primary rat-antimouse CD8 antibody (Lyt 2, eBiosciences)
and secondary goat-antirat IgG-Cy3 antibody (eBiosciences) were
diluted in blocking solution. Antibody incubation was performed
for 1 h at room temperature. To visualize the cell nuclei, DAPI
(0.5 μg/mL, Invitrogen D3571) was incubated for 5 min at room
temperature. Sections were washed with TBS between incubation
steps and finally mounted with Mowiol (Sigma–Aldrich) and analyzed using a Nikon Eclipse 600 fluorescence microscope.
Statistical analysis
Differences between two sets of data were evaluated by a twotailed Mann–Whitney U test. For analysis of scatter plots comparing ࣙ3 groups of mice, one-way ANOVA with Bonferroni’s
posttest was used. Survival curves were plotted by the Kaplan–
Meier method and compared with the log-rank test. Data represent mean ± SEM. Probability values of p ࣘ 0.05 were considered
statistically significant. All tests were carried out using GraphPad
Prism 5 (GraphPad Software, La Jolla, CA, USA).
Acknowledgments: This work was supported by an international
ARSEP grant (to B.E. and R.L.), the Toulouse University Hospital,
the French National Institute for Medical Research (INSERM), the
French National Research Agency (ANR-13-BSV3-0003-01), and
European Union, FP7-PEOPLE-2012-ITN NeuroKine to R.L., and
the Swiss National Science Foundation (Grant No. 149420)
and the Swiss Multiple Sclerosis Society to B.E. S.T. has been supported by a fellowship from the German Research Foundation. We
thank Dr. Beat Imhof (Geneva, Switzerland) for kindly providing
the anti-JAM-B antibody.
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 3302–3312
Conflict of interest: The authors declare no financial or commercial conflict of interest.
Cellular immune response
promotes leukocyte trafficking into the central nervous system. Nat.
Immunol. 2008. 9: 137–145.
17 Ifergan, I., Kebir, H., Alvarez, J. I., Marceau, G., Bernard, M., Bourbonniere, L., Poirier, J. et al., Central nervous system recruitment of effector
References
1 Galea, I., Bechmann, I. and Perry, V. H., What is immune privilege (not)?
Trends Immunol. 2007. 28: 12–18.
2 Liblau, R. S., Gonzalez-Dunia, D., Wiendl, H. and Zipp, F., Neurons as
targets for T cells in the nervous system. Trends Neurosci. 2013. 36: 315–
324.
3 Wilson, E. H., Weninger, W. and Hunter, C. A., Trafficking of immune
cells in the central nervous system. J. Clin. Invest. 2010. 120: 1368–1379.
4 Engelhardt, B. and Ransohoff, R. M., Capture, crawl, cross: the T cell code
to breach the blood-brain barriers. Trends Immunol. 2012. 33: 579–589.
5 Bartholomaus, I., Kawakami, N., Odoardi, F., Schlager, C., Miljkovic, D.,
Ellwart, J. W., Klinkert, W. E. et al., Effector T cell interactions with
meningeal vascular structures in nascent autoimmune CNS lesions.
Nature 2009. 462: 94–98.
6 Bauer, M., Brakebusch, C., Coisne, C., Sixt, M., Wekerle, H., Engelhardt,
B. and Fassler, R., Beta1 integrins differentially control extravasation of
inflammatory cell subsets into the CNS during autoimmunity. Proc. Natl.
Acad. Sci. USA 2009. 106: 1920–1925.
7 Engelhardt, B., Laschinger, M., Schulz, M., Samulowitz, U., Vestweber, D. and Hoch, G., The development of experimental autoimmune encephalomyelitis in the mouse requires alpha4-integrin but not
alpha4beta7-integrin. J. Clin. Invest. 1998. 102: 2096–2105.
8 Vajkoczy, P., Laschinger, M. and Engelhardt, B., Alpha4-integrin-VCAM1 binding mediates G protein-independent capture of encephalitogenic
T cell blasts to CNS white matter microvessels. J. Clin. Invest. 2001. 108:
557–565.
9 Yednock, T. A., Cannon, C., Fritz, L. C., Sanchez-Madrid, F., Steinman, L.
and Karin, N., Prevention of experimental autoimmune encephalomyelitis by antibodies against alpha 4 beta 1 integrin. Nature 1992. 356: 63–66.
10 Rothhammer, V., Muschaweckh, A., Gasteiger, G., Petermann, F., Heink,
S., Busch, D. H., Heikenwalder, M. et al., Alpha4-integrins control viral
meningoencephalitis through differential recruitment of T helper cell
subsets. Acta Neuropathol. Commun. 2014. 2: 27.
11 Rothhammer, V., Heink, S., Petermann, F., Srivastava, R., Claussen, M. C.,
Hemmer, B. and Korn, T., Th17 lymphocytes traffic to the central nervous
system independently of alpha4 integrin expression during EAE. J. Exp.
Med. 2011. 208: 2465–2476.
12 Martin-Blondel, G., Delobel, P., Blancher, A., Massip, P., Marchou, B.,
Liblau, R. S. and Mars, L. T., Pathogenesis of the immune reconstitution
inflammatory syndrome affecting the central nervous system in patients
infected with HIV. Brain 2011. 134: 928–946.
13 Saxena, A., Martin-Blondel, G., Mars, L. T. and Liblau, R. S., Role of CD8
T cell subsets in the pathogenesis of multiple sclerosis. FEBS Lett. 2011.
585: 3758–3763.
14 Bien, C. G., Vincent, A., Barnett, M. H., Becker, A. J., Blumcke, I., Graus,
F., Jellinger, K. A. et al., Immunopathology of autoantibody-associated
encephalitides: clues for pathogenesis. Brain 2012. 135: 1622–1638.
15 Battistini, L., Piccio, L., Rossi, B., Bach, S., Galgani, S., Gasperini, C., Ottoboni, L. et al., CD8+ T cells from patients with acute multiple sclerosis
display selective increase of adhesiveness in brain venules: a critical role
for P-selectin glycoprotein ligand-1. Blood 2003. 101: 4775–4782.
16 Cayrol, R., Wosik, K., Berard, J. L., Dodelet-Devillers, A., Ifergan, I., Kebir,
H., Haqqani, A. S. et al., Activated leukocyte cell adhesion molecule
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
memory CD8+ T lymphocytes during neuroinflammation is dependent
on alpha4 integrin. Brain 2011. 134: 3560–3577.
18 Young, K. G., Maclean, S., Dudani, R., Krishnan, L. and Sad, S., CD8+
T cells primed in the periphery provide time-bound immune-surveillance
to the central nervous system. J. Immunol. 2011. 187: 1192–1200.
19 Scheikl, T., Pignolet, B., Dalard, C., Desbois, S., Raison, D., Yamazaki, M.,
Saoudi, A. et al., Cutting edge: neuronal recognition by CD8 T cells elicits
central diabetes insipidus. J. Immunol. 2012. 188: 4731–4735.
20 Elices, M. J., Osborn, L., Takada, Y., Crouse, C., Luhowskyj, S., Hemler,
M. E. and Lobb, R. R., VCAM-1 on activated endothelium interacts with
the leukocyte integrin VLA-4 at a site distinct from the VLA-4/fibronectin
binding site. Cell 1990. 60: 577–584.
21 Ludwig, R. J., Hardt, K., Hatting, M., Bistrian, R., Diehl, S., Radeke, H. H.,
Podda, M. et al., Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin.
Immunology 2009. 128: 196–205.
22 Luo, B. H., Carman, C. V. and Springer, T. A., Structural basis of integrin
regulation and signaling. Annu. Rev. Immunol. 2007. 25: 619–647.
23 Haanstra, K. G., Hofman, S. O., Lopes Estevao, D. M., Blezer, E. L., Bauer,
J., Yang, L. L., Wyant, T. et al., Antagonizing the alpha4beta1 integrin,
but not alpha4beta7, inhibits leukocytic infiltration of the central nervous
system in rhesus monkey experimental autoimmune encephalomyelitis.
J. Immunol. 2013. 190: 1961–1973.
24 Doring, A., Pfeiffer, F., Meier, M., Dehouck, B., Tauber, S., Deutsch, U.
and Engelhardt, B., TET inducible expression of the alpha4beta7-integrin
ligand MAdCAM-1 on the blood-brain barrier does not influence the
immunopathogenesis of experimental autoimmune encephalomyelitis.
Eur. J. Immunol. 2011. 41: 813–821.
25 Laschinger, M. and Engelhardt, B., Interaction of alpha4-integrin with
VCAM-1 is involved in adhesion of encephalitogenic T cell blasts to brain
endothelium but not in their transendothelial migration in vitro. J. Neuroimmunol. 2000. 102: 32–43.
26 Steiner, O., Coisne, C., Cecchelli, R., Boscacci, R., Deutsch, U., Engelhardt,
B. and Lyck, R., Differential roles for endothelial ICAM-1, ICAM-2, and
VCAM-1 in shear-resistant T cell arrest, polarization, and directed crawling on blood-brain barrier endothelium. J. Immunol. 2010. 185: 4846–4855.
27 Jilek, S., Mathias, A., Canales, M., Lysandropoulos, A., Pantaleo, G.,
Schluep, M. and Du Pasquier, R. A., Natalizumab treatment alters the
expression of T-cell trafficking marker LFA-1 alpha-chain (CD11a) in MS
patients. Mult. Scler. 2013 [Epub ahead of print].
28 Schwab, N., Schneider-Hohendorf, T., Posevitz, V., Breuer, J., Gobel, K.,
Windhagen, S., Brochet, B. et al., L-selectin is a possible biomarker for
individual PML risk in natalizumab-treated MS patients. Neurology 2013.
81: 865–871.
29 Berlin, C., Berg, E. L., Briskin, M. J., Andrew, D. P., Kilshaw, P. J., Holzmann, B., Weissman, I. L. et al., Alpha 4 beta 7 integrin mediates lymphocyte binding to the mucosal vascular addressin MAdCAM-1. Cell 1993.
74: 185–195.
30 Kamata, T., Puzon, W. and Takada, Y., Identification of putative ligandbinding sites of the integrin alpha 4 beta 1 (VLA-4, CD49d/CD29). Biochem.
