Download Full Text - the American Society of Animal Science

Published December 8, 2014
Number of intramuscular adipocytes and fatty acid binding protein-4
content are significant indicators of intramuscular fat level
in crossbred Large White × Duroc pigs1
M. Damon,*2 I. Louveau,* L. Lefaucheur,* B. Lebret,* A. Vincent,* P. Leroy,†
M. P. Sanchez,‡ P. Herpin,# and F. Gondret*
*Unité Mixte de Recherches Systèmes d’Elevage Nutrition Animale et Humaine, Institut National de la
Recherche Agronomique, 35590 Saint Gilles, France; †Unité Mixte de Recherches Génétique Animale,
Institut National de la Recherche Agronomique, 35000 Rennes, France; ‡Station de Génétique Quantitative,
Institut National de la Recherche Agronomique, 78352 Jouy-en-Josas, France; and #Département Physiologie
Animale et Système d’Elevage, Institut National de la Recherche Agronomique, 35590 Saint-Gilles, France
ABSTRACT: Intramuscular fat content is generally
associated with improved sensory quality and better
acceptability of fresh pork. However, conclusive evidence is still lacking for the biological mechanisms underlying i.m. fat content variability in pigs. The current
study aimed to determine whether variations in i.m.
fat content of longissimus muscle are related to i.m.
adipocyte cellularity, lipid metabolism, or contractile
properties of the whole muscle. To this end, crossbred
(Large White × Duroc) pigs exhibiting either a high
(2.82 ± 0.38%, HF) or a low (1.15 ± 0.14%, LF) lipid
content in LM biopsies at 70 kg of BW were further
studied at 107 ± 7 kg of BW. Animals grew at the same
rate, but HF pigs at slaughter presented fatter carcasses than LF pigs (P = 0.04). The differences in i.m.
fat content between the 2 groups were mostly explained
by variation in i.m. adipocyte number (+127% in HF
compared with LF groups, P = 0.005). Less difference
(+13% in HF compared with LF groups, P = 0.057)
was noted in adipocyte diameter, and no significant
variation was detected in whole-muscle lipogenic enzyme activities (acetyl-CoA carboxylase, P = 0.9; malic
enzyme, P = 0.35; glucose-6-phosphate dehydrogenase,
P = 0.75), mRNA levels of sterol-regulatory element
binding protein-1 (P = 0.6), or diacylglycerol acyltransferase 1 (P = 0.6). Adipocyte fatty acid binding protein
(FABP)-4 protein content in whole LM was 2-fold
greater in HF pigs than in LF pigs (P = 0.05), and
positive correlation coefficients were found between the
FABP-4 protein level and adipocyte number (R2 = 0.47,
P = 0.02) and lipid content (R2 = 0.58, P = 0.004). Conversely, there was no difference between groups relative
to FABP-3 mRNA (P = 0.46) or protein (P = 0.56) levels,
oxidative enzymatic activities (citrate synthase, P = 0.9;
β-hydroxyacyl-CoA dehydrogenase, P = 0.7), mitochondrial (P = 0.5) and peroxisomal (P = 0.12) oxidation
rates of oleate, mRNA levels of genes involved in fatty
acid oxidation (carnitine-palmitoyl-transferase 1, P =
0.98; peroxisome proliferator-activated receptor delta,
P = 0.73) or energy expenditure (uncoupling protein 2,
P = 0.92; uncoupling protein 3, P = 0.84), or myosin
heavy-chain mRNA proportions (P > 0.49). The current
study suggests that FABP-4 protein content may be a
valuable marker of lipid accretion in LM and that i.m.
fat content and myofiber type composition can be manipulated independently.
Key words: adipocyte, fatty acid binding protein, intramuscular fat, meat quality, myosin, pig
2006 American Society of Animal Science. All rights reserved.
INTRODUCTION
Intramuscular fat content or marbling influences
sensory quality and acceptability of fresh pork (Fernan1
The authors acknowledge the staff of the Institut National de la
Recherche Agronomique experimental herds of Le Magneraud and
Rouillé for animal care, and N. Bonhomme, P. Ecolan, M. Fillaut, F.
Pontrucher, and C. Tréfeu for their expert technical assistance.
2
Corresponding author: [email protected]
Received July 19, 2005.
Accepted December 20, 2005.
J. Anim. Sci. 2006. 84:1083–1092
dez et al., 1999). This i.m. fat content varies widely
between muscles and pig genotypes (Sellier, 1998); particularly, the i.m. fat content is less in conventional
European pigs than in Duroc and Meishan pigs. Increasing i.m. fat content in valuable low-fat muscles by
selective breeding remains a difficult task because of
unfavorable genetic correlations with other production
traits (Hovenier et al., 1992). Quantitative trait loci
influencing i.m. fat content have been identified in pigs
(de Koning et al., 1999). The existence of a major gene
for i.m. fat accretion has been postulated in both Meis-
1083
1084
Damon et al.
han (Janss et al., 1997) and Duroc breeds (Sanchez et
al., 2002). However, the underlying mechanisms have
not been elucidated yet. Metabolic pathways in both
myofibers and i.m. adipocytes could theoretically contribute to variation in i.m. fat level (Kelley and Goodpaster, 2001; Gondret et al., 2004). Thus, studies have
elucidated several candidate genes, such as the adipocyte fatty-acid binding protein [(FABP)-4] and heart
fatty-acid binding protein (FABP-3), involved in intracellular targeting of fatty acids (Gerbens et al., 1998,
1999); the diacylglycerol acyltransferase 1 (DGAT1),
which controls triglyceride storage (Nonneman and
Rohrer, 2002; Thaller et al., 2003), or the malic enzyme
(MEZ; i.e., the main supplier of energy cofactor for lipogenesis; Mourot and Kouba, 1998). In contrast, studies
have failed to provide evidence for a strict association
between muscle oxidative capacity and i.m. fat content
(Leseigneur-Meynier and Gandemer, 1991), despite the
fact that i.m. fat content is nearly double as oxidative
as glycolytic fibers (Malenfant et al., 2001).
