Download Chapter 12 Genetic Engineering and the Molecules of Life

Document related concepts

Gel electrophoresis of nucleic acids wikipedia , lookup

Community fingerprinting wikipedia , lookup

Metalloprotein wikipedia , lookup

Genomic library wikipedia , lookup

Amino acid synthesis wikipedia , lookup

Metabolism wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Gene expression wikipedia , lookup

Proteolysis wikipedia , lookup

Two-hybrid screening wikipedia , lookup

DNA supercoil wikipedia , lookup

Gene wikipedia , lookup

Transformation (genetics) wikipedia , lookup

Non-coding DNA wikipedia , lookup

Molecular cloning wikipedia , lookup

Endogenous retrovirus wikipedia , lookup

Genetic engineering wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Genetic code wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Point mutation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Biochemistry wikipedia , lookup

Biosynthesis wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Transcript
Chapter 12 Genetic Engineering and the
Molecules of Life
How close to “designer babies” are we?
The first draft of the human genome
was completed in 2000
What have we learned from this?
What are stem cells?
What is recombinant DNA?
The Chemistry of Heredity
Deoxyribonucleic Acid (DNA) – the polymeric
molecule that conveys genetic information in all
species
Chromosomes – in humans, there are 46 doublestranded DNA molecules, which contain all of
an individual’s genetic information.
These 46 chromosomes exist as 23 pairs, one set
from each parent
Human genome – the approximately 30,000
genes on the 46 chromosomes that code for all
the proteins that convey one or more hereditary
traits
Gene – a section of DNA that codes for a
particular protein
The Chemistry of Heredity
What are we made of?
• All genetic information is stored in the nucleus of the millions of
cells in the body.
• Each nucleus contains chromosomes, 46 compact structures of
intertwined molecules of DNA, and about 30,000 genes,
components that convey one or more hereditary traits.
• DNA is a special template written in a molecular code on a tightly
coiled thread that carries all genetic information.
12.1
What makes up DNA?
DNA is made of fundamental
chemical units, repeated over
and over.
Each unit is composed of three
parts: nitrogen-containing
bases, the sugar deoxyribose,
and phosphate groups.
Adenine (A), Guanine (G),
Cytosine (C), and Thymine
(T) are the bases.
12.1
Nucleotides
A combination of a base, phosphate group, and a deoxyribose
sugar is a nucleotide.
This
nucleotide is
an adenosine
phosphate.
Any of the
four bases
can be used
to form a
nucleotide.
A covalent bond
exists between the
phosphate group
and the sugar.
Another covalent bond is
present between the ring
nitrogen of the base and a ring
carbon of the sugar.
12.1
What does a segment of DNA look like?
A typical DNA molecule
consists of thousands of
nucleotides covalently
bonded in a long chain.
The phosphate groups are
responsible for linking
each nucleotide.
A phosphate group of one
nucleotide reacts with an
–OH group present on the
deoxyribose ring of another
nucleotide, forming and
eliminating a H2O
molecule.
This –OH group reacts with the
phosphate group of another nucleotide
12.1
Chargaff’s Rules
Erwin Chargaff’s research showed that for all humans, the percentage of adenine
in DNA is almost identical to the percentage of thymine.
Similarly, the percentages of guanine and cytosine are almost equal.
From this, Chargaff concluded that the bases always come in pairs; adenine is
always associated with thymine and guanine is always associated with cytosine.
Thus, Chargaff’s rule states: %A = %T and %G = %C
12.1
Hydrogen bond – a weak bond-like interaction
that exists between a nitrogen or oxygen atom
and a hydrogen atom directly bonded to a
nitrogen or oxygen atom
O
H
O
R
C
H
R
R
N
H
:N
..
H
H
Nucleotide – combination of a base, a
deoxyribose ring, and a phosphate group
The Double Helix of DNA
X-Ray Diffraction pattern of a hydrated
DNA molecule taken in 1952.
Rosalind Franklin- her
data was used by Watson
and Crick (below)
This technique uses the fact that a
molecule’s electrons diffract X-Rays at