J. 1995. 305: 945–951.
31 Man, S., Tucky, B., Bagheri, N., Li, X., Kochar, R. and Ransohoff, R. M.,
Alpha4 Integrin/FN-CS1 mediated leukocyte adhesion to brain microvascular endothelial cells under flow conditions. J. Neuroimmunol. 2009. 210:
92–99.
www.eji-journal.eu
3311
3312
Guillaume Martin-Blondel et al.
Eur. J. Immunol. 2015. 45: 3302–3312
32 van der Laan, L. J., van der Goes, A., Wauben, M. H., Ruuls, S. R.,
46 Gasnault, J., Kahraman, M., de Goer de Herve, M. G., Durali, D., Del-
Dopp, E. A., De Groot, C. J., Kuijpers, T. W. et al., Beneficial effect of
fraissy, J. F. and Taoufik, Y., Critical role of JC virus-specific CD4 T-cell
modified peptide inhibitor of alpha4 integrins on experimental allergic
responses in preventing progressive multifocal leukoencephalopathy.
encephalomyelitis in Lewis rats. J. Neurosci. Res. 2002. 67: 191–199.
AIDS 2003. 17: 1443–1449.
33 Cunningham, S. A., Rodriguez, J. M., Arrate, M. P., Tran, T. M. and Brock,
47 Du Pasquier, R. A., Schmitz, J. E., Jean-Jacques, J., Zheng, Y., Gordon,
T. A., JAM2 interacts with alpha4beta1. Facilitation by JAM3. J. Biol. Chem.
J., Khalili, K., Letvin, N. L. et al., Detection of JC virus-specific cytotoxic
2002. 277: 27589–27592.
T lymphocytes in healthy individuals. J. Virol. 2004. 78: 10206–10210.
34 Martin-Padura, I., Lostaglio, S., Schneemann, M., Williams, L., Romano,
48 Tan, I. L., McArthur, J. C., Clifford, D. B., Major, E. O. and Nath,
M., Fruscella, P., Panzeri, C. et al., Junctional adhesion molecule, a novel
A., Immune reconstitution inflammatory syndrome in natalizumab-
member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J. Cell Biol. 1998.
142: 117–127.
35 Del Maschio, A., De Luigi, A., Martin-Padura, I., Brockhaus, M., Bartfai, T.,
Fruscella, P., Adorini, L. et al., Leukocyte recruitment in the cerebrospinal
fluid of mice with experimental meningitis is inhibited by an antibody to
junctional adhesion molecule (JAM). J. Exp. Med. 1999. 190: 1351–1356.
36 Lechner, F., Sahrbacher, U., Suter, T., Frei, K., Brockhaus, M., Koedel, U.
and Fontana, A., Antibodies to the junctional adhesion molecule cause
disruption of endothelial cells and do not prevent leukocyte influx into
the meninges after viral or bacterial infection. J. Infect. Dis. 2000. 182:
978–982.
37 Aurrand-Lions, M., Johnson-Leger, C., Wong, C., Du Pasquier, L. and
Imhof, B. A., Heterogeneity of endothelial junctions is reflected by differential expression and specific subcellular localization of the three JAM
family members. Blood 2001. 98: 3699–3707.
38 Polman, C. H., O’Connor, P. W., Havrdova, E., Hutchinson, M., Kappos,
L., Miller, D. H., Phillips, J. T. et al., A randomized, placebo-controlled
trial of natalizumab for relapsing multiple sclerosis. N. Engl. J. Med. 2006.
354: 899–910.
39 Bloomgren, G., Richman, S., Hotermans, C., Subramanyam, M., Goelz, S.,
Natarajan, A., Lee, S. et al., Risk of natalizumab-associated progressive
multifocal leukoencephalopathy. N. Engl. J. Med. 2012. 366: 1870–1880.
40 Bonig, H., Wundes, A., Chang, K. H., Lucas, S. and Papayannopoulou, T.,
Increased numbers of circulating hematopoietic stem/progenitor cells
are chronically maintained in patients treated with the CD49d blocking
antibody natalizumab. Blood 2008. 111: 3439–3441.
41 del Pilar Martin, M., Cravens, P. D., Winger, R., Frohman, E. M., Racke, M.
K., Eagar, T. N., Zamvil, S. S. et al., Decrease in the numbers of dendritic
cells and CD4+ T cells in cerebral perivascular spaces due to natalizumab.
Arch. Neurol. 2008. 65: 1596–1603.
42 Perkins, M. R., Ryschkewitsch, C., Liebner, J. C., Monaco, M. C., Himelfarb, D., Ireland, S., Roque, A. et al., Changes in JC virus-specific
associated PML. Neurology 2011. 77: 1061–1067.
49 Aly, L., Yousef, S., Schippling, S., Jelcic, I., Breiden, P., Matschke, J.,
Schulz, R. et al., Central role of JC virus-specific CD4+ lymphocytes
in progressive multi-focal leucoencephalopathy-immune reconstitution
inflammatory syndrome. Brain 2011. 134: 2687–2702.
50 Metz, I., Radue, E. W., Oterino, A., Kumpfel, T., Wiendl, H., Schippling,
S., Kuhle, J. et al., Pathology of immune reconstitution inflammatory
syndrome in multiple sclerosis with natalizumab-associated progressive
multifocal leukoencephalopathy. Acta Neuropathol. 2012. 123: 235–245.
51 Martin-Blondel, G., Bauer, J., Cuvinciuc, V., Uro-Coste, E., Debard, A.,
Massip, P., Delisle, M. B. et al., In situ evidence of JC virus control by
CD8+ T cells in PML-IRIS during HIV infection. Neurology 2013. 81: 964–
970.
52 Morgan, D. J., Liblau, R., Scott, B., Fleck, S., McDevitt, H. O., Sarvetnick,
N., Lo, D. et al., CD8(+) T cell-mediated spontaneous diabetes in neonatal
mice. J. Immunol. 1996. 157: 978–983.
53 Casanova, E., Fehsenfeld, S., Mantamadiotis, T., Lemberger, T., Greiner,
E., Stewart, A. F. and Schutz, G., A CamKIIalpha iCre BAC allows brainspecific gene inactivation. Genesis 2001. 31: 37–42.
54 Saxena, A., Bauer, J., Scheikl, T., Zappulla, J., Audebert, M., Desbois, S.,
Waisman, A. et al., Cutting edge: multiple sclerosis-like lesions induced
by effector CD8 T cells recognizing a sequestered antigen on oligodendrocytes. J. Immunol. 2008. 181: 1617–1621.
55 Vizler, C., Bercovici, N., Heurtier, A., Pardigon, N., Goude, K., Bailly, K.,
Combadiere, C. et al., Relative diabetogenic properties of islet-specific
Tc1 and Tc2 cells in immunocompetent hosts. J. Immunol. 2000. 165: 6314–
6321.
56 Wyss, L., Schafer, J., Liebner, S., Mittelbronn, M., Deutsch, U., Enzmann,
G., Adams, R. H. et al., Junctional adhesion molecule (JAM)-C deficient
C57BL/6 mice develop a severe hydrocephalus. PLoS One 2012. 7: e45619.
Abbreviations: BBB: Blood-brain barrier · IRIS: Immune reconstitution
T cell responses during natalizumab treatment and in natalizumab-
inflammatory syndrome · JAM-B: Junctional adhesion molecule-B · PML:
associated progressive multifocal leukoencephalopathy. PLoS Pathog.
Progressive multifocal leukoencephalopathy
2012. 8: e1003014.
43 Warnke, C., Mausberg, A. K., Stettner, M., Dehmel, T., Nekrich, L., Meyer
zu Horste, G., Hartung, H. P. et al., Natalizumab affects the T-cell receptor
repertoire in patients with multiple sclerosis. Neurology 2013. 81: 1400–
1408.
44 Schneider-Hohendorf, T., Rossaint, J., Mohan, H., Boning, D., Breuer, J.,
Full correspondence: Dr. Roland Liblau, INSERM U1043 - CNRS UMR
5282, Centre de Physiopathologie de Toulouse Purpan (CPTP), Purpan
Hospital, Place du Docteur Baylac TSA 40031, 31059 Toulouse Cedex 9,
France
Fax: +33-561-77-21-38
e-mail: [email protected]
Kuhlmann, T., Gross, C. C. et al., VLA-4 blockade promotes differential
routes into human CNS involving PSGL-1 rolling of T cells and MCAMadhesion of TH17 cells. J. Exp. Med. 2014. 211: 1833–1846.
45 Stuve, O., Marra, C. M., Jerome, K. R., Cook, L., Cravens, P. D., Cepok, S.,
Frohman, E. M. et al., Immune surveillance in multiple sclerosis patients
treated with natalizumab. Ann. Neurol. 2006. 59: 743–747.
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Received: 5/3/2015
Revised: 21/8/2015
Accepted: 7/9/2015
Accepted article online: 31/8/2015
www.eji-journal.eu
#!"$
"%&
2712
Lidia Yshii et al.
DOI: 10.1002/eji.201545759
Eur. J. Immunol. 2015. 45: 2712–2720
ECI 2015 Review Series
Neurons and T cells: Understanding this interaction
for inflammatory neurological diseases
Lidia Yshii1,2,3 , Christina Gebauer1,2 , Raphaël Bernard-Valnet1,2
and Roland Liblau1,2
1
INSERM U1043 - CNRS UMR 5282, Centre de Physiopathologie Toulouse-Purpan, Toulouse,
France
2
Université Toulouse III, Toulouse, France
3
Institute of Biomedical Sciences I, University of Sao Paulo, Sao Paulo, Brazil
Central nervous system (CNS) inflammation occurs in a large number of neurological
diseases. The type and magnitude of CNS inflammation, as well as the T-cell contribution,
vary depending on the disease. Different animal models of neurological diseases have
shown that T cells play an important role in CNS inflammation. Furthermore, recent
studies of human neurological disorders have indicated a significant role for T cells in
disease pathology. Nevertheless, how individual T-cell subsets affect neuronal survival,
damage and/or loss remains largely unclear. In this review we discuss the processes
by which T cells mediate either beneficial or deleterious effects within the CNS, with
emphasis on the direct interaction between T cells and neurons, as occurs in multiple
sclerosis, paraneoplastic cerebellar degeneration, and viral encephalitis. The therapeutic
approaches targeting T cells and their mediators as treatment for neurological diseases
are also described here.