To determine the mechanisms underlying variations
in i.m. fat content in pigs, we examined adipocyte cellularity, lipogenic capacity, FABP expressions, oxidative
metabolism, and myosin heavy-chain (MyHC) polymorphism in pigs exhibiting either a high or a low i.m. fat
content in the LM.
MATERIALS AND METHODS
Experimental Animals
The experiment was conducted in accordance with
national regulations for human care and use of animals
in research. Licenses, procedures, and holding facilities
were approved by the French Veterinary Services (certificate of authorization of experiment on living animals
no. 35-22 delivered by the French Department of Agriculture to F. Gondret).
The pigs originated from a French selection program
devoted to test the existence of a major gene involved
in determining i.m. fat content (Sanchez et al., 2002)
and were produced at the experimental farm of Le Magneraud (Institut National de la Recherche Agronomique, Surgères, France). At 70 kg of BW, biopsies were
performed in LM at the level of the last rib (Talmant
et al., 1989). The actual biopsy lasted <1 s, and approximately 1 g of LM was immediately frozen in liquid
nitrogen and stored at −75°C until determination of
the i.m. lipid content. Twelve F2 Large White × Duroc
barrows were then chosen from different litters having
either a low (1.15 ± 0.14%, n = 6, LF) or a high (2.82
± 0.38%, n = 6, HF) i.m. fat content.
The pigs were provided free access to a standard diet
(Table 1) and water until slaughter at about 107 kg of
BW. Pigs were transported (duration of transport = ∼3
h) to the experimental slaughterhouse (Unité Mixte de
Recherches Systèmes d’Elevage Nutrition Animale et
Humaine, Institut National de la Recherche Agronomique, Saint-Gilles, France) in the afternoon and were
Table 1. Composition of the diet (as-fed basis)
Ingredient
(g/kg)
Wheat
Maize
Wheat bran
Rapeseed meal
Soybean meal
Animal fat
Forage pea
Molasses
Clay
Dicalcium phosphate
Calcium carbonate
L-Lysine
Trace minerals and vitamins
331
156
147
56
98
6
104
28
8
2
11
5
10
Chemical composition
CP
Crude fat
Crude fiber
Starch
Ash
Lysine
DE, Mcal/kg
163
30
46
387
62
9.3
3.19
slaughtered by electrical stunning and exsanguination
after an overnight fast.
Carcass Measurements and Sample Collection
Age, BW, and carcass weight were recorded at slaughter. Blood samples (10 mL) were collected on heparin
at exsanguination, and plasma was then obtained by
centrifugation at 2,500 × g for 10 min at 4°C. Plasma
samples were stored at −20°C. Backfat thickness (mean
of measurements taken at the third and/or fourth lumbar vertebra and third and/or fourth last rib levels) was
measured using a Fat-O-Meater (SFK, Herlev,
Denmark).
Within 30 min after slaughter, a piece of LM (third
lumbar vertebra level) was carefully excised from the
right side of the carcass, avoiding any contamination
with subcutaneous adipose tissue, and was immediately processed for determination of the ex vivo oleate
oxidation rate. Other samples, oriented following the
myofiber longitudinal axis, were placed on flat sticks,
frozen in liquid nitrogen, and stored at −75°C until
histological and biochemical analyses. A 1-cm thick
slice of LM, the last sampling, was minced, freeze-dried,
pulverized, and kept at −20°C under vacuum until lipid
content determination. The day after slaughter, the
weights of dissectible backfat, loin, and ham of the left
side of the carcass were recorded.
Hormone Concentrations
Plasma concentrations of insulin were measured by
RIA as previously described (Prunier et al., 1993). Concentrations of IGF-I were determined in plasma using
a double RIA after acid-ethanol extraction (Louveau
Indicators of muscle fat content in pigs
and Bonneau, 1996). All samples were analyzed in duplicate within a single assay. The intraassay CV was
6.3% for insulin and 8.8% for IGF-I.
Muscle Lipid Content
Lipids were extracted from freeze-dried muscles using a 17-fold dilution of tissue in 2:1 chloroform/methanol (vol:vol) according to the method outlined by Folch
et al. (1957). Lipid content of fresh tissue (g/100 g)
was obtained by taking into account the DM content
determined from the weight of minced tissues before
and after freeze-drying.
Histochemistry
Intramuscular adipocyte characteristics were investigated in 5 LM serial cross-sections (10 ␮m thick, 40␮m interval) obtained by using a cryostat (2800 Frigocut Reichert-Jung, Francheville, France) and stained
with oil red O (Gondret and Lebret, 2002). For each
sample, all visible adipocytes were counted on the whole
of the 5 sections using a projection microscope (Visopan
Reichert, Wien, Austria). The rare visible cells that
displayed a diameter <10 ␮m were not considered. For
the particular case of border cells, we only counted adipocytes that exhibited more than one-half portion in a
particular section.
The total area of each cross-section was measured
using a programmable planimeter (Hitachi, Siko, Japan). The results were expressed as the number of adipocytes/cm2 of section (mean of the 5 determinations for
each sample). Individual areas of all of the adipocytes,
except border cells (total of approximately 100 to 250
adipocytes per section) were determined in each section.
The proportion of Sudan Black B positive fibers, which
stains intramyocellular lipids, was determined in 3 randomly selected sections of approximately 300 fibers,
using a projection microscope (Visopan Reichert) according to Dubowitz (1985).
Lipogenic Enzyme Activities
The activities of enzymes controlling key steps of lipogenesis (acetyl-CoA carboxylase; ACC) or providing reduced NAD phosphate for fatty acid synthesis [MEZ
and glucose-6-phosphate dehydrogenase (G6PDH)]
were measured on whole-muscle cytosolic fractions with
cofactors and excess of substrates. The activity of ACC
was determined by the H14CO3− fixation method (Chang
et al., 1967), whereas MEZ and G6PDH activities were
determined by spectrophotometry within the linear
phase of the reaction (Bazin and Ferré, 2001). Activities
were defined as the amount of enzyme that incorporated
1 nmol of H14CO3− (ACC) or reduced 1 nmol of NAD
phosphate+ (ME, G6PDH) per min/g of fresh tissue.
