Download Disruption of somitogenesis by a novel dominant allele of Lfng

© 2016. Published by The Company of Biologists Ltd | Development (2016) 143, 822-830 doi:10.1242/dev.128538
RESEARCH ARTICLE
Disruption of somitogenesis by a novel dominant allele of Lfng
suggests important roles for protein processing and secretion
ABSTRACT
Vertebrate somitogenesis is regulated by a segmentation clock.
Clock-linked genes exhibit cyclic expression, with a periodicity
matching the rate of somite production. In mice, lunatic fringe (Lfng)
expression oscillates, and LFNG protein contributes to periodic
repression of Notch signaling. We hypothesized that rapid LFNG
turnover could be regulated by protein processing and secretion.
Here, we describe a novel Lfng allele (LfngRLFNG), replacing the
N-terminal sequences of LFNG, which allow for protein processing
and secretion, with the N-terminus of radical fringe (a Golgi-resident
protein). This allele is predicted to prevent protein secretion without
altering the activity of LFNG, thus increasing the intracellular half-life
of the protein. This allele causes dominant skeletal and somite
abnormalities that are distinct from those seen in Lfng loss-of-function
embryos. Expression of clock-linked genes is perturbed and mature
Hes7 transcripts are stabilized in the presomitic mesoderm of mutant
mice, suggesting that both transcriptional and post-transcriptional
regulation of clock components are perturbed by RLFNG expression.
Contrasting phenotypes in the segmentation clock and somite
patterning of mutant mice suggest that LFNG protein may have
context-dependent effects on Notch activity.
KEY WORDS: Lunatic fringe, Somitogenesis, Segmentation clock,
Notch, Post-transcriptional regulation, Mouse
INTRODUCTION
During somitogenesis, somites bud from the presomitic mesoderm
(PSM) and give rise to the axial skeleton and other adult structures.
In the PSM, several genes exhibit oscillatory expression, with a
cyclic period that matches the rate of somite formation, linking them
to the segmentation clock. Many of these genes are members of the
Notch pathway, although genes in the FGF and WNT pathways also
exhibit cyclic expression (reviewed by Kageyama et al., 2012).
Notch activity levels in the PSM also oscillate (Morimoto et al.,
2005; Shifley et al., 2008), and in mouse and chicken this requires
periodic repression of Notch signaling by lunatic fringe (Lfng),
which functions in a delayed negative-feedback loop with the
transcriptional repressor Hes7 to regulate cyclic Notch activation in
the clock (Bessho et al., 2003; Kageyama et al., 2012).
In mouse and chick embryos, cyclic Lfng transcription and
oscillation of LFNG protein levels have been observed, linking
cyclic LFNG activity to the clock in the posterior PSM (Cole et al.,
2002; Dale et al., 2003; Morales et al., 2002). The short period of
these oscillations predicts that post-translational mechanisms must
1
The Department of Molecular Genetics, The Ohio State University, Columbus,
2
OH 43210, USA. Department of Biological Sciences, Northern Kentucky
University, Highland Heights, KY 41099, USA.
*Author for correspondence ([email protected])
Received 8 September 2015; Accepted 14 January 2016
822
exist to enforce a short LFNG protein half-life, allowing rapid
protein turnover during the ‘off’ phases of the clock cycle.
Supporting this idea, it has been shown that either loss of Lfng
activity (Evrard et al., 1998; Zhang and Gridley, 1998) or sustained,
non-oscillatory Lfng expression in the PSM (Serth et al., 2003)
perturbs embryonic segmentation and clock function. Lfng is also
expressed in the anterior PSM, in the rostral compartment of
patterning presomites (Cole et al., 2002), although most data
suggest that its most important roles in segmentation are in the clock
(Oginuma et al., 2010; Williams et al., 2014).
Lfng encodes a glycosyltransferase (O-fucosylpeptide 3-beta-Nacetylglucosaminyltransferase) that modifies Notch and its ligands in
the Golgi, modulating ligand-receptor interactions (Moloney et al.,
2000; Panin et al., 2002; Serth et al., 2015). Interestingly, the effects
of LFNG protein on Notch signaling are context dependent. In most
systems, LFNG acts in the signal-receiving cell, where it potentiates
the activation of Notch receptors by Delta-like ligands while reducing
signaling by Jagged ligands (Hicks et al., 2000; Kato et al., 2010;
Yang et al., 2005). However, in the clock it has been suggested that
LFNG protein may act in the signal-sending cell to inhibit activation
of NOTCH1 by DLL1, playing a crucial role in the synchronization of
clock oscillations between neighboring cells (Okubo et al., 2012).
In most cases, the described functions of LFNG in the Notch
pathway are cell-autonomous (Hicks et al., 2000; Moloney et al.,
2000; Munro and Freeman, 2000; Okubo et al., 2012; Panin et al.,
1997). However, both Drosophila Fringe and LFNG are cleaved by
furin-like proteases and secreted into the extracellular space (Johnston
et al., 1997; Shifley and Cole, 2008), where they may be inactive.
Accelerating the secretion of Drosophila Fringe creates a
hypomorphic allele, supporting the idea that protein processing and
secretion limit its cell-autonomous activity (Munro and Freeman,
2000). We hypothesized that processing and secretion of LFNG
terminates its intracellular activity, facilitating the rapid turnover
required for its function in the segmentation clock, and rapidly
clearing the protein from the posterior compartments of presomites in
the anterior PSM. This would represent a novel post-translational
mechanism for the spatial and temporal regulation of Notch
signaling, allowing rapid and reversible modulation of Notch activity.
To examine this hypothesis, we previously analyzed a chimeric
fusion of the active domain of LFNG to the N-terminal sequences of
radical fringe (RFNG), which is a Golgi-resident fringe protein.
When this mutant protein was expressed in tissue culture cells under
the control of an exogenous promoter, we found that the protein was
targeted to the Golgi and maintained the enzymatic activity of
LFNG (Shifley and Cole, 2008). However, unlike wild-type LFNG
protein, the chimeric protein was not secreted from tissue culture
cells even when strongly overexpressed. Furthermore, the
intracellular half-life of the chimeric protein was twice as long as
that of wild-type LFNG (Shifley and Cole, 2008). Here, we generate
mice expressing this Golgi-resident RFNG/LFNG chimeric variant
(RLFNG) from the endogenous Lfng locus by replacing the
DEVELOPMENT
Dustin R. Williams1, Emily T. Shifley1,2, Kara M. Braunreiter1 and Susan E. Cole1, *
N-terminal sequences of LFNG, which contain the protein
processing sites, with the N-terminus of RFNG. Based on our
previous findings in tissue culture, this alteration is predicted to
prevent protein processing and secretion, while maintaining the
enzymatic activity and specificity of LFNG.