Keywords: Autoimmunity r Central nervous system
Neurons r T cells r Viral infection
r
Inflammation
Introduction
Due to its limited regenerative capacity, the central nervous
system (CNS) needs to protect itself against potentially damaging exuberant immune responses. This is achieved through
a singular state of reduced exposure to the immune system,
known as “immune privilege” (reviewed in [1, 2]). This “immune
privilege” occurs thanks to the blood–brain barrier (BBB), limited major histocompatibility complex (MHC) molecule expression in the brain, and neuronal expression of molecules with
immunosuppressive properties, such as TGF-β and CD200 [3]. All
these contribute to protect neurons and axons from microgliaand/or T-cell-induced damage although it is not as drastic as
previously thought. Activated immune cells can enter the CNS
Correspondence: Prof. Roland Liblau
e-mail: [email protected]
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
r
Neurodegeneration
r
through various routes under specific conditions through selective receptor–ligand interactions (reviewed in [4]). Recent studies have identified an unconventional lymphatic drainage system
from the CNS interstitial fluid and cerebrospinal fluid (CSF) to
the deep cervical lymph nodes [5, 6]. Whether immune cells
exit the CNS using these lymphatic vessels is currently under
investigation.
Inflammation occurs in a large number of neurological diseases with etiologies as diverse as ischemia, trauma, infection,
autoimmunity, or neurodegeneration [7, 8]. The type and magnitude of CNS inflammation, and the possible contribution of
T cells, vary largely depending on the considered disease. A pivotal role has been attributed to T cells in animal models of CNS
inflammation, and similar observations are emerging from the
study of human neurological disorders (reviewed in [7, 9]). Moreover, CNS-resident cells, including some neurons, constitutively
express MHC class I molecules [10, 11], challenging the classical
view that neurons might be excluded from cytotoxic T-cell (CTL)
www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 2712–2720
recognition [12]. In addition, MHC class I expression on neurons
and glial cells increases strikingly under pathological conditions
[13]. Importantly, recent data indicate that neurons can process
and present viral or exogenous antigens to CTLs, resulting in neuronal cell death [14, 15].
In this review, we discuss the processes by which T cells can
have either beneficial or deleterious effects within the CNS, with
a special emphasis on the direct interaction between T cells and
neurons. We also review the different therapeutical approaches
targeting T cells and their mediators for the treatment of neurological diseases.
T-cell migration into the CNS
T cells enter into the CNS through migration across the BBB, the
blood–leptomeningeal barrier, or the choroid plexus (reviewed in
[16]). Integrins, selectins, and chemokine receptors expressed on
T cells regulate this transmigration, and T-cell ligands are upregulated on CNS endothelial cells during neuroinflammation [16].
In particular, the interaction between α4β1-integrin, expressed by
activated T cells, and vascular cell adhesion protein 1 (VCAM1), expressed on blood vessels, has been shown to have a pivotal role for CD4+ and CD8+ T-cell migration into the CNS
[17–19]. Th17 cells, however, have been shown to adhere to
endothelial cells and extravasate into the CNS independently
of α4β1 [20], using either a melanoma cell adhesion molecule
(MCAM)- [21], or lymphocyte function-associated antigen 1 (LFA1)-dependent pathway [22]. Moreover, the chemokine receptor
CCR6 has been shown to control the migration of Th17 cells into
the CNS through the choroid plexus in a mouse model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE)
[23]. Additionally, CD4+ FoxP3+ T regulatory (Treg) cells depend
on LFA-1 to migrate into the CNS in the absence of α4-integrin
during EAE [24]. In humans, blocking CCR5 appears to limit the
traffic of CD8+ T cells into the CNS of patients suffering from
progressive multifocal leukoencephalopathy-associated immune
reconstitution inflammatory syndrome (PML-IRIS), which is an
unbalanced immune reaction to the JC virus responsible for PML
[25, 26]. Moreover, CCR5 deficiency in humans is a strong risk
factor for CNS infection by West Nile virus (WNV) [27], most likely
because CCR5-deficient cells limit the local migration of effector
T cells.
Collectively, these data suggest that different immune cell subsets use various molecular cues to penetrate the CNS. These specific pathways offer the possibility of blocking only the immune
cell type involved in a particular disease.
Neuronal protection against T-cell-mediated
inflammation
While T cells are considered destructive in many neurological disorders (see “Inflammatory and neurodegenerative diseases mediated by T cells”), they can also promote neuroprotection in the
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
HIGHLIGHTS
same experimental situations [28]. For instance, Th1 and Th2
CD4+ T cells have been shown to produce neurotrophins, which
are neurotrophic growth factors that contribute to the development, function, and survival of neurons [29]. The production of
the neurotrophin BDNF (brain-derived neurotrophic factor), in
particular, is enhanced upon antigen stimulation of T cells, which
in turn has been shown to support neuronal survival by inducing
axonal outgrowth and regeneration [30]. Additionally, both BDNF
and neurotrophin-3 were detected in activated T cells infiltrating
the CNS during EAE, suggesting that the damaging consequences
of T cells can be counteracted by neurotrophic factors produced
by T cells [28].
Importantly, the interactions between T cells and neurons are bidirectional. Neurons have evolved mechanisms to
directly protect the CNS from T-cell-mediated inflammation. For
example, neurons have been shown to promote T-cell apoptosis through Fas/FasL interactions [31] and produce antiinflammatory cytokines, such as TGF-β, which is associated with
resistance to EAE [32, 33]. Furthermore, a pro-inflammatory environment results in increased production of TGF-β and enhanced
surface expression of CD80/CD86 by neurons [32]. In turn,
TGF-β and CD80/CD86 maintain the antigen-independent CD4+
T-cell proliferation and promote the conversion of pathogenic
CD4+ T cells into TGFβ+ CTLA-4+ Treg cells, which then suppress
encephalitogenic T cells and inhibit EAE [32].
In addition, Treg cells counteract effector immune mechanisms
within tissues, preserving neuronal function. In particular, Treg
cells can control CNS inflammation in EAE [34, 35]. For instance,
Treg cells expressing the transcription factor FoxA1 (FoxA1+ Treg
cells) have been shown to enhance their own expression of programmed cell death ligand 1 (PD-L1) and kill pathogenic CD4+
T cells, thereby suppressing EAE in a FoxA1- and PD-L1-dependent
way [36]. There is also evidence that CD8+ CD122+ T cells produce IL-10, which inhibits proliferation of CTLs as well as their
IFN-γ production, resulting in suppression of EAE, especially in
the late phase [37].
In addition, after CNS injury, CD4+ T-cell infiltration occurs
independently of MHC class II expression. The CNS-invading
CD4+ T cells exhibit increased IL-4 output as compared with
that of their peripheral counterparts, as a result of MyD88 signaling triggered by damage-associated molecular pattern molecules
(DAMPs) [38]. The T-cell-derived IL-4 indirectly triggers neuroprotection and axon growth through activation of IL-4 receptors
on neurons, enhancing the neurotrophin signaling pathway [38].
In a model of acute spinal cord injury, both Th1 cells and Treg
cells have been shown to be required for recovery [39]. Likewise,
in amyotrophic lateral sclerosis (ALS) mouse model, Treg cells
are recruited to attenuate the cytotoxic activity of microglia and,
consequently, promote neuroprotection [40, 41].
Nevertheless, within the CNS, effector T cells mostly contribute to inflammation and neurodegeneration in both sterile and nonsterile situations [7]. We therefore concentrate
below on pathological conditions in which T cells promote neuronal/axonal damage and discuss the mechanisms involved and
www.eji-journal.eu
2713
2714
Lidia Yshii et al.
how to therapeutically interfere with disease-promoting T-cell
populations.
T-cell activities in the CNS during viral infections
The interaction between CD8+ T cells and neurons during viral
infections differs according to the virus involved.
Exposure to the neurotropic herpes simplex virus type 1 (HSV1) results in chronic infection of neurons in the trigeminal ganglia. During latency, no infectious viral particles are produced and
HSV-1 proteins are not detectable [42]. HSV-1-specific CTLs have
been shown to localize in close proximity to HSV-1-infected neuronal cell body in human trigeminal ganglia [43]. HSV-1-specific
CTL activation or retention involves CD4+ T cells, as well as local
APCs [44]. CD8+ T cells have been shown to use at least two
noncytolytic mechanisms to maintain HSV-1 latency [45]. First,
granzyme B delivered by HSV-1-specific CD8+ T cells to infected
neurons can directly cleave ICP4, a viral protein required for efficient transcription of early and late viral genes, without impairing
neuronal survival in vitro [45]. Second, IFN-γ secretion by HSV1-specific CTLs has been implicated in inhibiting the expression
of HSV-1 gene products required for viral reactivation [45]. Thus,
Granzyme B and IFN-γ are essential to control the reactivation of
HSV-1 from latency.
In contrast to the noncytolytic mechanisms employed by CTLs
in response to HSV-1 infection, mouse models for WNV infection
have revealed that CD8+ T cells are required to clear the virus
from infected neurons in an MHC class I-dependent manner [46].
Mice lacking MHC I molecules have an increased and sustained
WNV infection in both peripheral and CNS tissues [46]. Indeed,
CD8+ T cells have been shown to directly kill infected neurons
through both the perforin and Fas/FasL ligand pathways to eliminate WNV from the CNS [47]. Additionally, CD8+ T cells produce
TNF-related apoptosis-inducing ligand (TRAIL) to restrict WNV
infection of CNS neurons [48]. Furthermore, upon WNV infection,
production of CXCL10 by neurons is induced by IFN-γ, thereby promoting the recruitment of CXCR3-expressing CD8+ T cells into the
CNS [49]. However, CXCL10 expression can vary between neuronal subsets: cerebellar granule neurons present higher expression of CXCL10 in comparison to cortical neurons, indicating a
differential regulation of inflammatory responses according to the
neuron subtypes [49].