Fatty Acid Oxidation Rate
Oxidation rates of oleate were determined from 0.3
g of freshly excised muscle samples using [1-14C] oleate
1085
as the substrate according to Herpin et al. (2003). Total
oleate oxidation was determined in the absence of mitochondrial inhibitors of the respiratory chain, whereas
these inhibitors (75.6 ␮M antimycin A and 10 ␮M rotenone; Sigma-Aldrich Co., St. Louis, MO) were required
to measure peroxisomal oleate oxidation. The difference
between total oxidation and peroxisomal oxidation was
considered to be mitochondrial oxidation. All assays
were performed in triplicate. Oleate oxidation rates
were expressed as nanomoles per minute per gram of
fresh muscle.
Oxidative Enzyme Activities
Frozen muscle (about 0.2 g) was homogenized in 50
vol (wt/vol) of ice-chilled 0.1 M phosphate buffer (pH
7.5) containing 2 mM EDTA and sonicated. After centrifugation at 1,700 × g for 15 min at 4°C, the supernatant fraction (soluble enzymes and mitochondrial material) was collected and used for further analyses. The
maximal activities of mitochondria oxidative markers,
reflecting either fatty acid beta-oxidation (β-hydroxyacyl-CoA dehydrogenase; HAD) or mitochondrial density
(citrate synthase; CS) were determined according to
the methods described by Bass et al. (1969) and Srere
(1969), respectively. Enzyme activities were assessed at
30°C using an automatic spectrophotometric analyzer
(Cobas Mira, Roche, Basel, Switzerland) and expressed
as micromoles of degraded substrate per minute per
gram of fresh muscle.
Real-Time Reverse Transcription-PCR
Expression of genes involved in fatty acid transport
(FABP), lipogenesis (sterol-regulatory element binding
protein; SREBP-1), terminal esterification (DGAT1),
fatty acid oxidation [carnitine-palmitoyl-transferase 1
(CPT-1); peroxisome proliferator-activated receptor
delta (PPARδ)], or energy expenditure (uncoupling proteins; UCP) were investigated by real-time quantitative reverse transcription-PCR (ABI PRISM 7000 SDS
thermal cycler; Applied Biosystems, Foster City, CA).
Total RNA was extracted from frozen samples according to the method of Chomczynski and Sacchi
(1987). Primers were designed using the Primer Express software (Applied Biosystems) based on Sus
scrofa sequences (Table 2). Complementary DNA was
synthesized from 2 ␮g of total DNAse-treated RNA in
40 ␮L of reaction buffer using random primers and
murine Moloney leukemia virus reverse transcription,
according to the manufacturer’s instructions (Applied
Biosystems). Forty cycles of amplification were performed in 25 ␮L of PCR buffer (SYBRGreen I PCR
core reagents, Applied Biosystems) with 5 ␮L of diluted
(4:100) first-strand cDNA reaction and 0.3 ␮M forward
and reverse primers (except 0.5 ␮M for SREBP-1). Uracil DNA glycosylase (1 U/100 ␮L; Invitrogen, Cergy Pontoise, France) was used to prevent any contamination
from previous PCR. Amplification product specificity
1086
Damon et al.
Table 2. Forward and reverse primers used in PCR reactions
Forward primer
Reverse primer
Tm,2
°C
GenBank
accession no.
CACTGTCTGGGCAAACCAAA
AGGGTCCCCGAGCCTTCT
CGACTCCGTCAAGCAGCTCTA
GCACTTACGAGAAAGAGGCATGA
GGAAAGTCAAGAGCACCATAACCT
AATCCGCATGAAGCTGGAGT
GCCCTTCAAGGACATGGACTA
CGGACGGCTCACAATGC
GCCACCTGGTAGGAACTCTCAAT
CAGCTGCTCATAGGTGACAAACA
CCAAAATCCGGGTGGTGAT
GCTGAGTCCAGGAGTAGCCAATT
ATTCCACCACCAACTTATCATCTACTATTT
GCACTTGTTGCGGTTCTTCT
CAGGAGTGGAAGAGCCAGTAGA
GCAAGACGGCGGATTTATTC
60
59
59
60
60
57
60
59
AF284832
AY739703
NM_214049
AJ416019
AJ416020
NM_011145
AY116586
AF102873
Gene1
CPT1 β
UCP2
UCP3
FABP-3
FABP-4
PPARδ
DGAT1
SREBP-1
1
CPT1β = carnitine palmitoyl tranferase 1β; UCP2 = uncoupling protein 2; UCP3 = uncoupling protein 3; FABP3 = fatty acid binding
protein-3; FABP4 = fatty acid binding protein-4; PPARδ = peroxysome proliferators-activated receptorδ; DGAT1 = diacyl-glycerol acyltransferase
1; SREBP-1: sterol regulatory element binding protein-1.
2
Tm = melting temperature.
was checked by dissociation curve analyses. Assuming
that efficiencies of the target genes and 18S are the
same, the amount of a specific target, normalized to an
endogenous reference and relative to a calibrator (i.e.,
one sample from the low i.m. fat group) was calculated
with the following formula (Pfaffl, 2001):
ratio = 2−⌬⌬CT,
where ⌬⌬CT = (CTgene − CT18S)sample − (CTgene −
CT18S)calibrator.
The proportions of each MyHC mRNA for slow-twitch
type I and fast-twitch types IIa, IIx, and IIb muscle
fibers were determined by reverse transcription-PCR
using the TaqMan system (Applied Biosystems) as previously described (Lefaucheur et al., 2004). Briefly,
cDNA were synthesized using a MyHC-specific primer
common to all MyHC. Then, the real-time PCR was
performed on the polymorphic actin-binding site corresponding to loop 2 (Chikuni et al., 2001). Importantly,
the forward and reverse primers were identical for all
4 MyHC, thus avoiding any difference in primer annealing efficiencies between MyHC isoforms. The detection
of each MyHC was based on 4 specific TaqMan minor
groove binder probes labeled with 6-carboxyfluoroscein.
For a given sample, the 4 MyHC were measured separately in triplicate within the same plate. Results are
expressed as the relative percentage of each MyHC.
