Download Effects of tubulin assembly inhibitors on cell division in prokaryotes

FEMS Microbiology Letters 191 (2000) 25^29
www.fems-microbiology.org
E¡ects of tubulin assembly inhibitors on cell division in prokaryotes
in vivo
Mary Sarcina, Conrad W. Mullineaux *
Department of Biology, University College London, Darwin Building, Gower St., London WC1E 6BT, UK
Received 3 July 2000; received in revised form 1 August 2000 ; accepted 1 August 2000
The bacterial cell division protein FtsZ is a structural analogue of tubulin. Bacterial mutants in which the ftsZ gene is inactivated are
unable to divide. Numerous inhibitors of tubulin assembly are known, some of which are used as fungicides. The strong structural
homology between FtsZ and tubulin raises the possibility that some of these inhibitors could affect bacterial cell division. Here we report
that the tubulin assembly inhibitors thiabendazole and 2-methylbenzimidazole cause cell elongation in Escherichia coli and
cyanobacteria. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
Keywords : Cyanobacterium ; Prokaryote; Elongation; Cell division
1. Introduction
Bacterial cell division can generally be divided in three
parts: elongation, septation and separation. The ¢rst part
is characterised by the elongation of the cells until they are
twice their normal size. At this point, the cells are ready to
divide according to the initiation of septum formation.
The constriction of the cell wall and cell membranes that
leads to the formation of two daughter cells [1] begins with
the ¢rst signs of the indentations around the midpoint of
the bacteria to mark the point of separation. The indentations grow more pronounced until the bacteria are split
in half and the two daughter cells separate from each
other. In Escherichia coli, the doubling time for this event
is about 20 min and numerous factors a¡ecting cell division are involved among which are the so called ¢lamentforming temperature-sensitive (fts) genes: ftsA, ftsD, ftsE,
ftsF, ftsI, ftsQ and ftsZ [2].
The protein FtsZ is ubiquitous in eubacteria and is also
found in archaea and chloroplasts [3]. The three-dimensional structure of FtsZ [4] shows a striking similarity to
* Corresponding author. Tel. : +44 (20) 7679-2326;
Fax: +44 (20) 7679-7096; E-mail : [email protected]
the three-dimensional structure of K- and L-tubulin [5],
with weak sequence identity [6], and a GTPase activity
[7,8]. This protein is essential for cell division and assembles into a ring-like structure at the site of cytokinesis
during septation. Inactivation of FtsZ in E. coli and other
bacteria produces cells that are unable to divide: instead
the cells become immensely elongated [9]. The assembly of
FtsZ in vitro has been demonstrated by using a FtsZ^
green £uorescent protein fusion [10]. According to these
experiments, FtsZ is capable of microtubule-like dynamic
assembly and can self-assemble into structures that are
similar to microtubule asters [11]. However, FtsZ polymers have not yet been visualised in vivo, making it impossible to verify the physiological relevance of such structures [11]. Investigating the e¡ects of tubulin assembly
inhibitors on FtsZ assembly should provide important information about possible structural and functional similarities between FtsZ and tubulin.
Cyanobacteria, like other prokaryotes, contain ftsZ
genes. In Synechocystis 6803 and Synechococcus 7942,
the sequence identity of the predicted proteins with
E. coli FtsZ is about 48%. Here we report the e¡ect of
some tubulin assembly inhibitors, namely thiabendazole
(TBZ) and 2-methylbenzimidazole (MBC) [12], on cell division in E. coli and in the cyanobacteria and Synechocystis sp. strain PCC 6803 in vivo. We show that the inhibitors have a signi¢cant e¡ect on cell size, comparable to
the e¡ect of inactivation of the cyanobacterial Synechococcus sp. strain PCC 7942 ftsZ gene.
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
PII: S 0 3 7 8 - 1 0 9 7 ( 0 0 ) 0 0 3 6 5 - 7
FEMSLE 9587 15-9-00
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 11, 2016
Abstract
26
M. Sarcina, C.W. Mullineaux / FEMS Microbiology Letters 191 (2000) 25^29
2. Materials and methods
2.1. Growth conditions
Synechococcus sp. strain PCC 7942 and Synechocystis
sp. strain PCC 6803 were grown in liquid BG-11 medium
at 30³C under white light. The light intensity was approximately 30^50 Wmol photon m32 s31 . E. coli strain DH5K
was grown in media as described by Maniatis et al. [13]
and used for all plasmid constructions according to standard molecular biology techniques [13].
tion using a digital black and white camera (Hamamatsu)
operated by Openlab 2.5 software (Improvision).