We observe severe segmentation defects in heterozygous mutant
mice that express RLFNG protein, and these are distinct from those
observed in animals lacking LFNG activity. These outcomes are
consistent with the hypothesis that altering protein processing/
secretion creates a hypermorphic RLFNG protein by preventing its
rapid turnover in the Golgi. Clock-related phenotypes suggest that
Notch activity levels are decreased in the posterior PSM of mutant
embryos. By contrast, somite phenotypes in mutant mice are
suggestive of expanded Notch signaling during rostral/caudal
patterning of somites. These findings support the idea that LFNG
protein may have context-dependent effects on Notch signaling in
different tissue compartments. Finally, we observe that this
mutation affects the transcript stability of another clock
component, Hes7, suggesting that there may be links between
normal clock function and the post-transcriptional regulation of
crucial clock components.
RESULTS
Expression of RLFNG protein perturbs segmentation
We previously described a chimeric RFNG/LFNG protein
(RLFNG) that is localized to the Golgi, tethered in the cell,
Development (2016) 143, 822-830 doi:10.1242/dev.128538
maintains the enzymatic activity of endogenous LFNG, but has a
longer intracellular half-life than the wild-type LFNG protein
(Shifley and Cole, 2008). We expressed RLFNG in vivo by
replacing exon 1 of the endogenous Lfng locus with a new exon
containing sequences encoding the N-terminus and type II
transmembrane domain of RFNG fused to LFNG at the first
conserved amino acid of the proteins (Fig. 1A, Fig. S1). Based on
our results in tissue culture, we predict that the resulting allele,
LfngRLFNG, encodes a protein with the enzymatic activity of LFNG
but which is not secreted. This allele does not alter the promoter or
enhancer regions, transcription start site, UTRs, or splice sites of
Lfng, and thus the mutation is not predicted to have direct effects on
Lfng gene expression. If LFNG secretion from wild-type cells acts to
inactivate LFNG protein activity in the clock, and the mouse allele
prevents this secretion as was seen in tissue culture, we predict that
this allele will inhibit inactivation of the LFNG intracellular activity.
This would result in a functionally hypermorphic RLFNG protein
that is retained and active in the Golgi longer than the wild-type
protein. Owing to its longer intracellular half-life, RLFNG would
not be cleared from cells during the brief ‘off’ phase of the clock.
Persistent LFNG activity would then be expected to perturb the
clock feedback loop, actively interfering with normal clock
function and somitogenesis. We predicted that this allele would
be associated with dominant phenotypes, as wild-type LFNG
protein cannot compensate for the inappropriate perdurance of the
RLFNG protein.
Fig. 1. Skeletal abnormalities in mice expressing
RLFNG protein. (A) The endogenous Lfng locus was
targeted to replace the Lfng pre/pro region and 28 amino
acids of the mature region (gray boxes and rectangle)
with the signal sequence and 21 amino acids of the
mature domain (striped box and rectangle) of RFNG (full
targeting plan provided in Fig. S1). A Southern blot of
targeted colonies with a 3′ flanking probe (arrow indicates
endogenous band, arrowhead indicates targeted band) is
shown. (B) Heterozygous mice (right) are viable but have
a shortened body axis and truncated tail. (C) Skeletons of
17.5 dpc wild-type (a-c; n=10), Lfng null (d-f; n=9) and
LfngRLFNG/+(g-i; n=12) embryos stained with Alizarin Red
and Alcian Blue. LfngRLFNG/+ mice have more severe rib
fusions (arrow in g) and more severe neural arch fusions
(asterisk in g and i) than those observed in Lfng null mice.
In the sacral region, Lfng null mice have one to four
relatively normal vertebrae (arrowheads in f ), in contrast
to LfngRLFNG/+ animals, which have disorganized sacral
regions, ectopic ossifications (arrow in i) and arch fusions
(asterisk in i).
DEVELOPMENT
RESEARCH ARTICLE
823
Indeed, heterozygous (LfngRLFNG/+) mice are viable and fertile,
but exhibit skeletal abnormalities, with a shortened body axis and
truncated tail, outwardly similar to Lfng null animals (Fig. 1B).
However, the phenotypes observed in LfngRLFNG/+ mice are distinct
from those described in Lfng null mutants, as expected for a gain-offunction mutation. In the anterior skeleton, LfngRLFNG/+ animals
exhibit increased fusions of dorsal ribs and neural arches compared
with Lfng null animals (Fig. 1C, compare d,e with g,h). The sacral
region is severely affected in LfngRLFNG/+ animals, with neural arch
fusions and disorganized and ectopic ossification centers. This is in
contrast to Lfng null embryos, which form one to four sacral
condensations with relatively normal neural arch morphology
(Fig. 1C, compare f with i). Thus, the expression of a chimeric
protein that is expected to prevent LFNG secretion creates a
dominant gain-of-function allele that perturbs skeletal development
more severely than the complete loss of LFNG function.
Endogenous Lfng transcription is reduced in LfngRLFNG/+
embryos
In the clock, LFNG functions in a feedback loop with NOTCH1 and
Hes7, and thus changes in LFNG protein turnover are predicted to
act through this loop to affect the expression of Lfng in the posterior
PSM. However, Lfng expression in the anterior PSM is driven by
distinct regulatory elements that may be independent of these
feedback loops (Cole et al., 2002). To examine the effects of the
Development (2016) 143, 822-830 doi:10.1242/dev.128538
RLFNG protein on Lfng expression, we examined LfngRLFNG/+
embryos at 10.5 days post coitum (dpc) and observed expression of
Lfng mRNA in a weak stripe in the anterior PSM, with no
expression of Lfng mRNA in the posterior PSM (Fig. 2Aa-d). Lfng
expression in the posterior PSM was examined more closely in
8.5 dpc mutant embryos, where background staining is less
noticeable and thus lower levels of expression can be reliably
detected. After a 6-h incubation in detection solution, cyclic Lfng
expression was clearly visible in wild-type embryos, but only a faint
band in the anterior PSM was seen in LfngRLFNG/+ embryos
(Fig. 2Ae-g). However, after a 48-h incubation in detection solution,
Lfng expression was observed throughout the posterior PSM of
LfngRLFNG/+ embryos (Fig. 2Ah). This expression is not overtly
oscillatory, although the low expression levels make it difficult to
exclude the possibility of dynamic transcription. However, dynamic
expression in the caudal PSM of wild-type embryos was evident
after this prolonged detection (Fig. S2A), suggesting that the lack of
overt cycling in LfngRLFNG/+ embryos is unlikely to be an artifact of
the long detection. qRT-PCR on RNA from individual caudal PSM
confirms that LfngRLFNG/+ embryos express relatively constant low
levels of Lfng transcript comparable to the lowest levels of Lfng
expression observed in wild-type embryos (Fig. S2B). Standard
PCR and qRT-PCR using allele-specific primers confirms that both
the mutant and wild-type alleles are expressed to similar levels in
mutant embryos (Fig. S2C).