particular angles and the resulting pattern,
like the one above, can be used to solve
the structure of a crystal.
12.2
The Double Helix of DNA
Using Rosalind Franklin’s X-ray
diffraction data, Watson and Crick
proposed a molecular model for
DNA.
This model had a double strand of
repeating nucleotides.
Complementary base pairing (AT,
CG) is held in place by hydrogen
bonds (shown in red).
The nature of the base pairing
required that the two strands be coiled
in the shape of a double helix.
12.2
DNA Replication
The process by which copies of DNA
are made is called replication.
The original DNA double helix
partially unwinds and the two
complementary portions separate.
Each of the strands serves as a
template for the synthesis of a
complementary strand.
The result is two complete and
identical DNA molecules.
12.2
Ribonucleic acid – the polymeric molecule
consisting of phosphate, the sugar ribose, and
the four bases cytosine (C), adenine (A), guanine
(G), and uracil (U)
Messenger RNA (mRNA) – the single-stranded
RNA molecule that transcribes the genetic
information of a particular gene from the DNA
double helix
Transfer RNA (tRNA) – the small RNA
molecule that carries a particular amino acid
when the genetic information in mRNA is
translated into the correct amino acid sequence
of a particular protein. There is a different
tRNA for each of the 20 common amino acids.
Cracking the Chemical Code
The 3 billion base pairs in each human cell provide the
blueprint for producing a human being.
The specific sequence of base pairing is important in
conveying the mechanism of how genetic information is
expressed.
The expression is seen through proteins.
Through directing the synthesis
of proteins, DNA can control the
characteristics of an individual,
including inherited illnesses.
12.3
Amino acid – the individual building blocks of
proteins. There are 20 common amino acids.
H R
O
C
H2N
OH
Protein – a polymer of amino acids with a
particular function. Proteins can be enzymes,
hormones, or have other biological functions.
H R1
H2N
O
O
H
H
N
R2
H
N
H
R3
O
OH
Proteins are made of amino acids. The general formula for an amino acid includes
four groups attached to a carbon atom: (1) a carboxylic acid group, -COOH; (2) an
amine group, -NH2; (3) a hydrogen atom, -H; and (4) a side chain designated as R:
There are 20 naturally
occurring amino acids
that make up proteins
They differ from one another by the different R groups
12.3
Two amino acids can link together via a peptide bond:
The two molecules join,
expelling a molecule of water
Peptide bond
The process may repeat itself over and over, creating a
peptide chain.
Once incorporated into the peptide chain, the amino acids
are known as amino acid residues.
12.3
Codons: How are they relevant in genetic expression?
The order of bases in DNA determines the order of amino acids in a protein.
Because there are 20 amino acids present in the proteins, the DNA code must
contain 20 code “words”; each word represents a different amino acid.
The genetic code is written in groupings of three DNA bases, called codons.
The diagram shows possible codons, determined according to the base
sequence of the nucleic acid strand. The expression of the genetic
information is then seen through the specific proteins assigned.
12.3
DNA transcription and RNA translation
The primary structure
of a protein is its linear
sequence of amino acids
and the location of any
disulfide (-S-S-) bridges.
N-terminal
carboxyl
terminal
The sequence is
characterized by the
amino terminal or
"N-terminal" (NH3+) at
one end; and the
carboxyl terminal or
"C-terminal" (COO-) at
the other.
Tertiary structure of the enzyme, chymotrypsin
12.4
Protein Structure
Primary structure – the sequence of amino acids
in a protein from the first amino acid to the last
Secondary structure – the intermediate level of
organization that shows helical structure and
chain linkages through disulfide (–S–S– ) bonds
Tertiary structure – the overall shape or
conformation of the protein
Most proteins contain one or more stretches of amino acids that give rise
to a characteristic three dimensional structure. The most common of
these are the alpha helix and the beta conformation. The telephone