The neurotropic Borna disease virus (BDV) is another example in which CD8+ T cells clear the virus through direct killing
of infected neurons. Interestingly, BDV triggers up-regulation of
MHC class I on primary murine neurons, thereby allowing cognate interaction between these neurons and virus-specific CTLs
[15]. This leads to morphological and functional alterations of the
infected neurons, preceding their subsequent apoptosis [15].
In the viral déjà vu model (antiviral CTLs targeting an epitope
shared by the initial virus persisting in neurons and the secondary
virus) in mice infected with a lymphocytic choriomeningitis virus
(LCMV) variant, an original non-neurotoxic phenomenon results
from the CTL attack on neurons in vivo [50]. Indeed, infection
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Immunol. 2015. 45: 2712–2720
with this variant results in a rapid loss of dendrites and synapses,
induced by the release of IFN-γ by CTLs in close contact with neurons, and subsequent IFN-γ receptor signaling in neurons, independent of Fas/FasL or perforin involvement [50]. Of note, in CNS
lesions of Rasmussen encephalitis patients, a similar phosphorylation of STAT1 observed in the murine déjà vu model is often
found within neurons in close contact with CD8+ T cells [50].
IFN-γ produced by CD8+ T cells may promote neurotoxicity
through additional mechanisms. For example, the IFN-γ receptor
can form a complex with the AMPA receptor subunit GluR1 in
neurons, increasing the excitability and vulnerability to glutamate
excitotoxicity [51]. In addition, IFN-γ signaling in neurons has
been shown to reduce the synaptic conduction below a critical
threshold and enhances the expression of MHC class I molecules
on neurons [51]. These effects may render neurons more susceptible to CD8+ T cell-mediated cytolysis during the course of
inflammatory diseases.
Thus, the collective effect of TRAIL, FasL, and perforin, and the
increased expression of MHC class I molecules, underlies some
of the molecular tools by which effector CD8+ T cells directly
interact with and kill infected neurons to contain viral infection
[47, 48]. Moreover, production of CXCL10 by neurons further
attracts effector CD8+ T cells at sites of viral infection. However,
the molecular tools used by T cells to control the viral infection
of CNS neurons seems to be dependent on the virus involved and
may even differ according to the infected neuronal subset.
Inflammatory and neurodegenerative diseases
mediated by T cells
The potential implication of T cells, and particularly CD8+
T cells, in CNS autoimmune diseases is receiving increasing attention [7, 8, 52, 53]. Indeed, the list of human neurological diseases in which T cells have been suggested to target neurons or
axons, directly or indirectly, is continuously growing (see Table
1). We describe below three selected diseases in which T cells
target neurons through different mechanisms. In multiple sclerosis (MS) and paraneoplastic cerebellar degeneration (PCD) the
adaptive immune system is a key mediator of CNS tissue damage whereas Parkinson’s disease (PD), a primary neurodegenerative disease with secondary inflammation, is mostly mediated
by innate immune cells [8]. In MS, axonal transection and neuronal loss have been shown to develop in the context of a complex
T-cell-mediated chronic inflammation [54]. Contrary to this, in
PCD, a rare autoimmune disease associated with gynecologic cancers, there is evidence suggesting that the selective loss of Purkinje
neurons likely results from direct interaction between CTLs and
Purkinje neurons [55]. Finally, recent data highlight the possible
contribution of T cells in PDs [14].
Multiple sclerosis and EAE, its popular animal model
MS is very likely an autoimmune disease of the CNS which
leads to multifocal demyelination and neurodegeneration [9]. MS
www.eji-journal.eu
HIGHLIGHTS
Eur. J. Immunol. 2015. 45: 2712–2720
Table 1. Human neurological diseases involving targeting of CNS neurons by infiltrating T cells
Disease
Infectious diseases
HTLV-1 associated myelopathy/tropical spastic
paraparesis (HAM/TSP)a)
JC virus PML-IRISb)
Viral encephalitisc)
Acute/subacute postviral encephalitisd)
Toxoplasmic encephalitise)
(Plausible) Autoimmune diseases
Narcolepsyf)
Anti-Hu syndromeg)
Encephalitis associated with anti-Ma1/2
antibody
Stiff-person syndromeh)
Paraneoplastic cerebellar degenerationi)
Idiopathic central diabetes insipidus j)
Multiple sclerosisk, l)
Febrile infection-related epilepsy syndrome
(FIRES)m)
Other diseases
Parkinson’s diseasen)
Rasmussen’s diseaseo)
CLIPPERSp)
Hemophagocytic lymphohistiocytosisq)
CTLA-4 haploinsufficiencyr)
Targeted neurons
Pathogenic T-cell population(s)
Axonal loss in spinal cord
Cytotoxic CD8+ T cells
Cerebellar granule cells; cortical neurons
Infected neurons
Neurons
Infected neurons
CD8+ T cells/CD4+ T cells
Mostly CD8+ T cells
CD8+ and CD4+ T cells
CD8+ T cells
Hypothalamic Orexin neurons
Most neurons
Diencephalic neurons
CD8+ T cells/CD4+ T cells
CD8+ T cells
CD8+ T cells
GABAergic neurons
Purkinje neurons
Neurohypophysis AVP neurons
Most axons/neurons
Temporal neurons and basal ganglia
CD8+ T cells
CD8+ T cells
CD8+ T cells
Th17; CD8+ T cells
T cells
Substantia nigra dopaminergic neurons
Cortical neurons
Brainstem and cerebellum
Gray and white matter
Gray and white matter
CD4+ T cells
CD8+ T cells
CD4+ > CD8+ T cells
CD8+ T cells (and NK cells)
Unknown
a)
Matsuura et al., J. Neuropathol. Exp. Neurol. (2015) 74:2
Schippling et al., Ann. Neurol. (2013) 74:622
c)
Phares et al., J Virol (2012) 86:2416
d)
Gogate et al., J Neuropathol Exp Neurol (1996) 55:435
e)
Blanchard et al., Parasite Immunol (2015) 37:150
f)
Liblau et al., Lancet Neurol (2015) 14:318
g)
Pignolet et al., Oncoimmunology (2013) 2:e27384
h)
Poh et al., J Neurol Sci (2014) 337:235
i)
Albert et al., Nat Med (1998) 4:1321
j)
Scheikl et al., J Immunol (2012) 188:4731
k)
Aktas et al., Neuron (2005) 46:421
l)
Huseby et al., J Exp Med (2001) 194:669
m)
Rebillard et al., Lancet Neurology Autoimmune Disorders Conference (2015) personal communication
n)
Brochard et al., J Clin Invest (2009) 119:182
o)
Varadkar et al., Lancet Neurol (2014) 13:195
p)
Simon et al., J Neurol Neurosurg Psychiatry (2012) 83:15
q)
Deiva et al., Neurology (2012) 78:1150
r)
Kuehn et al., Science (2014) 345:1623.
b)
development involves both genetic [56] and environmental factors [57]. Extensive axonal/neuronal damage is observed in MS
pathology, with transected axons and reduced neuronal density
resulting in brain and spinal cord atrophy [54, 58]. These findings
are associated with focal infiltration by macrophages and T cells,
which form demyelinated plaques within the white matter and in
the cortex. These infiltrating immune cells secrete proinflammatory cytokines, chemokines and reactive oxygen species that affect
the neurons, due to chronic inflammation and oxidative stress, as
well as mitochondrial and ion channel dysfunction, culminating
in neuronal death [9].
Extensive studies in EAE mice and MS patients have suggested
a key role for several T-cell subsets in MS pathogenesis, but their
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
contribution to the disease is still under investigation. While the
initial animal models of EAE emphasized the role of CD4+ T cells
[59], Lucchinetti et al. [60] demonstrated that CD8+ T-cell infiltration is present in more than 70% of human MS cortical plaque
biopsies. Moreover, CD8+ T cells have been shown to be far more
numerous than CD4+ T cells in active parenchymal MS lesions
[61]. Notably, higher levels of IL-17A have been detected in the
cerebrospinal fluid (CSF) of MS patients compared with that from
healthy subjects, and a large proportion (approx. 80%) of CNSinfiltrating T cells express IL-17 in active MS lesions [62, 63]. In
the classical EAE model, MOG-specific Th17 cells have been shown
to form direct physical contacts with neurons and their processes
within demyelinating lesions [64]. These contacts were shown to
www.eji-journal.eu
2715
2716
Lidia Yshii et al.
be LFA-1-dependent, but antigen- and MHC class II-independent
[64]. Nevertheless, Th17 cells induced a marked, localized and
partially reversible raise in Ca2+ concentration within axons that
could lead to axon transection and neuronal soma degeneration
[64], while Th1 cells were much less efficient at killing neurons
through this mechanism [65]. In contrast, encephalitogenic CD4+
T cells have been shown to contribute to neuronal damage by
releasing TRAIL and activate caspase 3 in neurons [65].
Increasing evidence indicates that CD8+ T cells contribute to
MS pathogenesis, and animal models in which CD8+ T cells are the
main effectors of disease have been developed [66]. For instance,
myelin basic protein (MBP)-specific CD8+ T cells have been shown
to cause severe CNS autoimmune disease in mice [67]. The MBPspecific CTLs induce demyelination and neuronal apoptosis, in an
IFN-γ-dependent fashion, leading to motor function impairment
[67]. In a humanized mouse model of EAE, it was demonstrated
that MHC class I alleles and CD8+ T cells are directly implicated.
In fact, MHC class I-restricted CD8+ T cells efficiently initiated
the first attack [68]. Furthermore, T-cell infiltrates were located
predominantly in the spinal cord and cerebellum, with signs of
demyelination and neuronal degeneration [68].
Collectively, these mouse models highlight the potential for
auto reactive CD4+ and CD8+ T cells to contribute directly or indirectly to axonal or neuronal damage. The advances in two-photon
in vivo imaging techniques, which allow real-time intravital monitoring of T-cell dynamics and function, will undoubtedly further
our understanding of the underlying mechanisms [69].