Fig. 2. Lfng expression and Notch activation are perturbed in LfngRLFNG/+ embryos. (A) Lfng expression in 10.5 dpc wild-type embryos oscillates (a-c;
n=4/13 phase 1, 5/13 phase 2, 4/13 phase 3), but is reduced in the posterior PSM of LfngRLFNG/+ embryos (d; n=10). At 8.5 dpc cyclic Lfng expression is observed
in wild-type embryos after 6 h of detection (e,f; n=4/10 phase 1, 6/10 phase 2), but Lfng expression in the posterior PSM of LfngRLFNG/+ embryos is not observed
(g; n=7). After 48 h of detection, low levels of Lfng are seen in the posterior PSM of LfngRLFNG/+ embryos (h; n=4). (B) Immunohistochemistry for NICD
demonstrates reduced Notch activity in the posterior PSM of LfngRLFNG/+ embryos (d; n=9) compared with wild-type embryos (a-c; n=3/12 phase 1, 6/12 phase 2,
3/12 phase 3). Long exposures at 8.5 dpc reveal low levels of NICD in the caudal PSM of mutant embryos (g; n=6), but cyclic NICD expression in wild-type
embryos (e,f; n=4). Longer exposures of 9.0 dpc embryos reveal that NICD is confined to the caudal compartments of the presomites (arrows) and mature somites
(asterisks) in wild-type embryos (h; n=4), whereas in LfngRLFNG/+ embryos (i; n=4) a broad band of NICD is seen in the anterior PSM (arrow), with low levels
throughout the mature somites (line). In h and i the images focus on the anterior PSM and the most recently formed somites. (C) Nrarp expression is reduced in the
PSM of LfngRLFNG/+ embryos (d; n=9) compared with wild-type embryos (a-c; n=4/11 phase 1, 3/11 phase 2, 4/11 phase 3). (D) There are no dramatic differences
in the expression of Notch1 (a,b) and Dll1 (c,d) between wild-type (a, n=3; c, n=5) and LfngRLFNG/+ (b, n=3; d, n=4) embryos. For oscillatory genes, the distributions
of expression patterns were significantly different between wild-type and mutant embryos by Fisher’s exact analysis (P<0.01).
824
DEVELOPMENT
RESEARCH ARTICLE
Development (2016) 143, 822-830 doi:10.1242/dev.128538
The LfngRLFNG allele contains endogenous transcriptional
regulation sequences that are, in principle, sufficient to drive
expression of the RLFNG protein in a wild-type pattern. However,
our results suggest that the RLFNG protein expressed from the
mutant allele perturbs the feedback loop that controls Lfng
transcription, leading to altered clock function and secondary
effects on Lfng transcription in the posterior PSM. Importantly, this
reduction in Lfng transcripts is unlikely to be the direct cause of the
phenotypes observed in our mutant mice, as phenotypes associated
with the LfngRLFNG allele are dominant, and do not recapitulate the
Lfng loss-of-function phenotypes. Instead, our results support the
hypothesis that this low level of transcript produces sufficient
stabilized RLFNG protein to continuously perturb clock function.
RLFNG expression perturbs cyclic activity in the Notch
pathway
In the segmentation clock, LFNG protein has been proposed to
inhibit Notch activation (Okubo et al., 2012). However, in the
anterior PSM, Lfng expression is confined to the future rostral
somite compartment, whereas Notch is activated in the future caudal
compartment (Morimoto et al., 2005). To examine the effect of the
LfngRLFNG allele on Notch signaling in the PSM, we examined
NOTCH1 activation by whole-mount immunohistochemistry with
an antibody specific to cleaved NOTCH1 [Notch intracellular
domain (NICD)]. In wild-type embryos, NICD levels oscillate in the
posterior PSM, and are stable in a stripe in the anterior PSM, as
previously described (Morimoto et al., 2005; Shifley et al., 2008).
At identical detection times, NICD is seen only in a stripe in the
anterior PSM of LfngRLFNG/+ embryos (Fig. 2Ba-d). After longer
detection we observe low levels of NICD in the posterior PSM of
LfngRLFNG/+ embryos (Fig. 2Bg), which are not overtly oscillatory,
as well as a broad band of NICD in the anterior PSM and low levels
of ubiquitous NICD in the somitic paraxial mesoderm. This is in
contrast to the defined stripes of NICD observed in the caudal
compartments of presomites in the anterior PSM and epithelial
somites of wild-type embryos (Fig. 2Bh,i).
This pattern of Notch activity is confirmed by the expression of
Nrarp, a direct Notch target in the PSM (Dequeant et al., 2006;
Wright et al., 2009), which is severely reduced in the posterior PSM
of all LfngRLFNG/+ embryos examined, with expression restricted to
an anterior stripe (Fig. 2Ca-d). These phenotypes are different from
those observed in Lfng null embryos, which exhibit stable NICD
levels throughout the PSM (Morimoto et al., 2005; Shifley et al.,
2008). Notch1 and Dll1 RNA expression are similar in wild-type and
mutant mice (Fig. 2D), so the reduction in Notch activity observed in
the posterior PSM is unlikely to be secondary to reduced expression
of other Notch pathway components. The finding of distinct Notch
pathway phenotypes in LfngRLFNG/+ embryos and Lfng null embryos
supports the idea that LfngRLFNG is not a loss-of-function allele.
Further, the different effects on Notch activity in the anterior and
posterior PSM raise the intriguing possibility that RLFNG protein
activity has context-dependent effects on Notch signaling.
Somitic structures are caudalized in Lfng
RLFNG/+
embryos
As suggested by the skeletal defects observed in LfngRLFNG/+ mice,
we find that somitogenesis is disrupted in LfngRLFNG/+ embryos. At
10.5 dpc, borders between somites are absent or incomplete
(Fig. 3Aa-d). LfngRLFNG/+ embryos produce myotome-like
structures in the trunk, although these are fused and disorganized
(Fig. 3Ae,f ). Thus, expression of the RLFNG protein perturbs
proper border formation and the production of epithelial somites
during somitogenesis.
The skeletal phenotypes of LfngRLFNG/+ mice suggest that they
exhibit somite patterning defects distinct from those observed in
Lfng null embryos. Mesp2 expression, marking the presumptive
rostral somite compartment in the anterior PSM (Saga et al., 1997),
is expressed (although at slightly reduced levels) in LfngRLFNG/+
embryos, suggesting that rostral identity is initially specified in the
PSM (Fig. 3Ba-c). However, Tbx18, which marks the mature rostral
somite compartment, is severely downregulated in LfngRLFNG/+
embryos (Fig. 3Bd-f ), whereas the expression of a caudal somite
marker, Uncx, is expanded in LfngRLFNG/+embryos (Fig. 3Bg-i).
This suggests that mature somitic structures are caudalized in
LfngRLFNG/+ embryos, in contrast to Lfng null embryos, which, as
previously reported (Oginuma et al., 2010), exhibit a pattern of
intermingled rostral and caudal cells (Fig. 3Be,h). In the trunk
regions of LfngRLFNG/+ embryos, dermomyotomal (Fig. 3Ca-c) and
sclerotomal (Fig. 3Cd-i) derivatives are observed, although these are
irregular and exhibit bifurcations and fusions, similar to those
observed in Lfng null embryos. The finding that the dominant
RLFNG-related patterning defects are distinct from those observed
in Lfng null embryos again supports the idea that the LfngRLFNG
mutation acts through a gain-of-function.