cord illustrates the nature of the secondary structure of the protein.
Tertiary structure refers to the three-dimensional structure of the entire
polypeptide.
Like this tangled-up
phone cord.
12.4
Active Site – the region of the enzyme where the
catalytic reaction takes place
Substrate – the molecule or molecules whose
reaction is catalyzed by the enzyme
Sickle-cell anemia is a hereditary disease, which
illustrates how small changes in a protein’s
primary structure can have a profoundly
deleterious effect on the protein’s function.
When an individual with sickle-cell anemia
experiences a low oxygen concentration in the
blood (e.g. during strenuous exercise), some of
the red blood cells convert into a rigid, sickle or
crescent-shaped form. Because these cells have
lost their normal deformability, they clog tiny
capillaries and cannot pass through tiny
openings in the spleen and other organs.
The property of sickling is caused by two
mutations in the DNA sequence of the gene
coding for the oxygen-transport protein,
hemoglobin. Two amino acids that should be
glutamic acid are replaced with valine instead.
This substitution causes hemoglobin to convert
to the sickled form at low oxygen
concentrations.
The function of a protein is dependent on its shape or threedimensional structure.
Small changes in the primary structure can have dramatic effects
on its properties.
Sickle cell anemia is an example of a
condition that develops when red blood cells
take on distorted shapes due to an error in the
amino acid sequence.
Because these cells lose their normal shape,
they cannot pass through tiny openings in the
spleen and other organs.
Some of the sickled cells are destroyed and anemia results. Other
sickled cells can clog organs so badly that the blood supply to them
is reduced.
12.4
The Human Genome Project is the effort to map all the genes in
the human organism.
On June 26, 2000, scientists announced that a rough draft of the
project to decode the genetic makeup of humans had been
completed.
The goal, to determine the sequence of all 3 billion base pairs in
the entire genome, was completed for the approximately 30,000
genes found on the 46 human chromosomes.
This information might one day help to diagnose and cure
diseases, understand human development, and trace our
evolutionary roots.
This was a unique collaboration between government, private
sector, and a philanthropic organization.
12.5
Human Genome Project – the determination of
the sequence of all 3 billion base pairs in the 46
human chromosomes, including that of the
approximately 30,000 genes. This project was
completed in 2000.
Scientists are now trying to determine the
function of all the proteins encoded by the
30,000 genes.
Should we be concerned that employers or
insurance companies will use genetic
information to discriminate against people who
have or have a hereditary predisposition to
certain diseases? Could this kind of information
be used to try and create a race of “super”
humans?
Recombinant DNA
Recombinant DNA is used to produce human
insulin for diabetics. Insulin is a small protein
(51 amino acids) that helps the body metabolize
glucose (blood sugar).
Plasmid – a ring of DNA that bacteria have
Vector – a plasmid with a foreign gene inserted
into it
Clone – a collection of cells or molecules
identical to an original cell or molecule
Uses of Recombinant DNA
Recombinant DNA is used to produce vaccines
against viruses and bacteria by inserting DNA
encoding for a viral or bacterial protein into a
vector. The protein is expressed and then
isolated and purified. This protein is then used
to in a vaccine to stimulate the immune system
to produce antibodies against it. A subsequent
infection by the virus or bacteria leads to a rapid
response by the immune system.
Transgenic plants (and animals) can be created
with some desirable property. Desirable
properties for agricultural crops include
resistance to certain pests and diseases, synthesis
of specific nutrients, and resistance to particular
herbicides. The latter property means that a
minimal amount of herbicide can be applied per
acre to clear weeds and improve crop yield.
A representation of