Paraneoplastic cerebellar degeneration
PCD is a rare and severe neurological disease, caused by the selective loss of Purkinje neurons in the cerebellum. PCD develops
mainly in patients with breast or ovarian carcinomas [53, 70].
An autoimmune response targeting a cytoplasmic protein (named
cdr2) expressed in both tumor cells and Purkinje neurons [55] is
thought to ultimately lead to neuroinflammation [71]. However,
the presence of cdr2-expressing tumor cells is not sufficient to
induce PCD. Actually, 60% of ovarian tumors and 25% of breast
tumors express cdr2 in the absence of PCD [70].
The immunopathogenesis of PCD is not fully clarified. Although
patients are diagnosed based on high titers of anti-cdr2 autoantibodies, the direct pathogenic contribution of anti-cdr2 autoantibodies is very unlikely, given the intracellular location of the target auto-antigen [72]. However, a recent report of a study using
cerebellar organotypic slice culture demonstrated that anti-cdr2
antibody internalization caused deregulation of Ca2+ homeostasis, leading to morphological changes of Purkinje cells and alterations in the cell signaling pathways, resulting in neurodegeneration [73]. According to one possible scenario, dendritic cells that
have phagocytosed apoptotic tumor cells would activate tumorspecific CD4+ and CD8+ T cells in local lymph nodes [72]. As a
possible result, most tumors detected in PCD patients have limited
disease spread [74]. However, cdr2-specific CTLs would migrate
to the CNS and target Purkinje neurons [55]. Indeed, CD8+ T cells
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Immunol. 2015. 45: 2712–2720
are found in the cerebellum of patients with PCD [75]. Moreover,
granzyme B-containing CD8+ T cells are observed close to the
Purkinje neurons [75], which can express MHC class-I molecules
[10].
Although cdr2-specific CTLs were found in the blood and CSF
of PCD patients [55, 76], there is no evidence that they cause
cerebellar pathology. This is in part due to the lack of appropriate
animal models of PCD.
Parkinson’s disease
PD, the most prevalent movement disorder, is caused by the selective degeneration of dopaminergic neurons in the substantia nigra
(SN), which are located in the midbrain. CD4+ and CD8+ T cells
have been detected within the SN in postmortem specimens from
PD patients [77]. The same observation was made in the mouse
model of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)induced dopaminergic neuronal death [77]. Further investigation
indicated that CD4+ T cells contribute to the neuronal loss induced
by MPTP, through activation of the Fas/FasL pathway [77]. Moreover, MHC class I was detected in dopaminergic neurons of the SN
in both healthy control and PD postmortem tissues [14]. The same
study showed that human stem cell-derived dopaminergic neurons
can display MHC class I upon IFN-γ treatment [14]. High exposure
to the dopamine precursor, L-DOPA, has been shown to induce
MHC class I expression on murine dopaminergic neurons, prior
to their subsequent destruction by CTLs [14]. Both studies concur
to suggest that T cells contribute to the neuronal loss observed in
PD [14, 77]. However, the precise T-cell subset at play remains to
be firmly determined. Furthermore, other immune cells, such as
activated microglia and astrocytes are believed to cause neuronal
death in a nonantigen-specific way [78]. This neuroinflammation
in PD could well participate to dopaminergic neuronal demise.
However, although actively studied, therapeutic immunomodulation has not yet been proved successful in PD.
Therapeutic implications of understanding the
consequences of neuron/T-cell interaction
In experimental models such as EAE, the range of possibilities to
therapeutically target pathogenic T cells is remarkable. Translation to humans may take 15 years or more and, unfortunately, it
has not been consistently correlated with success.
The use of T-cell depletion strategies has been revived thanks
to the approval for, and strong beneficial effect of, Alemtuzumab
in active MS [79, 80]. Alemtuzumab, a humanized anti-CD52
mAb, induces long-lasting (2–3 years) CD8+ and CD4+ T-cell
depletion [81]. In view of the data described above, it is noteworthy that the progressive T-cell reconstitution after cycles of
Alemtuzumab injection favors cells with a regulatory phenotype
(CD25+ FOXP3+ CD127low ), as well as CD4+ and CD8+ T cells producing IL-10 and TGF-β [82]. A transient increase in circulating
IL-4+ T cells has also been noted [82]. During the reconstitution
www.eji-journal.eu
HIGHLIGHTS
Eur. J. Immunol. 2015. 45: 2712–2720
phase, T cells also produce high levels of neurotrophic factors,
such as BDNF, CNTF, and PDGF, which favor survival and differentiation of neurons and oligodendrocytes in vitro [83]. Whether
these reconstituted T cells can penetrate the CNS and exert neuroprotective functions, however, remains uncertain.
Due to the lack of appropriate techniques, the selective elimination of functional T-cell subsets such as Th1, Th17, effector or
memory cytotoxic CD8+ T cells has not been clinically tested.
Daclizumab, a humanized anti-CD25 mAb inhibiting signaling
through the high-affinity IL-2R, was initially investigated in MS to
blunt activated pathogenic CD25+ T cells [84, 85]. Unexpectedly,
Daclizumab treatment led to only a marginal reduction in conventional CD4+ and CD8+ T-cell numbers and function, but elicited
regulatory mechanisms involving CD56bright NK cells [84, 86].
Blocking the migration of T cells (as well as other leukocytes)
from the blood to the CNS using anti-integrin monoclonal antibodies or a structural analog of sphingosine has proven highly successful [87, 88]. Indeed, the use of anti-α4 integrin mAb, which inhibits
VLA/VCAM1 interaction, or functional antagonists of sphingosine1-phosphate (S1P) receptors, which prevent lymphocyte exit from
secondary lymphoid organs into the blood, have produced remarkable therapeutic advances for people with MS [87, 88]. It is reasonable to predict that other CNS inflammatory diseases could
benefit from this therapeutic approach. However, the weak selectivity of this approach remains a major downside, putting, inter
alia, the CNS at risk of opportunistic infections. More selective
strategies, which interfere with given T-cell subsets, such as Th17
or cytotoxic CD8+ T cells, will rely on the growing knowledge on
the molecular cues governing their transmigration into the CNS.
This idea is nevertheless dependent upon two key parameters:
(i) the identification of selective/preferential pathways for given
T-cell subsets; and (ii) the absence of molecular redundancy for
their penetration into the CNS. The inhibition of effector T-cell
entry to the CNS by the CCR5 antagonist, maraviroc, in patients
with PML-IRIS may be a first encouraging example of a strategy
that addresses both parameters [25, 26].
Selective inhibition of given immune molecules has been a
major therapeutic revolution. The use of monoclonal antibodies targeting soluble T-cell mediators, in particular cytokines, or
their receptors is a novel therapeutical approach for patients with
CNS inflammatory diseases. mAbs neutralizing IL-17A or GM-CSF
have been tested in small trials with MS patients with suggestive efficacy [89, 90]. Blocking IFN-γ in MS, as well as in other
neurological diseases (Table 1) could be another therapeutical
approach. Indeed, IFN-γ is strongly expressed in active MS lesions
and intravenous injection of recombinant IFN-γ has been shown to
increase MS exacerbation rate [91]. Moreover, the administration
of neutralizing anti-IFN-γ mAb could be used to treat patients with
hemophagocytic lymphohistiocytosis [92]. However, the severe
opportunistic infections that have been shown to develop mostly
in Asian patients who had been treated with autoantibodies neutralizing IFN-γ raise serious concerns for the prolonged use of
this strategy [93]. The inhibition of key effector molecules within
T cells, such as Granzyme B and IL-17, represents exciting novel
strategies for future development. Pharmacologic inhibitors of
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
master transcription factors involved in T-cell differentiation are
being developed. For instance, siRNAs target precise molecules
within cells, but their efficient delivery to the desired cell population in vivo remains a challenge [94]. The use of ‘smart ligands’,
such as aptamers targeting a specific surface receptor linked to
siRNA, may help solve this challenge [95].
The ideal goal in the treatment of CNS autoimmune diseases would be to precisely neutralize the pathogenic autoreactive
T cells, instead of deleting large proportions of T cells or targeting
molecules needed for a protective immune response. Spectacular
results in preclinical animal models of MS with antigen-specific tolerance protocols have been presented [96], supporting this therapeutic approach. However, this has not yet met clinical expectations, possibly due to the ill-defined nature of both the target
autoantigens and the pathogenic lymphocyte subsets. Nevertheless, innovative antigen-specific strategies, such as myelin peptide
coupled to cells or nanobeads are being followed in MS [97, 98].
Conclusion
In this review, we have focused on the interactions between
T cells and neurons and their consequences in CNS disease. In
recent years, the role of T cells in tissue damage (and repair)
has been increasingly investigated, given the possible therapeutic implications. Nevertheless, the molecular mechanisms through
which each T-cell subset mediates neuronal loss or survival remain
largely unclear.
Until now, T-cell-associated CNS diseases, such as MS, are
gradually responsive to drugs blocking T-cell entry into the CNS.
However, more precise therapeutic approaches blocking specific
T-cell functions in the CNS are still needed. The emerging knowledge on the genetic bases of CNS inflammatory diseases will, in
all likelihood, help design more specific therapies.
Acknowledegment: This work was supported by FAPESP
2013/22196-4 (LY), by INSERM, CNRS, Toulouse III University
(RL), and grants from ARSEP, ANR T cell-CNS and the European
Union, FP7-PEOPLE-2012-ITN NeuroKine (RL).
Conflict of interest: The authors declare no financial or commercial conflict of interest.
References
1 Bechmann, I., Galea, I. and Perry, V. H., What is the blood-brain barrier
(not)? Trends Immunol. 2007. 28: 5–11.
2 Billingham, R. E. and Boswell, T., Studies on the problem of corneal
homografts. Proc. R Soc. Lond. B Biol. Sci. 1953. 141: 392–406.
www.eji-journal.eu
2717
2718
Lidia Yshii et al.
3 Chitnis, T., Imitola, J., Wang, Y., Elyaman, W., Chawla, P., Sharuk,
M., Raddassi, K. et al., Elevated neuronal expression of CD200 protects Wlds mice from inflammation-mediated neurodegeneration. Am.