Histogram plots were produced by Sigma plot 2.5 software (SPSS Inc.) and statistical analysis carried out using
the Kolmogorov^Smirnov test [16]. This test compares the
cumulative frequency curve of the data and calculates the
maximum vertical di¡erence value (Z) between them. It
follows that, if the experimental data depart substantially
from the control distribution, the two curves will be widely
separated over part of the cumulative frequency diagram.
3. Results
The entire ftsZ open reading frame (ORF) was ampli¢ed from Synechococcus sp. strain PCC 7942 using the
polymerase chain reaction (PCR). Primers were designed
by reference to the known ftsZ sequence of Synechococcus
sp. strain PCC 7942 (Mori et al. (1998) unpublished, GenBank accession number AF076530). The primer sequences
used were CGGGGTACCATGACCGACCCTATGCCG
and CGGGAATTCCTAGGGTCGGTTTTGAAT. The
PCR product was cloned in pBluescript and cut with HincII to remove a 744-bp section between positions 157 and
901 of the ORF sequence. A kanamycin resistance cassette
was then inserted.
Similarly, the complete ftsZ ORF (sll1633) from Synechocystis sp. PCC 6803 was ampli¢ed using the following
primers designed according to Kaneko [14], CGGAGCTCAATGATGGAACGGAGGGG and GGGGTACCTAACGGCGGGGAAAACGCCGC. The cloned gene
was digested with MscI to remove a 176-bp fragment between positions 351 and 527 of the ORF, which was again
replaced by a kanamycin resistance cassette.
The vftsZ mutants were generated by transforming
wild-type Synechococcus sp. strain PCC 7942 and Synechocystis sp. strain PCC 6803 with the constructs, followed by
selection on growth medium containing kanamycin at
50 Wg ml31 [15].
3.1. Inactivation of the ftsZ genes of cyanobacteria
Synechococcus sp. strain PCC 7942 and Synechocystis
sp. strain PCC 6803
2.3. Cell elongation
Stock solutions of TBZ and MBC (Sigma) were prepared by dissolving the inhibitors in water. The ¢nal concentration of inhibitor used was 30 Wg ml31 for a liquid
culture of V2.6U107 cells ml31 . For cyanobacteria, inhibitors were added about 18 h before microscope analysis,
corresponding to about two cell division cycles. For
E. coli, inhibitors were added about 2 h before microscope
analysis.
2.4. Microscope and image analysis
Images were obtained using an Axiophot confocal
microscope (Zeiss, Germany) equipped with a Hg lamp
(HBO 100). Images were acquired at a 250U magni¢ca-
Synechococcus sp. strain PCC 7942 wild-type cells are
rod-like in shape and are typically 2^5 Wm long. Insertional inactivation of the ftsZ gene with a kanamycin cassette
in this cyanobacterial strain resulted in the elongation of
the cells. The maximum cell size observed increased from
4 Wm to 9 Wm and the mean cell length increased from 3.1
to 4.0 Wm. Fig. 1A,C shows £uorescence-emission images
of the wild-type and mutant strains. The mutation was
lethal : cells could only be propagated for a few generations after transformation. Like most cyanobacteria, Synechococcus sp. strain PCC 7942 contains several copies of
its chromosome per cell. It is likely that the transformant
cells were heteroplasmic: that is, they retained both wildtype and transformed chromosomes. Thus the transformants would merely have a reduced copy number per cell of
ftsZ, which could decrease their longevity.
Inactivation of the ftsZ (sll1633) gene in the cyanobacterium Synechocystis sp. PCC 6803, which has spherical
cells about 1 Wm in diameter (Fig. 1E), resulted in enlarged
cells, either spherical or of irregular shape (Fig. 1G). In
this case, the mutant could be propagated inde¢nitely, but
the cells remained heteroplasmic as indicated by PCR ampli¢cation of the gene locus (data not shown).