genetic engineering
12.6
The mythical creature
chimera represents a
combination of a lion, a
goat, and a serpent.
Recombinant DNA is
sometimes referred to as
a chimera.
12.6
Current world population (approaching 7 billion) owes much to Norman
Borlaug (1914-2009; Distinguished Professor of International
Agriculture at Texas A&M; winner of the 1970 Nobel Peace Prize).
Borlaug is credited with saving hundreds of millions of lives by
developing advanced crop breeding and agricultural practices for use in
countries suffering from drought-induced famine. For example, Mexico,
which imported 60% of its wheat in the 1940’s, was able to become selfsufficient by the mid-1950’s despite an ever increasing population.
The green revolution of the 1950’s and 1960’s allowed the world food
supply to keep pace with explosive population growth.
Countries with undernourished populations
The United Nations’ Food & Agriculture
Organization (FAO) estimate that by 2030, it
will be necessary to increase the current grain
supply by 30% to feed a projected global
population of 8.3 billion.
A combination of rapidly increasing global
population and climate change will severely
challenge the world’s farmers to meet this goal.
A further complication is that as per capita
income climbs in China and some other middle
income countries, demand for food (particularly
meat) increases faster than population. Meat
production means diverting some grains into
animal feed.
Agricultural research is focusing on developing
genetically engineered drought-tolerant and
disease-resistant crops to meet the challenge of
increasing the global food supply. Genetic
engineering allows genes from other species to
be inserted into important food crops. It is a step
beyond simply crossbreeding different varieties
of the same plant species to develop new strains
with desired characteristics.
Genetically-Engineered Agriculture
Transgenic Plants
Virus resistant transgenic rice
Frankenfood?
Controversial: protestors at the
2005 WTO meeting in China
12.7
In Europe, there is widespread public
apprehension towards genetically modified
(GM) crops. One poll found that over 80% of
Europeans view GM foods as “bad”. Even in
the US, a majority (55%) disapproved of GM
food products. New EU regulations require
labeling and traceability of all food and animal
feed containing more than 0.5% of GM
ingredients. Some polls indicate that Americans
would like labeling, but it has not yet become a
major issue. Americans have historically placed
a considerably greater degree of trust in the
regulatory oversight of the US Dept. of
Agriculture than Europeans do in their
counterpart agencies.
In 1998, the US exported $63 million worth of
corn to the EU, but the exports decreased to
$12.5 million in 2002
At the end of 2002, EU ministers agreed to new
labeling controls for GM foods, which will have
to carry a special harmless DNA sequence (a
DNA bar code) identifying the origin of the
crops, making is easier to spot contaminated
crops and withdraw them from the food chain
should problems arise.
US Agricultural Department officials argue that
since the US does not require labeling, Europe
should not require labeling either. They claim
mandatory labeling is a trade barrier since it
could imply there is something wrong with GM
food.
Is the official US complaint to the World Trade
Organization (WTO) regarding the EU ban
justified? The complaint was also filed by
Argentina, Canada, Egypt, Australia, New
Zealand, Mexico, Chile, Colombia, El Salvador,
Honduras, Peru, and Uruguay.
Are individual consumers’ fears of GM foods
justified?
American farmers lost market share in certain
countries after changing to GM crops because of
skeptical consumers. Some famine-threatened
African countries (e.g. Zambia, Zimbabwe, and
Mozambique) have refused to accept US aid
because it contains GM food.
Recombinant DNA used to restore sight to
children
with congenital blindness
A research team at the Univ. of Pennsylvania
School of Medicine created a vector (a
genetically engineered virus) to carry a
normal version of a gene called RPE65, that
is mutated in one form of Leber’s congenital
amaurosis (LCA), a genetic disease that