J. Pathol. 2007. 170: 1695–1712.
4 Ransohoff, R. M. and Engelhardt, B., The anatomical and cellular basis of
immune surveillance in the central nervous system. Nat. Rev. Immunol.
2012. 12: 623–635.
Eur. J. Immunol. 2015. 45: 2712–2720
routes into human CNS involving PSGL-1 rolling of T cells and MCAMadhesion of TH17 cells. J. Exp. Med. 2014. 211: 1833–1846.
22 Rothhammer, V., Heink, S., Petermann, F., Srivastava, R., Claussen, M. C.,
Hemmer, B. and Korn, T., Th17 lymphocytes traffic to the central nervous
system independently of alpha4 integrin expression during EAE. J. Exp.
Med. 2011. 208: 2465–2476.
23 Reboldi, A., Coisne, C., Baumjohann, D., Benvenuto, F., Bottinelli, D.,
5 Louveau, A., Smirnov, I., Keyes, T. J., Eccles, J. D., Rouhani, S. J., Peske,
Lira, S., Uccelli, A. et al., C-C chemokine receptor 6-regulated entry of
J. D., Derecki, N. C. et al., Structural and functional features of central
TH-17 cells into the CNS through the choroid plexus is required for the
nervous system lymphatic vessels. Nature 2015. 523: 337–341.
initiation of EAE. Nat. Immunol. 2009. 10: 514–523.
6 Aspelund, A., Antila, S., Proulx, S. T., Karlsen, T. V., Karaman, S., Det-
24 Glatigny, S., Duhen, R., Arbelaez, C., Kumari, S. and Bettelli, E., Integrin
mar, M., Wiig, H. et al., A dural lymphatic vascular system that drains
alpha L controls the homing of regulatory T cells during CNS autoimmu-
brain interstitial fluid and macromolecules. J. Exp. Med. 2015. 212: 991–
nity in the absence of integrin alpha 4. Sci. Rep. 2015. 5: 7834.
999.
25 Martin-Blondel, G., Bauer, J., Uro-Coste, E., Biotti, D., Averseng-
7 Liblau, R. S., Gonzalez-Dunia, D., Wiendl, H. and Zipp, F., Neurons as
Peaureaux, D., Fabre, N., Dumas, H. et al., Therapeutic use of CCR5 antag-
targets for T cells in the nervous system. Trends Neurosci. 2013. 36: 315–
onists is supported by strong expression of CCR5 on CD8(+) T cells in
324.
progressive multifocal leukoencephalopathy-associated immune recon-
8 Waisman, A., Liblau, R. S. and Becher, B., Innate and adaptive immune
responses in the CNS. Lancet Neurol. 2015. 14: 945–955.
9 Mahad, D. H., Trapp, B. D. and Lassmann, H., Pathological mechanisms
in progressive multiple sclerosis. Lancet Neurol. 2015. 14: 183–193.
10 McConnell, M. J., Huang, Y. H., Datwani, A. and Shatz, C. J., H2-K(b)
and H2-D(b) regulate cerebellar long-term depression and limit motor
learning. Proc. Natl. Acad. Sci. USA 2009. 106: 6784–6789.
11 Needleman, L. A., Liu, X. B., El-Sabeawy, F., Jones, E. G. and McAllister,
A. K., MHC class I molecules are present both pre- and postsynaptically
in the visual cortex during postnatal development and in adulthood. Proc.
Natl. Acad. Sci. USA 2010. 107: 16999–17004.
12 Joly, E. and Oldstone, M. B., Neuronal cells are deficient in loading peptides onto MHC class I molecules. Neuron 1992. 8: 1185–1190.
stitution inflammatory syndrome. Acta Neuropathol. 2015. 129: 463–465.
26 Giacomini, P. S., Rozenberg, A., Metz, I., Araujo, D., Arbour, N., Bar-Or, A.
and Maraviroc in Multiple Sclerosis-Associated, P. M. L. I. G., Maraviroc
and JC virus-associated immune reconstitution inflammatory syndrome.
N. Engl. J. Med. 2014. 370: 486–488.
27 Glass, W. G., McDermott, D. H., Lim, J. K., Lekhong, S., Yu, S. F., Frank,
W. A., Pape, J. et al., CCR5 deficiency increases risk of symptomatic West
Nile virus infection. J. Exp. Med. 2006. 203: 35–40.
28 Hammarberg, H., Lidman, O., Lundberg, C., Eltayeb, S. Y., Gielen,
A. W., Muhallab, S., Svenningsson, A. et al., Neuroprotection by
encephalomyelitis: rescue of mechanically injured neurons and neurotrophin production by CNS-infiltrating T and natural killer cells. J. Neurosci. 2000. 20: 5283–5291.
29 Fargali, S., Sadahiro, M., Jiang, C., Frick, A. L., Indall, T., Cogliani, V.,
13 Hoftberger, R., Aboul-Enein, F., Brueck, W., Lucchinetti, C., Rodriguez,
Welagen, J. et al., Role of neurotrophins in the development and function
M., Schmidbauer, M., Jellinger, K. et al., Expression of major histocom-
of neural circuits that regulate energy homeostasis. J. Mol. Neurosci. 2012.
patibility complex class I molecules on the different cell types in multiple
sclerosis lesions. Brain Pathol. 2004. 14: 43–50.
48: 654–659.
30 Kerschensteiner, M., Gallmeier, E., Behrens, L., Leal, V. V., Misgeld, T.,
14 Cebrian, C., Zucca, F. A., Mauri, P., Steinbeck, J. A., Studer, L., Scherzer, C.
Klinkert, W. E., Kolbeck, R. et al., Activated human T cells, B cells, and
R., Kanter, E. et al., MHC-I expression renders catecholaminergic neurons
monocytes produce brain-derived neurotrophic factor in vitro and in
susceptible to T-cell-mediated degeneration. Nat. Commun. 2014. 5: 3633.
inflammatory brain lesions: a neuroprotective role of inflammation? J.
15 Chevalier, G., Suberbielle, E., Monnet, C., Duplan, V., Martin-Blondel, G.,
Exp. Med. 1999. 189: 865–870.
Farrugia, F., Le Masson, G., Liblau, R. et al., Neurons are MHC class I-
31 Flugel, A., Schwaiger, F. W., Neumann, H., Medana, I., Willem, M., Wek-
dependent targets for CD8 T cells upon neurotropic viral infection. PLoS
erle, H., Kreutzberg, G. W. et al., Neuronal FasL induces cell death of
Pathog. 2011. 7: e1002393.
16 Engelhardt, B. and Ransohoff, R. M., Capture, crawl, cross: the T cell code
to breach the blood-brain barriers. Trends Immunol. 2012. 33: 579–589.
17 Yednock, T. A., Cannon, C., Fritz, L. C., Sanchez-Madrid, F., Steinman, L.
and Karin, N., Prevention of experimental autoimmune encephalomyeli-
encephalitogenic T lymphocytes. Brain Pathol. 2000. 10: 353–364.
32 Liu, Y., Teige, I., Birnir, B. and Issazadeh-Navikas, S., Neuron-mediated
generation of regulatory T cells from encephalitogenic T cells suppresses
EAE. Nat. Med. 2006. 12: 518–525.
33 Cautain, B., Damoiseaux, J., Bernard, I., van Straaten, H., van Breda
tis by antibodies against alpha 4 beta 1 integrin. Nature 1992. 356: 63–66.
Vriesman, P., Boneu, B., Druet, P. et al., Essential role of TGF-beta in
18 Young, K. G., Maclean, S., Dudani, R., Krishnan, L. and Sad, S., CD8+
the natural resistance to experimental allergic encephalomyelitis in rats.
T cells primed in the periphery provide time-bound immune-surveillance
to the central nervous system. J. Immunol. 2011. 187: 1192–1200.
19 Ifergan, I., Kebir, H., Alvarez, J. I., Marceau, G., Bernard, M., Bourbon-
Eur. J. Immunol. 2001. 31: 1132–1140.
34 McGeachy, M. J., Stephens, L. A. and Anderton, S. M., Natural recovery and protection from autoimmune encephalomyelitis: contribution
niere, L., Poirier, J. et al., Central nervous system recruitment of effector
of CD4+CD25+ regulatory cells within the central nervous system. J.
memory CD8+ T lymphocytes during neuroinflammation is dependent
Immunol. 2005. 175: 3025–3032.
on alpha4 integrin. Brain 2011. 134: 3560–3577.
35 Korn, T., Reddy, J., Gao, W., Bettelli, E., Awasthi, A., Petersen, T. R.,
20 Glatigny, S., Duhen, R., Oukka, M. and Bettelli, E., Cutting edge: loss of
Backstrom, B. T. et al., Myelin-specific regulatory T cells accumulate in
alpha4 integrin expression differentially affects the homing of Th1 and
the CNS but fail to control autoimmune inflammation. Nat. Med. 2007.
Th17 cells. J. Immunol. 2011. 187: 6176–6179.
13: 423–431.
21 Schneider-Hohendorf, T., Rossaint, J., Mohan, H., Boning, D., Breuer, J.,
36 Liu, Y., Carlsson, R., Comabella, M., Wang, J., Kosicki, M., Carrion, B.,
Kuhlmann, T., Gross, C. C. et al., VLA-4 blockade promotes differential
Hasan, M. et al., FoxA1 directs the lineage and immunosuppressive
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eji-journal.eu
HIGHLIGHTS
Eur. J. Immunol. 2015. 45: 2712–2720
properties of a novel regulatory T cell population in EAE and MS. Nat.
Med. 2014. 20: 272–282.
37 Lee, Y. H., Ishida, Y., Rifa’i, M., Shi, Z., Isobe, K. and Suzuki, H., Essential
role of CD8+CD122+ regulatory T cells in the recovery from experimental
autoimmune encephalomyelitis. J. Immunol. 2008. 180: 825–832.
38 Walsh, J. T., Hendrix, S., Boato, F., Smirnov, I., Zheng, J., Lukens, J. R.,
Gadani, S. et al., MHCII-independent CD4+ T cells protect injured CNS
neurons via IL-4. J. Clin. Invest. 2015. 125: 699–714.