3.2. E¡ect of fungicide on cyanobacteria and E. coli in vivo
To test the e¡ect of tubulin inhibitors on the FtsZ gene
product of the bacterial cells in vivo, liquid cultures were
grown in the presence of TBZ (30 Wg ml31 ). E. coli cells
were grown for about 2 h in the presence of TBZ, whereas
the cyanobacterial cells were subjected to the inhibitor for
about 18 h to allow for their longer doubling time (V8 h).
The e¡ect of TBZ was analysed by phase-contrast and
£uorescence microscopy. As illustrated in Fig. 1B, growth
of the cyanobacterium Synechococcus 7942 in TBZ results
in elongation of the cells with a maximum length of 15 Wm
and a mean length of 4.4 Wm. The response to such a drug
is similar to the response observed in the Synechococcus
FEMSLE 9587 15-9-00
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 11, 2016
2.2. DNA manipulation
M. Sarcina, C.W. Mullineaux / FEMS Microbiology Letters 191 (2000) 25^29
27
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 11, 2016
Fig. 1. Fluorescence and phase-contrast microscope images. A: Fluorescence image of wild-type Synechococcus 7942 ; B: £uorescence image of TBZtreated Synechococcus 7942 ; C: £uorescence image of vftsZ Synechococcus 7942; D: £uorescence image of DAPI-stained TBZ-treated Synechococcus
7942 ; E: phase-contrast image of wild-type Synechocystis 6803; F: phase-contrast image of TBZ-treated Synechocystis 6803; G: phase-contrast image
of vftsZ Synechocystis 6803; H: phase-contrast image of wild-type E. coli; I: phase-contrast image of TBZ-treated E. coli. See text for explanation.
7942 vftsZ mutant (Fig. 1C). DAPI-DNA staining of
TBZ-treated Synechococcus 7942 cells (Fig. 1D) shows
that elongation of the cell is accompanied by increased
quantity of DNA, with several nucleoids per cell. Thus,
growth and DNA replication seem to be una¡ected by
TBZ, which may have a speci¢c e¡ect on cell division.
Similar results were obtained with the fungicide MBC
(data not shown).
Growth in TBZ of the cyanobacterium Synechocystis sp.
PCC 6803 resulted in enlarged spherical cells with a diameter of up to 3 Wm (Fig. 1F), similar to its corresponding
vftsZ mutant (Fig. 1G).
Elongation of E. coli cells grown in TBZ was also observed. The mean cell length increased from 2.7 Wm to
3.2 Wm and the maximum length from 5 Wm to 15 Wm
(Fig. 1I).
FEMSLE 9587 15-9-00
28
M. Sarcina, C.W. Mullineaux / FEMS Microbiology Letters 191 (2000) 25^29
Frequency plots (Fig. 2) obtained for TBZ-Synechococcus sp. strain PCC 7942, Synechococcus sp. strain PCC
7942 vftsZ and TBZ-E. coli di¡er from their corresponding wild-type distributions. The signi¢cance of these results was statistically tested according to Kolmogorov^
Smirnov (see Section 2.4). According to this analysis, the
TBZ-Synechococcus sp. strain PCC 7942 and the TBZ-E.
coli depart substantially from the wild-type distributions
(Z = 1.250, n = 9 and Z = 1.35, n = 7, respectively).
4. Discussion
So far the e¡ect of tubulin inhibitors, such as TBZ and
MBC, on FtsZ polymerisation in vivo has not been reported. Here, it has been illustrated that treatment of cyanobacterial and bacterial cultures with TBZ results in
elongation of the cells. Similar responses are observed in
the Synechococcus sp. strain PCC 7942 vftsZ mutant (this
work) and E. coli vftsZ mutant [9]. This suggests that the
cell division cycle has been arrested and possibly that these
tubulin inhibitors act in a similar manner on the FtsZ gene
product as they do on tubulin.
The increased amount of DNA, in DAPI-DNA-stained
TBZ-treated Synechococcus 7942 cells (Fig. 1D), indicates
that DNA replication still occurs in the presence of TBZ.
Once again, this suggests that the inhibitor has a speci¢c
e¡ect on cell division.
We have developed a novel variant of £uorescence recovery after photobleaching (FRAP) which may be used
to examine the mobility of membrane components in cells
with elongated cylindrical membranes [17]. A major motivation for the present study was to develop a way to
elongate small cells such as E. coli and Synechococcus
7942 to aid FRAP studies. Preliminary FRAP results on
Synechococcus 7942 indicate that TBZ-treated cells behave
similarly to untreated cells in terms of the mobility of their
thylakoid membrane components.