Western Blotting
Western blot analyses were performed on the wholemuscle cytosolic fraction (Laemmli, 1970; Towbin et al.,
1979). Proteins (15 ␮g) were diluted in Laemmli loading
buffer, separated by electrophoresis on a 15% polyacrylamide/0.1% SDS gel for 45 min at 200 V and then electrotransferred onto a poly(vinylidene difluoride) membrane (Amersham Biosciences, Piscataway, NJ) for 1 h
at 100 V. The membrane was blocked with PBS-Tween
20 (5% vol/vol) supplemented with 5% nonfat dry milk
and incubated for 1 h with porcine antiFABP-3 (1/
20,000) or rat antiFABP-4 (1/10,000) polyclonal antibodies, kindly provided by J. H. Veerkamp (Department
of Biochemistry, University of Nijmegen, The Netherlands). Horseradish peroxidase-coupled antirabbit IgG
was used as the secondary antibody (1/100,000). Immunodetection was performed with the ECL Plus Western
Blot detection kit (Amersham Biosciences), and the
membranes were scanned on a Storm phosphorimager
(Molecular Dynamics, Sunnyvale, CA). Signals were
quantified using ImageQuant software (Molecular Dynamics). Membranes were stained with Ponceau working solution (Sigma-Aldrich) to check for good protein
transfer and equivalent loading.
Statistical Analyses
The SAS software (SAS Inst. Inc., Cary, NC) was
used for all statistical evaluations. Data were analyzed
by one-way ANOVA for the main effect of i.m. fat groups
(HF vs. LF). The effect of slaughter day was removed
from the final model because it did not significantly
influence any of the characteristics studied. Differences
between means of the HF and LF groups were considered significant at P < 0.05. A probability value <0.10
was discussed as a trend. Overall Pearson correlation
coefficients were calculated between i.m. fat content
and FABP-4 or FABP-3 expression levels. We also assessed the correlation between FABP-4 content and adipocyte number. Finally, stepwise regression analysis
was performed using each MyHC percentage as the
dependent variable and the other muscle characteristics as the independent variables. Only variables reaching the 0.15 significance level were retained for entry
into the model.
RESULTS
Growth Performance and Carcass Traits
The HF and LF pigs had similar final BW and age
at slaughter (Table 3). Plasma insulin concentrations
were similar in both groups, whereas plasma IGF-I
concentrations tended (P = 0.06) to be lower in HF pigs
than in LF pigs. Carcass composition differed between
groups; HF pigs exhibited greater backfat thickness
1087
Indicators of muscle fat content in pigs
Table 3. Growth and carcass traits at slaughter for i.m. fat groups1
Item
Final live weight, kg
Final age, d
Hormonal status at slaughter
Insulin concentration, ␮IU/mL
IGF-I concentration, ng/mL
Carcass traits
HCW, kg
Mean backfat depth, mm
Backfat proportion,3 %
Loin proportion,3 %
Ham proportion,3 %
HF
LF
SEM
P-value2
105.8
154
107.5
151
7.4
5
0.70
0.32
6.6
151
7.4
204
2.4
43
0.58
0.06
83.1
19.9
10.4
32
24.4
83
17.2
8.6
33.3
25.4
6.1
1.7
1.4
1
1
0.98
0.02
0.04
0.05
0.10
1
Pigs exhibited a high (HF, n = 6) or a low (LF, n = 6) LM lipid content at slaughter.
Level of significance for the effect of i.m. fat group.
3
Weight percentage of the left side of the carcass.
2
(+16%, P = 0.02), greater backfat proportion (+21%, P =
0.04), and a slightly lower proportion of loin (−4%, P =
0.05) than LF pigs.
Muscle Lipid Content
Total lipid content in LM at slaughter was 70%
greater (P < 0.001) in HF pigs than in LF pigs (Table
4). This increase was parallel to a greater number of
i.m. adipocytes/cm2 (+127%, P = 0.005) and a tendency
for enlarged adipocytes (+13%, P = 0.057) in HF pigs
compared with LF pigs. Considering adipocyte as a
sphere, this led to a 49% difference in adipocyte volume
between HF and LF pigs (P = 0.072). Positive correla-
tions were also found between LM fat content at slaughter and adipocyte number (R2 = 0.73, P < 0.001) and
adipocyte diameter (R2 = 0.47, P = 0.013). Sudan Black
positive fibers accounted for 17% of the total analyzed
muscle fibers in both LF and HF groups.
Muscle Lipogenic Capacities
The activities of lipogenic enzymes (ACC, MEZ, and
G6PDH), and mRNA levels of genes coding for key metabolic factors involved in the control of lipogenesis
(SREBP1) and esterification (DGAT1) did not differ between the 2 groups (P > 0.35; Table 4).
Table 4. Adipocyte cellularity, fatty acid binding protein expression, and lipogenic capacities of the LM at slaughter for i.m. fat groups1
Variable
Total lipid content, %
Adipocyte cellularity
Number, per cm2
Diameter, ␮m
Sudan Black positive myofibers, %
FABP expression
FABP-3 mRNA3
FABP-4 mRNA3
FABP-3 protein (arbitrary units)
FABP-4 protein (arbitrary units)
Lipogenic enzyme activities4
ACC
MEZ
G6PDH
Gene expression3
SREBP-1
DGAT1
1
HF
LF
SEM
P-value2
3.4
2.0
0.5
<0.001
662
48.3
16.9
291
42.7
17.4
165
4.5
3.5
0.005
0.057
0.836
2.05
2.49
16.3
8.94
0.7
235
53.7
0.84
0.85
1.44
1.52
13.9
4.69
0.7
277
50.83
0.97
0.97
1.39
2.30
6.77
3.31
0.2
77
32
0.16
0.40
0.461
0.485
0.558
0.050
0.927
0.351
0.754
0.590
0.620
Pigs exhibited a high (HF, n = 6) or a low (LF, n = 6) LM lipid content at slaughter.
Level of significance for the effect of i.m. fat group.
Levels of mRNA (arbitrary units) for fatty acid binding protein-3 (FABP-3) and -4 (FABP-4), sterolregulatory element binding protein (SREBP-1), and diacylglycerol acyltransferase (DGAT1) were normalized
to the level of 18S ribosomal RNA in the same sample.