Hes7 transcription and transcript stability are affected in
LfngRLFNG/+ embryos
To examine the effects of the LfngRLFNG allele on clock function, we
examined Hes7 expression in LfngRLFNG/+ embryos. Using a cDNA
probe that detects processed, mature Hes7 mRNA, we observe that
Hes7 mRNA levels oscillate in the PSM of wild-type embryos,
whereas in LfngRLFNG/+ embryos we observe ubiquitous expression
of Hes7 mRNA in the posterior PSM (Fig. 4Aa-d). To distinguish
transcriptional and post-transcriptional effects on Hes7 expression
in LfngRLFNG/+ embryos we examined Hes7 expression using an
intron-specific probe, allowing specific detection of newly
transcribed Hes7 RNAs that have not yet undergone splicing.
Oscillatory transcription of Hes7 was observed in wild-type
embryos, but the levels of newly transcribed Hes7 RNA in
LfngRLFNG/+ embryos were significantly reduced and were
restricted to the posterior PSM in all embryos examined
(Fig. 4Ae-h).
The restriction of Hes7 transcription to the most caudal PSM in
LfngRLFNG/+ embryos is consistent with the effects of reduced Notch
activity on Hes7 (Niwa et al., 2007), and thus might reflect the
reductions in NICD we observe in the posterior PSM of mutant
embryos. However, our data also suggest a secondary effect on Hes7
mRNA stability or turnover, such that the Hes7 transcripts produced
when cells are in the tailbud are stable enough to persist as cells
progress into the anterior PSM, producing the observed stable
gradient of mature Hes7 transcript in the PSM (Fig. 4B). This
finding suggests the existence of previously unappreciated links
between clock function and the post-transcriptional regulation of
clock components.
Other clock-linked genes are affected in LfngRLFNG/+ embryos
In mouse embryos, targets of the FGF and WNT pathways have
been observed to oscillate in the PSM (Dequeant et al., 2006;
Wright et al., 2009), and it is clear that both FGF and WNT
signaling are important for normal clock function (Aulehla and
Pourquie, 2010). To determine whether RLFNG expression
perturbs clock-linked genes in other pathways, we examined the
expression patterns of Axin2, Spry2 and Snai1. In wild-type
embryos, we observe oscillatory expression of Spry2; however, in
all LfngRLFNG/+ embryos, stable Spry2 expression was observed
825
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
Development (2016) 143, 822-830 doi:10.1242/dev.128538
throughout the PSM (Fig. 5A-C). Axin2 oscillations are evident in
wild-type embryos, but we observed that Axin2 expression in
LfngRLFNG/+ embryos was limited to an anterior stripe and faint
staining in the posterior tailbud (Fig. 5D-F). Finally, whereas
oscillatory Snai1 expression was observed in wild-type embryos,
Snai1 was expressed stably in the posterior PSM in all LfngRLFNG/+
embryos (Fig. 5G-I). Thus, the disruption of clock activity in
LfngRLFNG/+ embryos prevents the normal cyclic expression of both
WNT and FGF pathway members in the PSM.
DISCUSSION
We hypothesized that secretion of LFNG from the cell provides an
essential level of post-translational control in the PSM, facilitating
rapid clearance of LFNG protein from cells after Lfng transcription
is downregulated. This clearance could be important both in the
clock, where LFNG protein levels oscillate to synchronize
neighboring cells, and in somite patterning, where LFNG protein
is rapidly cleared from the presumptive caudal somite compartment.
To test this model, we introduced a novel mutation into the
endogenous Lfng locus, replacing the N-terminal LFNG domain
with sequences encoding the signal sequence and type II
transmembrane domain of RFNG, creating a fusion protein called
RLFNG. Previously published work demonstrates that, in tissue
culture, this fusion protein is localized to the Golgi, is not secreted,
and has the enzymatic function of LFNG. Thus, we predict that
826
in vivo this allele will reduce or prevent protein processing and
secretion, producing a Golgi-resident protein with the enzymatic
activity of LFNG, under control of the endogenous Lfng regulatory
regions. The LfngRLFNG allele in mice is associated with dominant
phenotypes that are distinct from those observed in mice with loss
of Lfng function, consistent with our hypothesis that LFNG
processing/secretion act to terminate the function of LFNG in the
cell, and that the prevention of this post-translational control will
produce a hypermorphic protein.
Overall, our data are consistent with a model in which RLFNG
protein is not secreted during the ‘off’ phase of the clock cycle, but
is stably maintained in cells after transcription ceases. This would
replicate the protein behavior previously observed in tissue culture,
where RLFNG protein was localized to the Golgi and not secreted
into the medium (Shifley and Cole, 2008). Unfortunately, we have
been unable to detect LFNG protein in mutant embryos and thus we
cannot provide formal proof that the RLFNG protein in embryos is
localized to the Golgi and that its levels do not oscillate. We have not
identified anti-LFNG antibodies of sufficient quality to detect either
wild-type LFNG or RLFNG protein in embryos, preventing direct
comparison of their cellular localization or levels in vivo. Others
have reported that when wild-type tagged LFNG proteins are
ubiquitously overexpressed in the PSM they perturb somitogenesis,
even though the LFNG protein expressed from these transgenes is
not detectable (Serth et al., 2003, 2015); thus, it is not unreasonable
DEVELOPMENT
Fig. 3. Somite formation and patterning are
perturbed in LfngRLFNG/+ embryos. (A) At
10.5 dpc, wild-type embryos (a,c,e; n=10) form
regular epithelial somites and myotomes.
LfngRLFNG/+ embryos exhibit morphological
segmentation defects (b; n=10), and epithelial
somites are not observed in LfngRLFNG/+ sections
(d; n=3). LfngRLFNG/+ embryos form myotome-like
structures, but these are fused and disorganized
(asterisks in f; n=3). (B) At 10.5 dpc, Mesp2
expression is slightly downregulated and diffuse in
LfngRLFNG/+ embryos (c; n=5) as compared with
wild-type embryos (a; n=5), but similar to that in
Lfng null embryos (b; n=5). In mature somites,
Tbx18 expression is severely reduced in
LfngRLFNG/+ embryos (compare d with f; n=6 each),
whereas Uncx is expressed throughout the mature
somite region (compare g with i; n=6 each),
suggesting the somites are caudalized. At this
stage, Lfng null embryos exhibit poorly
compartmentalized expression of both Uncx (h;
n=4) and Tbx18 (e; n=4). (C) Trunk regions of
10.0 dpc embryos stained for Myog (a-c; n=3 each)
and Uncx (d-f; n=5 each) show that LfngRLFNG/+
(c,f ) and Lfng null (b,e) embryos produce somitic
derivatives, although these are irregular, exhibiting
fusions and bifurcations (arrows), and
disorganization in the posterior trunk (lines in e,f ).
Pax1 expression in the sclerotome is less
metameric in the lumbar region of LfngRLFNG/+
embryos (line in i; n=4) than Lfng null embryos (line
in h; n=4). Embryos have been bisected for
visualization with anterior at the top, and the
forelimb bud (asterisk) maintained.
RESEARCH ARTICLE
Development (2016) 143, 822-830 doi:10.1242/dev.128538
Fig. 4. Hes7 expression is perturbed and transcripts are stabilized in
LfngRLFNG/+ embryos. (A) Mature Hes7 mRNA transcripts are observed
throughout the PSM of LfngRLFNG/+ embryos (d; n=8), whereas levels cycle in
wild-type embryos (a-c; n=4/11 phase 1, 3/11 phase 2, 4/11 phase 3).