39 Raposo, C., Graubardt, N., Cohen, M., Eitan, C., London, A., Berkutzki,
T. and Schwartz, M., CNS repair requires both effector and regulatory
T cells with distinct temporal and spatial profiles. J. Neurosci. 2014. 34:
10141–10155.
40 Kunis, G., Baruch, K., Miller, O. and Schwartz, M., Immunization with a
myelin-derived antigen activates the brain’s choroid plexus for recruitment of immunoregulatory cells to the CNS and attenuates disease progression in a mouse model of ALS. J. Neurosci. 2015. 35: 6381–6393.
53 Blachere, N. E., Orange, D. E., Santomasso, B. D., Doerner, J., Foo, P.
K., Herre, M., Fak, J. et al., T cells targeting a neuronal paraneoplastic
antigen mediate tumor rejection and trigger CNS autoimmunity with
humoral activation. Eur. J. Immunol. 2014. 44: 3240–3251.
54 Peterson, J. W., Bo, L., Mork, S., Chang, A. and Trapp, B. D., Transected
neurites, apoptotic neurons, and reduced inflammation in cortical multiple sclerosis lesions. Ann. Neurol. 2001. 50: 389–400.
55 Albert, M. L., Darnell, J. C., Bender, A., Francisco, L. M., Bhardwaj, N.
and Darnell, R. B., Tumor-specific killer cells in paraneoplastic cerebellar
degeneration. Nat. Med. 1998. 4: 1321–1324.
56 International Multiple Sclerosis Genetics, C., Beecham, A. H., Patsopoulos, N. A., Xifara, D. K., Davis, M. F., Kemppinen, A., Cotsapas, C. et al.,
Analysis of immune-related loci identifies 48 new susceptibility variants
for multiple sclerosis. Nat. Genet. 2013. 45: 1353–1360.
57 Ascherio, A., Munger, K. L. and Lunemann, J. D., The initiation and prevention of multiple sclerosis. Nat. Rev. Neurol. 2012. 8: 602–612.
41 Endo, F., Komine, O., Fujimori-Tonou, N., Katsuno, M., Jin, S., Watanabe,
58 Schirmer, L., Antel, J. P., Bruck, W. and Stadelmann, C., Axonal loss and
S., Sobue, G. et al., Astrocyte-derived TGF-beta1 accelerates disease pro-
neurofilament phosphorylation changes accompany lesion development
gression in ALS mice by interfering with the neuroprotective functions
and clinical progression in multiple sclerosis. Brain Pathol. 2011. 21: 428–
of microglia and T cells. Cell Rep. 2015. 11: 592–604.
440.
42 Stevens, J. G., Wagner, E. K., Devi-Rao, G. B., Cook, M. L. and Feldman, L.
59 Ben-Nun, A., Kaushansky, N., Kawakami, N., Krishnamoorthy, G., Berer,
T., RNA complementary to a herpesvirus alpha gene mRNA is prominent
K., Liblau, R., Hohlfeld, R. et al., From classic to spontaneous and human-
in latently infected neurons. Science 1987. 235: 1056–1059.
ized models of multiple sclerosis: impact on understanding pathogenesis
43 Theil, D., Derfuss, T., Paripovic, I., Herberger, S., Meinl, E., Schueler,
and drug development. J. Autoimmun. 2014. 54: 33–50.
O., Strupp, M. et al., Latent herpesvirus infection in human trigeminal
60 Lucchinetti, C. F., Popescu, B. F., Bunyan, R. F., Moll, N. M., Roemer,
ganglia causes chronic immune response. Am. J. Pathol. 2003. 163: 2179–
S. F., Lassmann, H., Bruck, W. et al., Inflammatory cortical demyeli-
2184.
44 van Velzen, M., Jing, L., Osterhaus, A. D., Sette, A., Koelle, D. M. and
Verjans, G. M., Local CD4 and CD8 T-cell reactivity to HSV-1 anti-
nation in early multiple sclerosis. N. Engl. J. Med. 2011. 365: 2188–
2197.
61 Babbe, H., Roers, A., Waisman, A., Lassmann, H., Goebels, N., Hohlfeld,
gens documents broad viral protein expression and immune compe-
R., Friese, M. et al., Clonal expansions of CD8(+) T cells dominate the
tence in latently infected human trigeminal ganglia. PLoS Pathog. 2013. 9:
T cell infiltrate in active multiple sclerosis lesions as shown by microma-
e1003547.
nipulation and single cell polymerase chain reaction. J. Exp. Med. 2000.
45 Knickelbein, J. E., Khanna, K. M., Yee, M. B., Baty, C. J., Kinchington, P.
192: 393–404.
R. and Hendricks, R. L., Noncytotoxic lytic granule-mediated CD8+ T cell
62 Kostic, M., Dzopalic, T., Zivanovic, S., Zivkovic, N., Cvetanovic, A., Sto-
inhibition of HSV-1 reactivation from neuronal latency. Science 2008. 322:
janovic, I., Vojinovic, S. et al., IL-17 and glutamate excitotoxicity in
268–271.
46 Shrestha, B. and Diamond, M. S., Role of CD8+ T cells in control of West
Nile virus infection. J. Virol. 2004. 78: 8312–8321.
47 Shrestha, B. and Diamond, M. S., Fas ligand interactions contribute to
CD8+ T-cell-mediated control of West Nile virus infection in the central
nervous system. J. Virol. 2007. 81: 11749–11757.
48 Shrestha, B., Pinto, A. K., Green, S., Bosch, I. and Diamond, M. S., CD8+
T cells use TRAIL to restrict West Nile virus pathogenesis by controlling
infection in neurons. J. Virol. 2012. 86: 8937–8948.
49 Zhang, B., Chan, Y. K., Lu, B., Diamond, M. S. and Klein, R. S., CXCR3
mediates region-specific antiviral T cell trafficking within the central
nervous system during West Nile virus encephalitis. J. Immunol. 2008.
180: 2641–2649.
50 Kreutzfeldt, M., Bergthaler, A., Fernandez, M., Bruck, W., Steinbach, K.,
Vorm, M., Coras, R. et al., Neuroprotective intervention by interferongamma blockade prevents CD8+ T cell-mediated dendrite and synapse
loss. J. Exp. Med. 2013. 210: 2087–2103.
51 Mizuno, T., Zhang, G., Takeuchi, H., Kawanokuchi, J., Wang, J., Sonobe,
Y., Jin, S. et al., Interferon-gamma directly induces neurotoxicity through
a neuron specific, calcium-permeable complex of IFN-gamma receptor
and AMPA GluR1 receptor. FASEB J. 2008. 22: 1797–1806.
52 Steinman, L., Conflicting consequences of immunity to cancer versus
autoimmunity to neurons: insights from paraneoplastic disease. Eur. J.
Immunol. 2014. 44: 3201–3205.
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
the pathogenesis of multiple sclerosis. Scand. J. Immunol. 2014. 79: 181–
186.
63 Tzartos, J. S., Friese, M. A., Craner, M. J., Palace, J., Newcombe, J., Esiri, M.
M. and Fugger, L., Interleukin-17 production in central nervous systeminfiltrating T cells and glial cells is associated with active disease in multiple sclerosis. Am. J. Pathol. 2008. 172: 146–155.
64 Siffrin, V., Radbruch, H., Glumm, R., Niesner, R., Paterka, M., Herz, J.,
Leuenberger, T. et al., In vivo imaging of partially reversible th17 cellinduced neuronal dysfunction in the course of encephalomyelitis. Immunity 2010. 33: 424–436.
65 Aktas, O., Smorodchenko, A., Brocke, S., Infante-Duarte, C., Schulze Topphoff, U., Vogt, J., Prozorovski, T. et al., Neuronal damage in autoimmune
neuroinflammation mediated by the death ligand TRAIL. Neuron 2005. 46:
421–432.
66 Saxena, A., Martin-Blondel, G., Mars, L. T. and Liblau, R. S., Role of CD8
T cell subsets in the pathogenesis of multiple sclerosis. FEBS Lett. 2011.
585: 3758–3763.
67 Huseby, E. S., Liggitt, D., Brabb, T., Schnabel, B., Ohlen, C. and Goverman,
J., A pathogenic role for myelin-specific CD8(+) T cells in a model for
multiple sclerosis. J. Exp. Med. 2001. 194: 669–676.
68 Friese, M. A., Jakobsen, K. B., Friis, L., Etzensperger, R., Craner, M. J.,
McMahon, R. M., Jensen, L. T. et al., Opposing effects of HLA class I
molecules in tuning autoreactive CD8+ T cells in multiple sclerosis. Nat.
Med. 2008. 14: 1227–1235.
www.eji-journal.eu
2719
2720
Lidia Yshii et al.
Eur. J. Immunol. 2015. 45: 2712–2720
69 Sorbara, C. D., Wagner, N. E., Ladwig, A., Nikic, I., Merkler, D., Kleele,
86 Bielekova, B., Catalfamo, M., Reichert-Scrivner, S., Packer, A., Cerna, M.,
T., Marinkovic, P. et al., Pervasive axonal transport deficits in multiple
Waldmann, T. A., McFarland, H. et al., Regulatory CD56(bright) natural
sclerosis models. Neuron 2014. 84: 1183–1190.
killer cells mediate immunomodulatory effects of IL-2Ralpha-targeted
70 Darnell, J. C., Albert, M. L. and Darnell, R. B., Cdr2, a target antigen
of naturally occuring human tumor immunity, is widely expressed in
gynecological tumors. Cancer Res. 2000. 60: 2136–2139.
71 Verschuuren, J., Chuang, L., Rosenblum, M. K., Lieberman, F., Pryor,
A., Posner, J. B. and Dalmau, J., Inflammatory infiltrates and complete
absence of Purkinje cells in anti-Yo-associated paraneoplastic cerebellar
degeneration. Acta Neuropathol. 1996. 91: 519–525.
72 Dalmau, J. and Rosenfeld, M. R., Paraneoplastic syndromes of the CNS.
Lancet Neurol. 2008. 7: 327–340.