4
Activities for acetyl-CoA carboxylase (ACC), malic enzyme (MEZ), and glucose-6-phosphate dehydrogenase
(G6PDH) were expressed as nanomoles per minute per gram of fresh muscle.
2
3
1088
Damon et al.
Intracellular Fatty Acid Transport
Both FABP-3 mRNA expression (P = 0.46) and protein content (P = 0.56) were similar in HF and LF pigs
(Table 4). In contrast, we observed a 2-fold greater (P =
0.05) FABP-4 content in HF pigs than in LF pigs and
no difference at the mRNA level (P = 0.49, Table 4). A
significant positive correlation was also found between
FABP-4 protein content and i.m. adipocyte number/
cm2 (R2 = 0.47, P = 0.02, Figure 1A). The correlation
coefficient between FABP-4 protein content and i.m. fat
percentage at slaughter reached 0.58 (P = 0.004, Figure
1B). A stronger correlation between FABP-4 content
and i.m. fat level (R2 = 0.78, n = 18, P < 0.001) has been
achieved in another experiment with Large White ×
Duroc backcross pigs (data not shown). This relationship was not observed at the FABP-4 mRNA level.
There was no significant relationship at P = 0.05 between LM i.m. fat content and FABP-3 mRNA or protein levels.
Muscle Energetic and Contractile Properties
Activities of HAD and CS and mitochondrial oleate
oxidation rates were similar in both groups (Table 5).
The level of mRNA from key genes involved in the control of lipid oxidation process (CPT-1, PPARδ), mitochondrial uncoupling (UCP2, UCP3) and MyHC polymorphism did not differ between groups. Stepwise regression analysis revealed that only FABP-3 predicted
MyHC 1 and 2b proportions at P = 0.15. The FABP-3
protein content was positively (R2 = 0.47, P = 0.01) and
negatively (R2 = 0.57, P = 0.004) correlated with MyHC
1 and 2b mRNA proportion, respectively (Figure 2). No
relationship was found with the other 2 MyHC.
DISCUSSION
The cellular and metabolic mechanisms underlying
phenotypic differences in i.m. fat content have not been
clearly elucidated yet. Differences in i.m. fat content
are mainly related to triacylglycerol fraction with >80%
stored in adipocytes interspersed in the perimysium
and <20% located within myofiber cytoplasm and especially slow-twitch oxidative type I (Essen-Gustavsson et
al., 1994; Gondret et al., 1998). Therefore, many muscle
intrinsic pathways in both i.m. adipocytes and myofibers could contribute an explanation of the variability
of i.m. fat content, such as the balance between lipid
anabolic and catabolic pathways, intracellular trafficking of fatty acids supported by FABP, and myofiber
energetic metabolism in relation to muscle contraction.
However, the current study did not show any relationship between i.m. fat content and whole-muscle lipogenic capacity, FABP-3 expression, MyHC proportions,
or various traits related to fatty acid oxidation. Recently, decreased i.m. fat content has been related to
overexpression of UCP3 in transgenic mice (Bezaire et
al., 2005). Because UCP are thought to play a role in
Figure 1. Relationships between fatty acid binding protein-4 (FABP-4) content and i.m. adipocyte number of the
LM at slaughter [panel A; 䊐 = low fat (LF) and 䊏 = high
fat (HF); n = 6] and i.m. fat content of the LM at slaughter
(panel B; 䊐 = LF; 䊏 = HF; n = 12). AU = arbitrary units;
*P < 0.05; **P < 0.01.
fatty acid handling to facilitate oxidation in muscle (Samec et al., 1998), the absence of variation of UCP2 and
UCP3 expressions between HF and LF pigs could be
due to the lack of differences observed on oxidative
metabolic variables such as enzymatic activities (CS
and HAD), mitochondrial and peroxisomal oxidation
rates of oleate, and mRNA levels of CPT-1 and PPARδ.
The fact that the amount of i.m. fat is not related to fiber
1089
Indicators of muscle fat content in pigs
Table 5. Oxidative metabolism and myosin heavy chain (MyHC) mRNA profile of the
LM at slaughter for i.m. fat groups1
Variable
Oxidative metabolism
HAD3
CS3
Oleate mitochondrial oxidation4
Oleate peroxisomal β-oxidation4
Gene expression5
CPT-1β
UCP3
UCP2
PPARδ
MyHC mRNA, %
I
IIa
IIx
IIb
HF
LF
SEM
P-value2
3.7
5.7
13.2
2.7
3.6
5.8
11.4
1.9
0.6
0.9
1.3
0.3
0.70
0.92
0.51
0.12
0.39
0.57
0.82
0.39
0.98
0.84
0.92
0.73
6.9
2.4
6.2
9.3
0.95
0.78
0.49
0.73
1.21
1.02
1.57
1.07
19
8
22.3
50.7
1.21
1.09
1.53
1.15
19.3
8.4
19.7
52.6
1
Pigs exhibited a high (HF, n = 6) or a low (LF, n = 6) LM lipid content at slaughter.
Level of significance for the effect of i.m. fat group.
3
Activities of β-hydroxyacyl-CoA dehydrogenase (HAD) and citrate synthase (CS) were expressed as
micromoles per minute per gram of fresh muscle.
4
Expressed as nanomoles per minute per gram of fresh muscle.
5
Levels of mRNA (arbitrary units) for carnitine-palmitoyl-transferase-1 (CPT-1), uncoupling protein 3
(UCP3), uncoupling protein 2 (UCP2), and peroxysome proliferators-activated receptor delta (PPARδ) were
normalized to the level of 18S rRNA in the same sample.