However, nascent Hes7 transcripts, revealed by an intron-specific probe, are
reduced in the PSM of LfngRLFNG/+ embryos (h; n=7), whereas they are cyclic in
wild-type embryos (e-g; n=2/8 phase 1, 2/8 phase 2, 4/8 phase 3). The
distributions of Hes7 expression patterns were significantly different between
wild-type and mutant embryos by Fisher’s exact analysis (P<0.02). (B) Our
observations suggest that in mutant embryos Hes7 transcription (orange) is
confined to the caudal PSM, but stabilized mature transcripts persist as cells
move anterior in the PSM (green).
Fig. 5. Clock-linked gene expression is perturbed in LfngRLFNG/+
embryos. Spry2 expression oscillates in wild-type embryos at 10.5 dpc (A,B;
n=8/18 phase 1, 10/18 phase 2), but is slightly reduced and non-cyclic in
LfngRLFNG/+ embryos (C; n=9/9). Axin2 expression oscillates in wild-type
embryos at 10.5 dpc (D,E; n=5/11 phase 1, 6/11 phase 2), but is reduced in
LfngRLFNG/+ embryos (F; n=8/8). Snai1 expression oscillates in wild-type
embryos at 10.5 dpc (G,H; n=6/10 phase 1, 4/10 phase 2), but is noncyclic in
LfngRLFNG/+ embryos (I; n=5/5). White bars delineate regions of staining. The
distributions of expression patterns were significantly different between
wild-type and mutant embryos by Fisher’s exact analysis (P<0.02).
Our data suggest that Rlfng expression has context-dependent
effects on Notch activation. The reduction of NICD in the posterior
PSM of mutant embryos is consistent with the idea that LFNG
represses NOTCH1 activation in the clock, and that expression of
RLFNG protein results in ubiquitous (but not complete) inhibition
of Notch activity in this region. However, activation of NOTCH1 in
the anterior PSM of LfngRLFNG/+ embryos is not as severely
inhibited by RLFNG, appearing as a broad band that is not refined
into the caudal somite compartment seen in wild-type embryos
(Fig. 2Bh,i). The phenotypes of mutant embryos support the idea
that Notch signaling is affected in different ways, with clock
phenotypes suggestive of reduced Notch activity, and pattering
phenotypes suggestive of expanded or ectopic Notch activity.
In the clock, LFNG has been proposed to act in the signal-sending
cell to inhibit Notch activation through an unknown mechanism that
is enhanced by co-expression of DLL3 (Okubo et al., 2012). We
suggest that expression of the mutant allele produces RLFNG
protein that is tethered in the Golgi, perturbing normal clock
function by altering the coordinated, cyclic activation of Notch in
the PSM and dysregulating the feedback loops that regulate this
activation (Fig. 6B). In this model, RLFNG activity in posterior
PSM cells would work with DLL3 to inhibit activation of NOTCH1
by DLL1 in neighboring cells. This reduction in Notch activity
would in turn affect the transcription of Hes7, Lfng, and other clocklinked genes. The segmentation clock phenotypes observed in
LfngRLFNG mice represent the steady-state expression of clock genes
827
DEVELOPMENT
that RLFNG protein could be expressed at levels sufficient to
disrupt segmentation without being detectable by current reagents.
Despite this caveat, our previous description of the RLFNG
protein (Shifley and Cole, 2008) and the dominant nature of the
phenotypes observed here provide strong support for the idea that
the LfngRLFNG allele represents a gain-of-function mutation. If the
mutation interfered with protein folding or activity then we would
predict that it would phenocopy an Lfng loss-of-function and be
recessive. By contrast, we observe dominant phenotypes in
heterozygous animals that do not recapitulate the Lfng null
phenotypes, and contrast with the completely normal phenotypes
observed in Lfng +/− animals (Evrard et al., 1998; Zhang and
Gridley, 1998). We cannot formally rule out the idea that the
RLFNG protein is mistargeted in the cell or that our phenotypes
arise from excessive glycosylation of its targets; however, even if
these mechanisms do contribute to the observed phenotypes, this
would support the idea that post-translational regulation of LFNG
protein activity is important.
As predicted by our model, we observe that the feedback loops
that govern the clock result in reduced transcription of the
endogenous Lfng and Rlfng locus in mutant embryos. We predict
that this low level of Rlfng transcript produces RLFNG protein,
which is more stable than wild-type LFNG, and thus we propose
that RLFNG protein is found throughout the PSM of LfngRLFNG/+
embryos (Fig. 6A). We cannot formally exclude the possibility that
the LfngRLFNG allele might have some effect on transcript stability,
which could exacerbate the reduced RNA expression we observe.
There is no evidence that the transcript regions altered in our mutant
mice harbor any RNA stability signals, and the Lfng 3′UTR, which
we and others have suggested influences transcript stability (Chen
et al., 2005; Nitanda et al., 2014; Riley et al., 2013), is intact in the
LfngRLFNG allele. Further, our qRT-PCR analyses indicate that both
alleles are expressed to similar levels in heterozygous embryos, and
reductions in transcript stability could not explain the dominant
nature of the phenotypes.
RESEARCH ARTICLE
Development (2016) 143, 822-830 doi:10.1242/dev.128538
subsequent to the loss of clock synchrony. The LfngRLFNG mutant
embryos described here exhibit a dramatic reduction in the level of
NOTCH1 activation and in the transcription of Notch targets such as
Hes7 and Nrarp. The crosstalk mechanisms that coordinate Notch,
WNT and FGF oscillations in the clock are complex, and further
work will be necessary to fully understand how RLFNG protein
affects other clock activities. However, these results support our
initial hypothesis that secretion of LFNG from the cell acts to
terminate its activity in the segmentation clock.
In contrast to the effects in the posterior PSM, in the anterior PSM
and mature somites the phenotypes observed in LfngRLFNG/+
embryos are suggestive of increased or expanded Notch
activation, with loss of rostral markers and expansion of caudal
markers (Fig. 3). Dorsal rib tissues arise from the caudal somite
(Aoyama and Asamoto, 2000); thus, the somite caudalization
observed in LfngRLFNG/+ embryos is consistent with the severe
dorsal rib fusions observed in adult mutant animals (Fig. 1), which
are similar to those seen in Tbx18 mutant mice or mice with a
hypomorphic Mesp2 allele (Bussen et al., 2004; NomuraKitabayashi et al., 2002). Taken together, these phenotypes
828
resemble those seen when ligand-independent NICD was
overexpressed in the PSM (Feller et al., 2008) or when Notch
activity is exogenously activated in the rostral somite (Sasaki et al.,
2011) or derepressed in the rostral somite due to loss of Mesp2
(Takahashi et al., 2013). Thus, these phenotypes suggest that the
protein expressed from the LfngRLFNG allele potentiates or expands
the regions of NOTCH1 activation in the presomites of mutant mice.
The resulting expansion of Notch target genes would be predicted to
caudalize somitic structures.