progressively damages the retinas leaving
many patients totally blind in their twenties
or thirties.
Animal studies with mice and dogs had shown
that visual improvement was age-dependent, so
the research team hypothesized that younger
patients would receive the greatest benefit. A
clinical trial with five children and seven adults
ranging in age from 8 to 44, received injections
of therapeutic genes into their retinas.
As expected, the greatest improvement occurred
in the children, all of whom are now able to
navigate a low-light obstacle course. Before
they received the gene therapy, the patients had
great difficulty avoiding barriers, especially in
dim light. Not all the adults performed better on
the obstacle course and those who did, showed
more modest improvements than did the
children.
The clinical benefits have persisted for nearly
two years after the first injections with
therapeutic genes were given. Although none of
the patients attained normal eyesight, six of the
twelve test subjects improved enough that they
are no longer classified as legally blind.
Gene therapies for other retinal diseases, such as
age-related macular degeneration may also be
developed.
These results are based on nearly twenty years
of research and animal studies with mice and
dogs. Is it justified?
Cloning Mammals and Humans
In 1996, Dolly the sheep was born – the first
cloned mammal. Dolly was created by a
technique called nuclear transfer. The nucleus
(contains the chromosomes) from an adult cell
was placed in a donor egg from another sheep
whose nucleus had been removed. The nucleus
and donor egg were fused with an electrical jolt.
The DNA then initiated the growth of the
embryo, which was then implanted into a
surrogate sheep’s uterus. Since then, several
other mammalian species have been successfully
cloned.
Dolly is an example of “reproductive cloning”,
in which an embryo is transferred to a
gestational carrier in the hopes that a pregnancy
will result and be carried full term.
Cloning Humans and Mammals
12.8
Cloning Humans and Mammals
Dolly, the cloned sheep
Snuppy, the cloned dog, next to his “father”
12.8
“Therapeutic cloning” refers to harvesting stem
cells from 3- to 5-day-old embryos to establish
stem cell lines. Scientists hope to induce these
stem cells to differentiate into various
specialized cells.
In 2004, a team of scientists led by Woo Suk
Hwang and Shin Yong Moon of Seoul National
University reported that they had successfully
cloned human cells to generate embryonic stem
cells. In 2006, Hwang admitted the data had
been fabricated and resigned from his university
position.
Would blastocysts created in this manner be
extensions of the people whose DNA was used
to create them or would they be separate, unique
beings in the same way that identical twins are
unique, even though they share the same genetic
blueprint?
Results from Stem Cell Research
Scientists at the Burnham Institute for Medical Research in La Jolla, CA,
have programmed embryonic stem cells into becoming nerve cells when
transplanted into the brains of mice. None of the mice formed tumors,
which have been a major setback in previous attempts at stem cell
transplantation.
This research is a first step toward developing new treatments for stroke,
Alzheimer’s, and other neurological conditions.
The Food & Drug Administration (FDA) approved a phase I clinical trial
for the transplantation of a human embryonic stem cell-derived cell
population into spinal cord-injured individuals on January 23, 2009.
Eight to ten paraplegics who had had their injuries no longer than two
weeks before the trial begins, will be selected since the neural stem cells
must be injected before scar tissue forms. These first trials are mainly to
test for the safety of the procedures. Based on earlier results with mice,
researchers say the restoration of myelin sheaths (insulation around nerve
cells) and an increase in mobility is probable. The injections are not
expected to fully restore mobility.
In November 2010, the first patient, a recent paraplegic, was injected
with two million embryonic stem cells in the injured spinal cord region
with the goal of regenerating spinal cord tissue. The cells had been