2
type composition per se is in accordance with previous
observations (Leseigneur-Meynier and Gandemer,
1991; Larzul et al., 1997). Interestingly, the proportion
of slow-twitch type I MyHC mRNA (19%) was greater
than previously reported in pure Large White pigs (Lefaucheur et al., 2004), which could be explained by the
greater percentage of type I fibers encountered in Duroc
than in Large White pigs (Fazarinc et al., 1995). Because a permissive action of FABP-3 in delivering fatty
acid to mitochondrial oxidation has been shown in various models (Glatz et al., 2003; Haunerland and Spener,
2004), our results, which show a positive relationship
between the proportion of MyHC 1 and FABP-3 protein
level, are consistent with the fact that slow-twitch type
I fibers are more oxidative and use more lipids as fuel
substrate than other fiber types. The lack of any difference among groups in FABP-3 does not support QTL
analyses, suggesting FAPB-3 as a candidate gene for
i.m. fat deposition in Duroc pigs (Gerbens et al., 1998,
1999). Altogether, the present results strongly suggest
that the primary mechanisms involved in the regulation of i.m. fat content are not related to fiber type
composition and energy catabolism, but would rather
reside within the i.m. adipocytes themselves in relation
to their environment.
The most striking histological difference between LF
and HF groups in the current study is the greater number of i.m. adipocytes in the LM of HF than LF pigs with
less difference in adipocyte size. Moreover, stepwise
regression analysis asserts that differences in i.m. fat
content are mostly explained by variation in adipocyte
number because no other variable reached the P = 0.05
significance level for entry into the model. These conclu-
sions are also supported by our observations in rhomboideus red muscle, where adipocyte number was increased by 76% in HF pigs without any significant variation of adipocyte diameter (data not shown). Because
lipogenesis in LM, assessed as de novo lipogenic enzymes activity and expression of genes involved in the
control of lipogenesis (SREBP-1) and triglycerides storage (DGAT1), remained similar in both groups, it is
likely that differences between HF and LF pigs in lipid
content mainly involved differences in duration of adipocyte hyperplasia.
The lack of difference in DGAT1 mRNA level between
groups was quite surprising, because QTL analyses
have previously underlined DGAT1 as a candidate gene
for i.m. fat deposition in pigs (Nonneman and Rohrer,
2002) and cattle (Thaller et al., 2003). In addition,
Roorda et al. (2005) further indicated that overexpression of DGAT1 protein in muscle using DNA electroporation was able to induce intramyocellular triglyceride
storage in rat. Posttranscriptional events could first
explain the discrepancies between these studies and
our data. However, because DGAT1 is expressed in both
myocytes (75% of the muscle volume) and adipocytes, it
is also possible that basal mRNA level in the myofibers
might have masked an induction in i.m. adipocytes.
Interestingly, positive correlation coefficients were
found in the current study between FABP-4 level and
both adipocyte number and i.m. fat content, whereas
correlations with the other variables acquired in this
study were not significant. Moore et al. (1991) first suggested that the correlation observed between FABP activity and marbling score in beef muscle could be due
to interfascicular adipocyte FABP. More recently, a pos-
1090
Damon et al.
Figure 2. Relationships between fatty acid binding protein-3 (FABP-3) content and myosin heavy-chain (MyHC)
mRNA proportions of the LM at slaughter. Relative proportion of MyHC type I (panel A; n = 12) and relative
proportion of MyHC type IIb (panel B ; n = 12). AU =
arbitrary units; **P ≤ 0.01.
itive association between i.m. fat content and FABP-4
gene polymorphism (Gerbens et al., 1998, 1999) or
FABP-4 gene expression (Wang et al., 2005) has been
shown in both Duroc pigs and different bovine breeds.
However, Gerbens et al. (2001) failed to find this relationship between i.m. fat content and FABP-4 expression in crossbred Large White × Dutch Landrace pigs.
Therefore, it is possible that only pure Duroc (Gerbens
et al., 1999) or crossbred Duroc pigs (current study)
have the correct allele in segregation. Fatty acid binding protein-4 is known as a late marker of adipogenesis
(Spiegelman et al., 1983), and its ectopic expression
could also induce a transdifferentiation of existing myoblasts or satellite cells to an adipogenic cell type (Taylor-Jones et al., 2002). However, whether FABP-4 was
involved as a primary cause or a consequence of i.m.
adipogenesis remains to be elucidated. Alternatively,
an interaction between FABP-4 activity and lipolysis
intensity cannot be excluded and has been proposed by
others. Indeed, Coe et al. (1999) reported an impairment of lipolysis in adipocytes of FABP-4 null mice.
Moreover, Shen et al. (1999) suggested that absence
of interaction between FABP-4 and hormone sensitive
lipase (HSL) led to feedback inhibition of HSL by fatty
acids. Therefore, in the current study, a mutation of
the FABP-4 gene in HF pigs might have prevented an
interaction between FABP-4 and HSL, impairing lipolysis that could lead to a metabolic balance favoring fat
accumulation in HF pigs. However, further investigation combining determination of HSL activity, FABP4 genotyping, and in vitro protein-protein interaction
are required to validate this hypothesis. However, the
lack of any relationship between FABP-4 protein and
mRNA level suggests a posttranscriptional regulation,
which would be consistent with such a protein-protein
interaction mechanism.
Finally, in addition to difference in i.m. fat content,
HF pigs also exhibited fatter carcasses than LF ones.
This is consistent with most studies showing a positive
genetic correlation (+0.3 on average; Sellier, 1998) between i.m. fat content and fat proportion in the carcass
of pigs. However, the Duroc breed has been reported to
exhibit a greater i.m. fat content at the same backfat
thickness (Wood et al., 2004). In the present experiment, the lower plasma IGF-I concentration of HF pigs
compared with LF pigs could at least partly explain
increased carcass fatness in the former. Indeed, circulating IGF-I mainly reflects growth hormone action in
ad libitum fed animals, which is known to induce a
dramatic decrease in the fat mass by lowering insulin
action on glucose transport and lipogenesis (Louveau
and Bonneau, 2001). Moreover, in Duroc pigs, a positive
correlation has been found between i.m. fat content and
serum IGF-I concentrations at 8 wk of age but not at
slaughter age (Suzuki et al., 2004). Thus, more work is
necessary to explain the greater subcutaneous fat depot
in HF pigs than in LF pigs through the somatotropic
axis and lipid turnover.
The present findings suggest that both the number
of adipocytes interspersed between myofiber fasciculi
and the level of FABP-4 may be valuable markers of
i.m. fat accretion. The absence of any relationship between i.m. fat level and whole-muscle energetic and
contractile properties suggests that i.m. fat content and
myofiber type composition can be manipulated independently.