In the anterior PSM of wild-type embryos, DLL1 is upregulated
in the presumptive caudal compartment and DLL3 is confined to the
presumptive rostral compartment, where it is co-expressed with
wild-type LFNG. Notch activation (visualized via NICD) is
apparent in stripes in the anterior PSM and in the caudal
compartments of mature somites. In LfngRLFNG mutant embryos,
we observe a single broad band of NICD in the anterior PSM, and
low but ubiquitous levels of NICD in the mature somitic region
(Fig. 2B). The mechanism(s) that perturb Notch activation in the
anterior PSM of LfngRLFNG embryos are not clear, but our data are
consistent with the idea that, in LfngRLFNG/+ embryos, RLFNG
DEVELOPMENT
Fig. 6. A model of perturbed Notch signaling in
LfngRLFNG mutant embryos. (A) In wild-type PSM
(left), both Lfng mRNA (top) and LFNG protein (bottom)
oscillate in the posterior PSM and are stably expressed
in the anterior PSM in caudal presomites. In LfngRLFNG/+
embryos (right), low levels of mRNA expression in the
caudal PSM and stable expression in the anterior PSM
result in stable RLFNG protein perduring throughout the
PSM. (B) In the caudal PSM of LfngRLFNG/+ embryos
(right), low levels of Rlfng mRNA give rise to a stable
RLFNG protein, which, in the presence of DLL3,
constitutively represses NOTCH1, resulting in
decreased transcription of Hes7 and Lfng. In addition,
increased LFNG activity inhibits Hes7 mRNA turnover
through an unknown mechanism. (C) In the patterning
region of the anterior PSM, LFNG protein in wild-type
embryos (left) is rapidly cleared from the future caudal
compartment, although Lfng transcription in the rostral
compartment is maintained. Notch signaling defines the
caudal somite compartment, while in the future rostral
compartment MESP2 reduces Notch signaling by
destabilizing Mastermind-like proteins. In LfngRLFNG/+
embryos (right), RLFNG protein is not cleared from the
future caudal compartment and may perdure into
mature somites. In the absence of DLL3, which is
downregulated in this region, LFNG may now potentiate
interactions between DLL1 and NOTCH1, increasing
the levels or extent of NOTCH1 activity and caudalizing
future somites by upregulating as yet unidentified Notch
target genes. Since early expression of Mesp2 relies on
Notch activity, the low levels of overall Notch signaling
may contribute to reduced expression of Mesp2, which
may further reduce the specification of the rostral
compartment, enhancing the caudalization phenotype.
RESEARCH ARTICLE
PSM of LfngRLFNG/+ embryos. This represents the first mouse
mutation known to affect Hes7 mRNA turnover, although mutations
that affect RNA stability have been observed for Hes homologs in
Xenopus and zebrafish (Davis et al., 2001; Dill and Amacher, 2005).
Thus, these findings suggest that the rapid turnover of Hes7 RNA in
the mouse PSM may be regulated by an unknown mechanism that is
linked to the segmentation clock or to the Notch signaling pathway.
Further analysis of the mice reported here might shed light on this
important question.
MATERIALS AND METHODS
Targeted mutation and genotyping
Lfng sequences from the NotI-AatII sites in exon 1 were replaced with the
RFNG N-terminus amplified with primers (5′-3′) ATGCGGCCGGCGGCCACCATGAGCCGTGCGCGGCGG and GGTTCTTCCGAGTGGTCTTG, replacing the LFNG pre/pro region with the signal sequence of RFNG
fused at LFNG D113. The 5′ arm contains a floxed Neo-testis Cre cassette,
which is excised upon passage through the male germline (Bunting et al.,
1999). LfngRLFNG mice were genotyped with primers SC286 (TTGGGTCTATCTGGGAAACG) and SC287 (GCGACTCATCCAGACACAGA)
producing a 149 bp wild-type band and a 250 bp mutant band. Lfng tmRjo1
(Lfng null) mice were genotyped as described (Shifley et al., 2008). Mice
were maintained on a mixed 129/Sv×FVB/J background in an specificpathogen-free facility under the care of OSU Laboratory Animal Resources.
All protocols were approved by the OSU IACUC.
Skeletal preparations and histology
Embryos were harvested at 17.5 dpc. Alcian Blue/Alizarin Red staining was
performed as described (McLeod, 1980). For histology, embryos were fixed
in Bouin’s fixative, processed for paraffin sections, and stained with
Hematoxylin and Eosin.
Whole-mount RNA in situ hybridization and
immunohistochemistry analysis
Embryos were collected from timed pregnancies (noon of day of plug
detection is 0.5 dpc) and fixed in paraformaldehyde. Hybridization with
digoxigenin-labeled probes was performed as described ( probes are listed in
Table S1). Whole-mount immunohistochemistry to detect NICD (Cell
Signaling 4147, 1:500; Table S1) was performed as previously described
(Shifley et al., 2008).
RT-PCR
The posterior PSM of individual 10.5 dpc embryos was collected in cold
PBS. Endogenous Lfng RNA levels were assessed using gene-specific
TaqMan assays (Applied Biosystems Mm00456128_m1*). Lfng values were
normalized to Gapdh, and the highest level of wild-type expression was set to
100 for comparison across embryos. For allele-specific RT-PCR, cDNA was
produced from individual embryos (SuperScript III, Invitrogen).
Amplification of Lfng alleles was performed with primers SC1019 (CTGGCTGTGTTGCTGCTACT), SC-1020 (CCCATCAGTGAAGATGAACG)
and SC1021 (GATCCCGGAGTCCTCACC) producing a 237-bp
LfngRLFNG-specific band and a 267 bp wild-type-specific band. In
conventional PCR, all three Lfng primers were included, and PCRs were
run for 35 cycles to obtain robust signals for both wild-type and mutant
embryo samples. For qRT-PCR, levels of Lfng or Rlfng were assessed using
an Applied Biosystems StepOne Plus machine and SYBR Select Master Mix.
Hprt was amplified using primers AGCTACTGTAATGATCAGTCAACG
and AGAGGTCCTTTTCACCAGCA. Absolute quantification was
performed using standard curves of linearized plasmids, followed by
normalization to Hprt.
Statistical analyses
For oscillatory expression
compare the distributions
phases between wild-type
mutant expression pattern
patterns, Fisher’s exact analyses were used to
of expression patterns among the oscillatory
and mutant embryos. Generally, the invariant
was assigned to the oscillation phase it most
829
DEVELOPMENT
protein would be more stable than wild-type LFNG and thus would
persist in the caudal presomite or mature somite after Rlfng gene
expression is downregulated. This is in contrast to wild-type LFNG
protein, which would be rapidly cleared out of these structures,
presumably by SPC6 (also known as PCSK5), which we have
shown can process LFNG protein and is highly expressed in the
anterior PSM (Shifley and Cole, 2008).