FEMSLE 9587 15-9-00
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 11, 2016
Fig. 2. Frequency plots of Synechococcus 7942 and E. coli. A: Wild-type Synechococcus 7942; B: TBZ-treated Synechococcus 7942; C: vftsZ Synechococcus 7942; D: wild-type E. coli; E: TBZ-treated E. coli.
M. Sarcina, C.W. Mullineaux / FEMS Microbiology Letters 191 (2000) 25^29
Acknowledgements
We would like to thank Professor Jeremy Hyams and
his co-workers for the gift of TBZ and helpful discussions
and Tauheed Butt for constructing the vftsZ strain of
Synechocystis PCC 6803. This work was supported by a
BBSRC grant to C.W.M.
References
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
ZipA, an essential component of the septal ring structure that mediates cell division in E. coli. Cell 88, 175^185.
Yu, X.-C. and Margolin, W. (1997) Ca2‡ -mediated GTP-dependent
dynamic assembly of bacterial cell division protein FtsZ into asters
and polymer networks in vitro. EMBO J. 16, 5455^5463.
Yu, X.-C. and Margolin, W. (1998) Inhibition of assembly of bacterial cell division protein FtsZ by the hydrophobic dye 5,5P-bis-(8anilino-1-naphthalenesulfonate). J. Biol. Chem. 273, 10216^10222.
White, E. and Katz, E.R. (1987) Biochemical and genetic approaches
to microtubule function in Dictyostelium discoideum. Methods Cell
Biol. 28, 245^259.
Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press,
New York.
Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasamoto, S.,
Kimura, T., Hosouchi, T., Matsuno, A., Muraki, A., Nakazaki, N.,
Naruo, K., Okumura, S., Shimpo, S., Takeuchi, C., Wada, T., Watanabe, A., Yamada, M., Yasuda, M. and Tabata, S. (1996) Sequence
analysis of the genome of the unicellular cyanobacterium Synechocystis sp. PCC6803. II. Sequence determination of the entire genome
and assignment of the potential protein coding regions. DNA Res. 3,
109^136.
Williams, J.C.K. (1988) Construction of speci¢c mutations in Photosystem II photosynthetic reaction centre by genetic engineering methods in Synechocystis 6803. Methods Enzymol. 167, 766^778.
Miller, J.C. and Miller, J.N. (1992) Statistics for Analytical Chemistry. Ellis Horwood Ltd., Chichester.
Mullineaux, C.W., Tobin, M.J. and Jones, G.R. (1997) Mobility of
photosynthetic complexes in thylakoid membranes. Nature 390, 421^
424.
FEMSLE 9587 15-9-00
Downloaded from http://femsle.oxfordjournals.org/ by guest on May 11, 2016
[1] Roth¢eld, L.I. and Justice, S.S. (1997) Bacterial cell division : the
cycle of the ring. Cell 88, 581^584.
[2] Bramhill, D. and Thompson, C.M. (1994) GTP-dependent polymerization of Escherichia coli FtsZ protein to form tubules. Proc. Natl.
Acad. Sci. USA 91, 5813^5817.
[3] Erickson, H.P. (1997) FtsZ, a tubulin homologue, in prokaryote cell
division. Trends Cell Biol. 7, 362^367.
[4] Lo«we, J. and Amos, L.A. (1998) Crystal structure of the bacterial
cell-division protein FtsZ. Nature 391, 203^206.
[5] Nogales, E., Wolf, S.G. and Downing, K.H. (1998) Structure of the
KL tubulin dimer by electron crystallography. Nature 391, 199^203.
[6] Erickson, H.P. (1995) FtsZ, a prokaryotic homolog of tubulin? Cell
80, 367^370.
[7] de Boer, P., Crossley, R. and Roth¢eld, L. (1992) The essential bacterial cell-division protein FtsZ is a GTPase. Nature 359, 254^256.
[8] RayChaudhuri, D. and Park, J.T. (1992) Escherichia coli cell-division
gene FtsZ encodes a novel GTP-binding protein. Nature 359, 251^
254.
[9] Hale, C.A. and de Boer, P.A.J. (1997) Direct binding of FtsZ to
29