LITERATURE CITED
Bass, A., D. Brdiczka, P. Eyer, S. Hofer, and D. Pette. 1969. Metabolic
differentiation of distinct muscle types at the level of enzymatic
organization. Eur. J. Biochem. 10:198–206.
Bazin, R., and P. Ferré. 2001. Assays of lipogenic enzymes. Methods
Mol. Biol. 155:121–127.
Bezaire, V., L. L. Spriet, S. Campbell, N. Sabet, M. Gerrits, A. Bonen,
and M. E. Harper. 2005. Constitutive UCP3 overexpression at
physiological levels increases mouse skeletal muscle capacity
for fatty acid transport and oxidation. FASEB J. 19:977–979.
Indicators of muscle fat content in pigs
Chang, H. C., I. Seidman, G. Teebor, and D. M. Lane. 1967. Liver
acetyl-CoA-carboxylase and fatty acid synthetase: Relative activities in the normal state and in hereditary obesity. Biochem.
Biophys. Res. Commun. 28:682–686.
Chikuni, K., R. Tanabe, S. Muroya, and I. Nakajima. 2001. Differences in molecular structure among the porcine myosin heavy
chain-2a,-2x, and-2b isoforms. Meat Sci. 57:311–317.
Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA
isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159.
Coe, N. R., M. A. Simpson, and D. A. Bernlohr. 1999. Targeted disruption of the adipocyte lipid-binding protein (aP2 protein) gene
impairs fat cell lipolysis and increases cellular fatty acid levels.
J. Lipid Res. 40:967–972.
de Koning, D. J., L. L. Janss, A. P. Rattink, P. A. van Oers, B. J. de
Vries, M. A. Groenen, J. J. van der Poel, P. N. de Groot, E. W.
Brascamp, and J. A. van Arendonk. 1999. Detection of quantitative trait loci for backfat thickness and intramuscular fat content
in pigs (Sus scrofa). Genetics 152:1679–1690.
Dubowitz, V. 1985. In Muscle Biopsy. A Practical Approach. W. B.
Saunders, ed. Balliere Tindall, London, UK.
Essen-Gustavsson, B., A. Karlsson, K. Lundström, and A. C. Enfält.
1994. Intramuscular fat and muscle fibre lipid contents in halothane-gene-free pigs fed high or low protein diets and its relation
to meat quality. Meat Sci. 38:269–277.
Fazarinc, G., M. Ursic, and S. V. Bavdek. 1995. Histochemical profile
of the longissimus dorsi muscle of the pig breeds with different
porcine stress syndrome (PSS) susceptibility. Pages 107–112 in
6th Zavrnik Memorial Mtg., Lipica, Slovenia.
Fernandez, X., G. Monin, A. Talmant, J. Mourot, and B. Lebret.
1999. Influence of intramuscular fat content on the quality of
pig meat—1. Composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. Meat Sci. 53:59–65.
Folch, J., M. Lee, and G. H. Sloane Stanley. 1957. A simple method
for the isolation and purification of total lipids from animal
tissues. J. Biol. Chem. 226:497–509.
Gerbens, F., A. Jansen, A. J. M. Van Erp, F. Harders, T. H. E. Meuwissen, G. Rettenberger, J. H. Veerkamp, and M. F. W. Te Pas. 1998.
The adipocyte fatty acid-binding protein locus: Characterization
and association with intramuscular fat content in pigs. Mamm.
Genome 9:1022–1026.
Gerbens, F., A. Jansen, A. J. M. Van Erp, F. Harders, F. J. Verburg,
T. H. E. Meuwissen, J. H. Veerkamp, and M. F. W. Te Pas. 1999.
Effect of genetic variants of the heart fatty acid-binding protein
gene on intramuscular fat and performance traits in pigs. J.
Anim. Sci. 77:846–852.
Gerbens, F., F. J. Verburg, H. T. B. Van Moerkerk, B. Engel, W.
Buist, J. H. Veerkamp, and M. F. W. Te Pas. 2001. Associations
of heart and adipocyte fatty acid binding protein gene expression
with intramuscular fat content in pigs. J. Anim. Sci. 79:347–354.
Glatz, J. F., F. G. Schaap, B. Binas, A. Bonen, G. J. van der Vusse,
and J. J. Luiken. 2003. Cytoplasmic fatty acid-binding protein
facilitates fatty acid utilization by skeletal muscle. Acta Physiol.
Scand. 178:367–371.
Gondret, F., and B. Lebret. 2002. Feeding intensity and dietary protein level affect adipocyte cellularity and lipogenic capacity of
muscle homogenates in growing pigs, without modification of
the expression of sterol regulatory element binding protein. J.
Anim. Sci. 80:3184–3193.
Gondret, F., J. Mourot, and M. Bonneau. 1998. Comparison of intramuscular adipose tissue cellularity in muscles differing in their
lipid content and fibre type composition during rabbit growth.
Livest. Prod. Sci. 54:1–10.
Gondret, F., J. F. Hocquette, and P. Herpin. 2004. Age-related relationships between muscle fat content and metabolic traits in
growing rabbits. Reprod. Nutr. Dev. 44:1–16.
Haunerland, N. H., and F. Spener. 2004. Fatty acid-binding proteins—Insights from genetic manipulations. Prog. Lipid Res.
43:328–349.
Herpin, P., A. Vincent, M. Fillaut, B. Piteira Bonito, and J. F. Hocquette. 2003. Mitochondrial and peroxisomal fatty acid oxidation
1091
capacities increase in the skeletal muscles of young pigs during
early postnatal development but are not affected by cold stress.
Reprod. Nutr. Dev. 43:155–166.
Hovenier, R., E. Kanis, Th. van Asseldonk, and N. G. Westerink. 1992.
Genetic parameters of pig meat quality traits in a halothane
negative population. Livest. Prod. Sci. 32:309–321.
Janss, L. L. G., J. A. M. van Arendonk, and E. W. Brascamp. 1997.
Bayesian statistical analyses for presence of single genes affecting meat quality traits in a crossbred pig population. Genetics
145:395–408.
Kelley, D. E., and B. H. Goodpaster. 2001. Skeletal muscle triglyceride. An aspect of regional adiposity and insulin resistance. Diabetes Care 24:933–941.