In the absence of DLL3, this residual RLFNG protein in the
presumptive caudal somite compartment could potentiate activation
of NOTCH1 by DLL1, as has been shown in other systems (Hicks
et al., 2000; Kato et al., 2010; Yang et al., 2005) (Fig. 6C), promoting
the caudalized phenotypes that we observe. This expansion of Notch
activity could be increased by the observed reduction of Mesp2 in
mutant embryos, as MESP2 protein in wild-type embryos directly
reduces Notch activity in the future rostral compartment by
destabilizing Mastermind-like protein (Sasaki et al., 2011). Finally,
we predict that RLFNG protein will persist in the mature somite
region where wild-type Lfng is not expressed, and it is not known
what effects it might have there. We have previously shown that
SPC6, which can cleave LFNG, is highly expressed in the rostral
component of somite S–1, which might suggest that clearance of
LFNG protein from this region is important (Shifley et al., 2008). A
conditionally activatable LfngRLFNG allele or an allele targeting
RLFNG to the anterior PSM might help address these questions in the
future. It is difficult to ascribe specific aspects of the skeletal
phenotype to perturbations in clock function as opposed to alterations
in somite patterning, as loss of clock function may influence
patterning defects. However, the somite caudalization and the loss of
metameric Pax1 expression observed in LfngRLFNG/+ embryos are
similar to the outcomes observed when inappropriate Notch
activation is driven in the rostral somite compartment (Sasaki et al.,
2011; Takahashi et al., 2013); thus, we suggest that some of the
observed phenotypes are related to altered patterning.
It is not clear what, if any, role secreted LFNG plays during
somitogenesis. Mathematical models suggesting that secreted
LFNG functions in synchronizing the segmentation clock have
been proposed (Cinquin, 2003), but the phenotypes reported here
are unlikely to be caused solely by a loss of LFNG secretion.
LfngRLFNG/+ mice retain a wild-type copy of Lfng that could produce
the secreted form, although at low levels due to the observed
reductions in Lfng transcripts. Further, the skeletal and patterning
phenotypes, as well as the effects on NICD levels, in LfngRLFNG/+
mice are distinct from those observed in Lfng null mice,
providing little support for the idea that the phenotypes observed
in LfngRLFNG/+ mice are due to any loss of LFNG activity. The
finding that the LfngRLFNG allele does not phenocopy the effects of
loss of LFNG, together with the dominant nature of these
phenotypes, support the idea that at least some of the phenotypes
observed in our mutant mice are the consequence of a perturbation
of an intracellular function of LFNG. However, our results do not
formally rule out the possibility that the LFNG protein has an
extracellular function, which we expect would also be perturbed in
our mutant mice.
Finally, our work suggests a link between clock activity and the
post-transcriptional regulation of clock components. Expression of
RLFNG has effects on both transcriptional and post-transcriptional
regulation of Hes7. In LfngRLFNG/+ embryos, NICD levels are
reduced in the posterior PSM and Hes7 transcription is confined to
the posterior PSM. This is consistent with previous findings
suggesting that Notch activity is not required for the initiation of
Hes7 transcription in the most posterior PSM (Niwa et al., 2007).
However, mature Hes7 transcripts appear to be stabilized in the
Development (2016) 143, 822-830 doi:10.1242/dev.128538
closely resembled for these analyses (i.e. the expression of Lfng of all mutant
embryos was assigned to ‘phase 3’). In the case of Spry2, as the mutant
expression pattern was distinct from any wild-type pattern, a third category
of expression was assigned.
Acknowledgements
We thank S. Amacher and members of the S.E.C. laboratory for comments.
Competing interests
The authors declare no competing or financial interests.
Author contributions
S.E.C. developed concepts/approach, performed some experiments, and
contributed to data analysis and manuscript preparation. D.R.W. and E.T.S.
designed and performed most experiments, and contributed to data analysis and
manuscript preparation. K.M.B. performed and assisted with the design of some
experiments and contributed to manuscript editing.
Funding
This work was supported by a grant from the National Science Foundation [# IOS0919649 to S.E.C.].
Supplementary information
Supplementary information available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.128538/-/DC1
References
Aoyama, H. and Asamoto, K. (2000). The developmental fate of the Rostral/Caudal
half of a somite for vertebra and Rib formation: experimental confirmation of the
resegmentation theory using chick-quail chimeras. Mech. Dev. 99, 71-82.
Aulehla, A. and Pourquie, O. (2010). Signaling gradients during paraxial
mesoderm development. Cold Spring Harb. Perspect. Biol. 2, a000869.
Bessho, Y., Hirata, H., Masamizu, Y. and Kageyama, R. (2003). Periodic
repression by the bHLH factor Hes7 is an essential mechanism for the somite
segmentation clock. Genes Dev. 17, 1451-1456.
Bunting, M., Bernstein, K. E., Greer, J. M., Capecchi, M. R. and Thomas, K. R.
(1999). Targeting genes for self-excision in the germ line. Genes Dev. 13,
1524-1528.
Bussen, M., Petry, M., Schuster-Gossler, K., Leitges, M., Gossler, A. and
Kispert, A. (2004). The T-box transcription factor Tbx18 maintains the separation
of anterior and posterior somite compartments. Genes Dev. 18, 1209-1221.
Chen, J., Kang, L. and Zhang, N. (2005). Negative feedback loop formed by lunatic
fringe and Hes7 controls their oscillatory expression during somitogenesis.
Genesis 43, 196-204.
Cinquin, O. (2003). Is the somitogenesis clock really cell-autonomous? A coupledoscillator model of segmentation. J. Theor. Biol. 224, 459-468.
Cole, S. E., Levorse, J. M., Tilghman, S. M. and Vogt, T. F. (2002). Clock
regulatory elements control cyclic expression of lunatic fringe during
somitogenesis. Dev. Cell 3, 75-84.
Dale, J. K., Maroto, M., Dequeant, M.-L., Malapert, P., McGrew, M. and Pourquie,
O. (2003). Periodic notch inhibition by lunatic fringe underlies the chick
segmentation clock. Nature 421, 275-278.
Davis, R. L., Turner, D. L., Evans, L. M. and Kirschner, M. W. (2001). Molecular
targets of vertebrate segmentation: two mechanisms control segmental
expression of xenopus Hairy2 during somite formation. Dev. Cell 1, 553-565.
Dequeant, M.-L., Glynn, E., Gaudenz, K., Wahl, M., Chen, J., Mushegian, A. and
Pourquie, O. (2006). A complex oscillating network of signaling genes underlies
the mouse segmentation clock. Science 314, 1595-1598.
Dill, K. K. and Amacher, S. L. (2005). Tortuga refines notch pathway gene
expression in the zebrafish presomitic mesoderm at the post-transcriptional level.
Dev. Biol. 287, 225-236.
Evrard, Y. A., Lun, Y., Aulehla, A., Gan, L. and Johnson, R. L. (1998). Lunatic
fringe is an essential mediator of somite segmentation and patterning. Nature 394,
377-381.
Feller, J., Schneider, A., Schuster-Gossler, K. and Gossler, A. (2008). Noncyclic
Notch activity in the presomitic mesoderm demonstrates uncoupling of somite
compartmentalization and boundary formation. Genes Dev. 22, 2166-2171.