induced to become specialized nerve cells. The embryonic stem cells
came from a leftover embryo from a fertility treatment, which would
have been otherwise discarded. Embryonic stem cells are valued by
researchers for their ability to be transformed into any type of cell. There
are some restrictions tied to federally funded research involving
embryonic stem cell lines. The company developing this treatment has
spent ~$175 million thus far with no federal funding.
Animal model studies shown movement in previously paralyzed rodents,
but the results in humans are not expected to be that dramatic.
Human embryonic stem cells could be used as
models for human genetic diseases. The relative
inaccessibility of human tissue is an obstacle to
research in these areas. This approach could be
very valuable in studying cystic fibrosis or
fragile-X syndrome or other genetic diseases
where no reliable animal model exists.
Embryos with a genetic disease could be
identified by prenatal genetic diagnosis (PGD)
and used to establish a stem cell line featuring
the genetic disorder.
The National Institutes of Health (NIH)
announced the approval of thirteen new
human embryonic stem cell lines for NIH
funding on Dec. 2. 2009.
Where do we go from here?
Is saving a human life worth the
cost of a potential human life?
12.8
What We Should Know from Ch. 10 and 12
Be able to write structural formulas and lineangle drawings.
Be able to draw isomers.
Recognize functional groups.
Recognize enantiomers and chiral carbons.
Understand the structure of DNA and how it is
translated into a protein sequence.
Understand how the base pairs are held together
by hydrogen bonds.
Understand what recombinant DNA is and how
it works. Be able to give examples of
recombinant DNA technology.
Understand the polymerase chain reaction and
be able to give examples of this method.
Understand cloning via nuclear transfer.
RNA Codon Table
Ala (Alanine)
Leu (Leucine)
Arg (Arginine)
Lys (Lysine)
Asn (Asparagine)
Met (Methionine)
Asp (Aspartic acid)
Phe (Phenylalanine)
Cys (Cysteine)
Pro (Proline)
Gln (Glutamine)
Ser (Serine)
Glu (Glutamic acid)
Thr (Threonine)
Gly (Glycine)
Trp (Tryptophan)
His (Histadine)
Tyr (Tyrosine)
Ile (Isoleucine)
Val (Valine)
START
STOP
GCU, GCC, GCA, GCG
UUA, UUG, CUU, CUC, CUA, CUG
CGU, CGC, CGA, CGG, AGA, AGG
AAA, AAG
AAU, AAC
AUG
GAU, GAC
UUU, UUC
UGU, UGC
CCU, CCC, CCA, CC G
CAA, CAG
UCU, UCC, UCA, UC G, AGU, AGC
GAA, GAG
ACU, ACC, ACA, AC G
GGU, GGC, GGA, GGG
UGG
CAU, CAC
UAU, UAC
AUU, AUC, AUA
GUU, GUC, GUA, GUG
AUG
UAA, UGA, UAG
AUG serves as the codon fo r the amino acid methionine and also as the “start” site on
messenger RNA (mRNA). The first AUG codon on mRNA is where translation into
protein beg ins.
DNA makes up the chromosomes (23 pairs in humans) in cells’ nuclei. There are four
bases A, C , G and T . A and T form base pairs as do G and C. RNA use s the base uracil
(U) in place of thymine (T) as well as A, C and G.
When a gene in a chromosome is transcribed, the DNA strands are pulled apart and a
complementary RNA strand is formed from the DNA strand containing the gene. The
DNA double helix then reforms and the mRNA travels from the cell’s nucleus to the
cytosol. The mRNA is then translated into protein.
Below is shown a small section of a DNA strand. What would the base sequence o f the
complementary strand be after one round of DNA replication?
TACAGA CCACATAAAACCGAA
ATGTCTGGTGTATTTTGGCTT
What would the base sequence o f the mRNA be after transcription of this section of
DNA? Remember RNA uses U in place of T.
AUGUCUGGUGUAUUUUGGCUU
What would be the amino acid sequence of the protein formed from translation of this
section of mRNA? You may use the three letter abbreviations for the amino acids.
Met-Ser-Gly-Val-Phe-Trp-Leu
How does chang ing the original DNA sequence to TACAGACCACATAAAACAGA A
chang e the amino acid sequence of the protein that is produced?
Met-Ser-Gly-Val-Phe-Cys-Leu
Draw the hyd rogen bond s between the AT base pair.
H
O
H3C
H
N
H
H
Thymine
N
O
H
N
N
N
dR
N
N
H
Adenine
dR
Circle the chiral carbons in the molecules shown below. Chiral carbons have four
different substituents.
O
CH3
CH3
O
H3C
H
O
O
H3CO
Na