Laemmli, U. K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227:680–685.
Larzul, C., L. Lefaucheur, P. Ecolan, J. Gogué, A. Talmant, P. Sellier,
P. Leroy, and G. Monin. 1997. Phenotypic and genetic parameters for longissimus muscle fiber characteristics in relation to
growth, carcass and meat quality traits in Large White pigs. J.
Anim. Sci. 75:3126–3137.
Lefaucheur, L., D. Milan, P. Ecolan, and C. Le Callennec. 2004. Myosin heavy chain composition of different skeletal muscles in
Large White and Meishan pigs. J. Anim. Sci. 82:1931–1941.
Leseigneur-Meynier, A., and G. Gandemer. 1991. Lipid composition
of pork muscle in relation to the metabolic type of the fibers.
Meat Sci. 29:229–241.
Louveau, I., and M. Bonneau. 1996. Effect of a growth hormone
infusion on plasma insulin-like growth factor-I in Meishan and
Large White pigs. Reprod. Nutr. Dev. 36:301–310.
Louveau, I., and M. Bonneau. 2001. Biology and actions of somatotropin in the pig. Pages 111–131 in Biotechnology in Animal
Husbandry. R. Renaville and A. Burny, ed. Kluwer Academic
Publishers, The Netherlands.
Malenfant, P., A. Tremblay, E. Doucet, P. Imbeault, J. A. Simoneau,
and D. R. Joanisse. 2001. Elevated intramyocellular lipid concentration in obese subjects is not reduced after diet and exercise
training. Am. J. Physiol. Endocrinol. Metab. 280:E632–E639.
Moore, K. K., P. A. Ekeren, D. K. Lunt, and S. B. Smith. 1991.
Relationship between fatty acid-binding protein activity and
marbling scores in bovine longissimus muscle. J. Anim. Sci.
69:1515–1521.
Mourot, J. and M. Kouba. 1998. Lipogenic enzyme activities in muscles of growing Large White and Meishan pigs. Livest. Prod. Sci.
5:127–133.
Nonneman, D., and G. A. Rohrer. 2002. Linkage mapping of porcine
DGAT1 to a region of chromosome 4 that contains QTL for growth
and fatness. Anim. Genet. 33:472–473.
Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45.
Prunier, A., C. Martin, A. M. Mounier, and M. Bonneau. 1993. Metabolic and endocrine changes associated with undernutrition in
the peripubertal gilt. J. Anim. Sci. 71:1887–1894.
Roorda, B. D., M. K. Hesselink, G. Schaart, E. Moonen-Kornips, P.
Martinez-Martinez, M. Losen, M. H. De Baets, R. P. Mensink,
and P. Schrauwen. 2005. DGAT1 overexpression in muscle by
in vivo DNA electroporation increases intramyocellular lipid
content. J. Lipid Res. 46:230–236.
Samec, S., J. Seydoux, and A. G. Dulloo. 1998. Role of UCP homologues in skeletal muscles and brown adipose tissue: Mediators
of thermogenesis or regulators of lipids as fuel substrate? FASEB
J. 12:715–724.
Sanchez, M. P., P. Le Roy, H. Griffon, J. C. Caritez, X. Fernandez,
C. Legault, and G. Gandemer. 2002. Déterminisme génétique
de la teneur en lipides intramusculaires dans une population
F2 Duroc × Large White. Journées Rech. Porcine 34:39–43.
Sellier, P. 1998. Genetics of meat and carcass traits. Page 463 in The
Genetics of the Pig. M. F. Rotschild and A. Ruvinsky, ed. CAB
International, Wallingford, UK.
Shen, W. J., K. Sridhar, D. A. Bernlohr, and F. B. Kraemer. 1999.
Interaction of rat hormone-sensitive lipase with adipocyte lipidbinding protein. Proc. Natl. Acad. Sci. USA 96:5528–5532.
1092
Damon et al.
Spiegelman, B. M., M. Frank, and H. Green. 1983. Molecular cloning
of mRNA from 3T3 adipocytes. Regulation of mRNA content
for glycerophosphate dehydrogenase and other differentiationdependent proteins during adipocyte development. J. Biol.
Chem. 258:10083–10089.
Srere, P. A. 1969. Citrate synthase. Page 3 in Methods in Enzymology.
No. 13. Acad. Press, New York.
Suzuki, K., M. Nakagawa, K. Katoh, H. Kadowaki, T. Shibata, H.
Uchida, Y. Obara, and A. Nishida. 2004. Genetic correlation
between serum insulin-like growth factor-1 concentration and
performance and meat quality traits in Duroc pigs. J. Anim. Sci.
82:994–999.
Talmant, A., X. Fernanadez, P. Sellier, and G. Monin. 1989. Pages
1129–1131 in Proc. 35th Int. Congr. Meat Sci. Technol., Copenhagen, Denmark.
Taylor-Jones, J. M., R. E. McGehee, T. A. Rando, B. Lecka-Czernik,
D. A. Lipschitz, and C. A. Peterson. 2002. Activation of an adipo-
genic program in adult myoblasts with age. Mech. Ageing Dev.
123:649–661.
Thaller, G., C. Kuhn, A. Winter, G. Ewald, O. Bellmann, J. Wegner,
H. Zuhlke, and R. Fries. 2003. DGAT1, a new positional and
functional candidate gene for intramuscular fat deposition in
cattle. Anim. Genet. 34:354–357.
Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets:
Procedure and some applications. Proc. Natl. Acad. Sci. USA
76:4350–4354.
Wang, Y. H., K. A. Byrne, A. Reverter, G. S. Harper, M. Taniguchi,
S. M. McWilliam, H. Mannen, K. Oyama, and S. A. Lehnert.
2005. Transcriptional profiling of skeletal muscle tissue from
two breeds of cattle. Mamm. Genome 16:201–210.
Wood, J. D., G. R. Nute, R. I. Richardson, F. M. Whittington, O.
Southwood, G. Plastow, R. Mansbridge, N. da Costa, and K. C.
Chang. 2004. Effects of breed, diet and muscle on fat deposition
and eating quality in pigs. Meat Sci. 67:651–667.