73 Schubert, M., Panja, D., Haugen, M., Bramham, C. R. and Vedeler, C. A.,
Paraneoplastic CDR2 and CDR2L antibodies affect Purkinje cell calcium
homeostasis. Acta Neuropathol. 2014. 128: 835–852.
74 Giometto, B., Grisold, W., Vitaliani, R., Graus, F., Honnorat, J., Bertolini,
G. and Euronetwork, P. N. S., Paraneoplastic neurologic syndrome in
the PNS Euronetwork database: a European study from 20 centers. Arch.
Neurol. 2010. 67: 330–335.
75 Aye, M. M., Kasai, T., Tashiro, Y., Xing, H. Q., Shirahama, H., Mitsuda,
M., Suetsugu, T. et al., CD8 positive T-cell infiltration in the dentate
nucleus of paraneoplastic cerebellar degeneration. J. Neuroimmunol. 2009.
208: 136–140.
76 Albert, M. L., Austin, L. M. and Darnell, R. B., Detection and treatment of
activated T cells in the cerebrospinal fluid of patients with paraneoplastic
cerebellar degeneration. Ann. Neurol. 2000. 47: 9–17.
77 Brochard, V., Combadiere, B., Prigent, A., Laouar, Y., Perrin, A., BerayBerthat, V., Bonduelle, O. et al., Infiltration of CD4+ lymphocytes into the
brain contributes to neurodegeneration in a mouse model of Parkinson
disease. J. Clin. Invest. 2009. 119: 182–192.
78 Biber, K., Owens, T. and Boddeke, E., What is microglia neurotoxicity
(Not)? Glia 2014. 62: 841–854.
79 Cohen, J. A., Coles, A. J., Arnold, D. L., Confavreux, C., Fox, E. J., Hartung,
H. P., Havrdova, E. et al., Alemtuzumab versus interferon beta 1a as firstline treatment for patients with relapsing-remitting multiple sclerosis: a
randomised controlled phase 3 trial. Lancet 2012. 380: 1819–1828.
80 Coles, A. J., Twyman, C. L., Arnold, D. L., Cohen, J. A., Confavreux, C.,
Fox, E. J., Hartung, H. P. et al., Alemtuzumab for patients with relapsing
multiple sclerosis after disease-modifying therapy: a randomised controlled phase 3 trial. Lancet 2012. 380: 1829–1839.
81 Hill-Cawthorne, G. A., Button, T., Tuohy, O., Jones, J. L., May, K., Somerfield, J., Green, A. et al., Long term lymphocyte reconstitution after alemtuzumab treatment of multiple sclerosis. J. Neurol. Neurosurg. Psychiatry
2012. 83: 298–304.
82 Zhang, X., Tao, Y., Chopra, M., Ahn, M., Marcus, K. L., Choudhary,
N., Zhu, H. et al., Differential reconstitution of T cell subsets following immunodepleting treatment with alemtuzumab (anti-CD52 monoclonal antibody) in patients with relapsing-remitting multiple sclerosis.
J. Immunol. 2013. 191: 5867–5874.
83 Jones, J. L., Anderson, J. M., Phuah, C. L., Fox, E. J., Selmaj, K., Margolin,
D., Lake, S. L. et al., Improvement in disability after alemtuzumab treat-
therapy (daclizumab) in multiple sclerosis. Proc. Natl. Acad. Sci. USA 2006.
103: 5941–5946.
87 Polman, C. H., O’Connor, P. W., Havrdova, E., Hutchinson, M., Kappos,
L., Miller, D. H., Phillips, J. T. et al., A randomized, placebo-controlled
trial of natalizumab for relapsing multiple sclerosis. N. Engl. J. Med. 2006.
354: 899–910.
88 Kappos, L., Radue, E. W., O’Connor, P., Polman, C., Hohlfeld, R., Calabresi, P., Selmaj, K. et al., A placebo-controlled trial of oral fingolimod
in relapsing multiple sclerosis. N. Engl. J. Med. 2010. 362: 387–401.
89 Constantinescu CS, A. A., Fryze, W. Safety and pharmacokinetics of
MOR103, a human antibody to granulocyte-macrophage colonystimulating factor, in patients with multiple sclerosis ACTRIMS-ECTRIMS 2014,
pp Abstract FC 2.4.
90 Havrdova, E., Belova, A., Goloborodko, A., Tisserant, A., Jones, I., Garren,
H. and Johns, D., Positive proof of concept of AIN457, an antibody against
interleukin-17A, in relapsing-remitting multiple sclerosis Actrims. Multiple Scler. J. 2012, 18: 513–513.
91 Panitch, H. S., Hirsch, R. L., Haley, A. S. and Johnson, K. P., Exacerbations
of multiple sclerosis in patients treated with gamma interferon. Lancet
1987. 1: 893–895.
92 Agency, E. M., Public summary of opinion on orphan designation: Recombinant human anti-interferon gamma monoclonal antibody for the
treatment of haemophagocytic lymphohistiocytosis European Medicines
Agency. European Medicines Agency, Committee for Orphan Medicinal
Products, London, United Kingdom 2010.
93 Browne, S. K., Burbelo, P. D., Chetchotisakd, P., Suputtamongkol, Y.,
Kiertiburanakul, S., Shaw, P. A., Kirk, J. L. et al., Adult-onset immunodeficiency in Thailand and Taiwan. N. Engl. J. Med. 2012. 367: 725–734.
94 Keefe, A. D., Pai, S. and Ellington, A., Aptamers as therapeutics. Nat. Rev.
Drug Discov. 2010. 9: 537–550.
95 Wang, C. W., Chung, W. H., Cheng, Y. F., Ying, N. W., Peck, K., Chen,
Y. T. and Hung, S. I., A new nucleic acid-based agent inhibits cytotoxic
T lymphocyte-mediated immune disorders. J. Allergy Clin. Immunol. 2013.
132: 713–722 e711.
96 Anderton, S., Burkhart, C., Metzler, B. and Wraith, D., Mechanisms of
central and peripheral T-cell tolerance: lessons from experimental models of multiple sclerosis. Immunol. Rev. 1999. 169: 123–137.
97 Lutterotti, A., Yousef, S., Sputtek, A., Sturner, K. H., Stellmann, J. P.,
Breiden, P., Reinhardt, S. et al., Antigen-specific tolerance by autologous
myelin peptide-coupled cells: a phase 1 trial in multiple sclerosis. Sci.
Transl. Med. 2013. 5: 188ra175.
98 Getts, D. R., Shea, L. D., Miller, S. D. and King, N. J., Harnessing nanoparticles for immune modulation. Trends Immunol. 2015. 36: 419–427.
Full correspondence: Proof. Roland Liblau, INSERM U1043 - CNRS UMR
5282, Centre de Physiopathologie Toulouse-Purpan, Purpan Hospital,
Place du Docteur Baylac TSA 40031, 31059 Toulouse Cedex 9, France
Fax: +33 561 77 21 38
e-mail: [email protected]
ment of multiple sclerosis is associated with neuroprotective autoimmunity. Brain 2010. 133: 2232–2247.
84 Pfender, N. and Martin, R., Daclizumab (anti-CD25) in multiple sclerosis.
See all the ECI 2015 Reviews at http://onlinelibrary.wiley.com/journal/
10.1002/(ISSN)1521-4141/homepage/eci2015.htm
Exp. Neurol. 2014. 262 Pt A: 44–51.
85 Gold, R., Giovannoni, G., Selmaj, K., Havrdova, E., Montalban, X.,
Radue, E. W., Stefoski, D. et al., Daclizumab high-yield process in
relapsing-remitting multiple sclerosis (SELECT): a randomised, doubleblind, placebo-controlled trial. Lancet 2013. 381: 2167–2175.
C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Received: 27/4/2015
Revised: 26/8/2015
Accepted: 2/9/2015
Accepted article online: 8/9/2015
www.eji-journal.eu
"&
!"
!)
*"
"" (#/2!0./3
!" ,
-""!" !! !& ! ! ! #" & ! ,-* & ! & !" ! +!!"&% "!
!&% !!" *" (!!+!"" & !
! ! & ! !" "! ! " "! "
*
!!"!! !!"! ($
! ! ! +! "!&* $#( ! !"!!! "*
" & $ # !' !$ !!
!$" !!#% +!
(&!"+ &(
!' & ! $ " ( !
!( !' & ! !# " * !
!! !$ $"# !!!!+ 1545 !#!
#"! ! !
!" "&! *
& $ ) ! " ( !" "!&(
"!"!&(!#" & !( )"&
.%'.
$%& '$
$&'$-%7$8! '
-%%!'& '+!'!'%5@D!($A?@E
% %* $!% '$!!#'% "$ .!"%#'% <= %! & % % $$%5
%%!.% + ' $."! % ' &$ ! &$ ' $ %!'%9 & )"$ & ' &- . &)"$."$%'%'%*%&- $(') &$<=8
$ . !$% ' $."! % '&!9' %! $ #' "$!(!#' %&$'&! % '% '$%8 % &$(') $. &% %'-$ & #' >' &. +
.&! '$ "!'$$& !'$ ' $0 '$5 #'> !$ !"$%5
% "*%!"&!! % %%!.% + % '&!9 &!$"% $! %% & %
&- % &$'$%8
')$ $&&%&$>"&! %*"!*&%5 !'%(! %
'$ &&-%.(!"".& *%.')!-%'$ %5;' "!'$%* $!
'6 #' ! '& + "$& ($%% "!"'&! % '$! % ' & ;'&$
"!'$ ;&) .$.'% %''/5 $&.$%. "$ "$& %.&( % '%
'$ '$(&8$,+%')!-%'$ % !'%(! %.&$ .
$0 *"!*&% CG & FG %".#'% "!'$ : &- % "*%!"&!!%&""!$&.' '$!"$. %! %. %%
!.'$%$%"! %%'.(!"" &%8
!&% .%7 %* $!% '$!!#'% "$ .!"%#'%5 ' &. &9&'!$5
'&!9' &.5%*%&- $(') &$5*"!*&%
%" 7
' !!
@?CB5 &$*%!"&!!!'!'%'$" #'"% &!$%'%*%&- $(')7. %%&&$& &%
'$" 9B?AF
B@?AC!'!'%)?B
$