Hicks, C., Johnston, S. H., diSibio, G., Collazo, A., Vogt, T. F. and Weinmaster,
G. (2000). Fringe differentially modulates Jagged1 and Delta1 signalling through
Notch1 and Notch2. Nat. Cell Biol. 2, 515-520.
Johnston, S. H., Rauskolb, C., Wilson, R., Prabhakaran, B., Irvine, K. D. and
Vogt, T. F. (1997). A family of mammalian fringe genes implicated in boundary
determination and the Notch pathway. Development 124, 2245-2254.
Kageyama, R., Niwa, Y., Isomura, A., Gonzá lez, A. and Harima, Y. (2012).
Oscillatory gene expression and somitogenesis. Wiley Interdiscip. Rev. Dev. Biol.
1, 629-641.
830
Development (2016) 143, 822-830 doi:10.1242/dev.128538
Kato, T. M., Kawaguchi, A., Kosodo, Y., Niwa, H. and Matsuzaki, F. (2010).
Lunatic fringe potentiates Notch signaling in the developing brain. Mol. Cell.
Neurosci. 45, 12-25.
McLeod, M. J. (1980). Differential staining of cartilage and bone in whole mouse
fetuses by Alcian blue and Alizarin red S. Teratology 22, 299-301.
Moloney, D. J., Panin, V. M., Johnston, S. H., Chen, J., Shao, L., Wilson, R.,
Wang, Y., Stanley, P., Irvine, K. D., Haltiwanger, R. S. et al. (2000). Fringe is a
glycosyltransferase that modifies Notch. Nature 406, 369-375.
Morales, A. V., Yasuda, Y. and Ish-Horowicz, D. (2002). Periodic lunatic fringe
expression is controlled during segmentation by a cyclic transcriptional enhancer
responsive to Notch signaling. Dev. Cell 3, 63-74.
Morimoto, M., Takahashi, Y., Endo, M. and Saga, Y. (2005). The Mesp2
transcription factor establishes segmental borders by suppressing Notch activity.
Nature 435, 354-359.
Munro, S. and Freeman, M. (2000). The Notch signalling regulator fringe acts in the
Golgi apparatus and requires the glycosyltransferase signature motif DXD. Curr.
Biol. 10, 813-820.
Nitanda, Y., Matsui, T., Matta, T., Higami, A., Kohno, K., Nakahata, Y. and
Bessho, Y. (2014). 3′-UTR-dependent regulation of mRNA turnover is critical for
differential distribution patterns of cyclic gene mRNAs. FEBS J. 281, 146-156.
Niwa, Y., Masamizu, Y., Liu, T., Nakayama, R., Deng, C.-X. and Kageyama, R.
(2007). The initiation and propagation of Hes7 oscillation are cooperatively
regulated by Fgf and Notch signaling in the somite segmentation clock. Dev. Cell
13, 298-304.
Nomura-Kitabayashi, A., Takahashi, Y., Kitajima, S., Inoue, T., Takeda, H. and
Saga, Y. (2002). Hypomorphic Mesp allele distinguishes establishment of
rostrocaudal polarity and segment border formation in somitogenesis.
Development 129, 2473-2481.
Oginuma, M., Takahashi, Y., Kitajima, S., Kiso, M., Kanno, J., Kimura, A. and
Saga, Y. (2010). The oscillation of Notch activation, but not its boundary, is
required for somite border formation and rostral-caudal patterning within a somite.
Development 137, 1515-1522.
Okubo, Y., Sugawara, T., Abe-Koduka, N., Kanno, J., Kimura, A. and Saga, Y.
(2012). Lfng regulates the synchronized oscillation of the mouse segmentation
clock via trans-repression of Notch signalling. Nat. Commun. 3, 1141.
Panin, V. M., Papayannopoulos, V., Wilson, R. and Irvine, K. D. (1997). Fringe
modulates Notch-ligand interactions. Nature 387, 908-912.
Panin, V. M., Shao, L., Lei, L., Moloney, D. J., Irvine, K. D. and Haltiwanger, R. S.
(2002). Notch ligands are substrates for protein O-fucosyltransferase-1 and fringe.
J. Biol. Chem. 277, 29945-29952.
Riley, M. F., Bochter, M. S., Wahi, K., Nuovo, G. J. and Cole, S. E. (2013). Mir125a-5p-mediated regulation of Lfng is essential for the avian segmentation clock.
Dev. Cell 24, 554-561.
Saga, Y., Hata, N., Koseki, H. and Taketo, M. M. (1997). Mesp2: a novel mouse
gene expressed in the presegmented mesoderm and essential for segmentation
initiation. Genes Dev. 11, 1827-1839.
Sasaki, N., Kiso, M., Kitagawa, M. and Saga, Y. (2011). The repression of Notch
signaling occurs via the destabilization of mastermind-like 1 by Mesp2 and is
essential for somitogenesis. Development 138, 55-64.
Serth, K., Schuster-Gossler, K., Cordes, R. and Gossler, A. (2003).
Transcriptional oscillation of lunatic fringe is essential for somitogenesis. Genes
Dev. 17, 912-925.
Serth, K., Schuster-Gossler, K., Kremmer, E., Hansen, B., Marohn-Kö hn, B.
and Gossler, A. (2015). O-fucosylation of DLL3 is required for its function during
somitogenesis. PLoS ONE 10, e0123776.
Shifley, E. T. and Cole, S. E. (2008). Lunatic fringe protein processing by proprotein
convertases may contribute to the short protein half-life in the segmentation clock.
Biochim. Biophys. Acta 1783, 2384-2390.
Shifley, E. T., VanHorn, K. M., Perez-Balaguer, A., Franklin, J. D., Weinstein, M.
and Cole, S. E. (2008). Oscillatory lunatic fringe activity is crucial for segmentation
of the anterior but not posterior skeleton. Development 135, 899-908.
Takahashi, Y., Yasuhiko, Y., Takahashi, J., Takada, S., Johnson, R. L., Saga, Y.
and Kanno, J. (2013). Metameric pattern of intervertebral disc/vertebral body is
generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of
somites in the mouse embryo. Dev. Biol. 380, 172-184.
Williams, D. R., Shifley, E. T., Lather, J. D. and Cole, S. E. (2014). Posterior
skeletal development and the segmentation clock period are sensitive to Lfng
dosage during somitogenesis. Dev. Biol. 388, 159-169.
Wright, D., Ferjentsik, Z., Chong, S.-W., Qiu, X., Jiang, Y.-J., Malapert, P.,
Pourquie, O., Van Hateren, N., Wilson, S. A., Franco, C. et al. (2009). Cyclic
Nrarp mRNA expression is regulated by the somitic oscillator but Nrarp protein
levels do not oscillate. Dev. Dyn. 238, 3043-3055.
Yang, L.-T., Nichols, J. T., Yao, C., Manilay, J. O., Robey, E. A. and Weinmaster,
G. (2005). Fringe glycosyltransferases differentially modulate Notch1 proteolysis
induced by Delta1 and Jagged1. Mol. Biol. Cell 16, 927-942.
Zhang, N. and Gridley, T. (1998). Defects in somite formation in lunatic fringedeficient mice. Nature 394, 374-377.
DEVELOPMENT
RESEARCH ARTICLE