* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein Synthesis
Signal transduction wikipedia , lookup
Magnesium transporter wikipedia , lookup
Cell nucleus wikipedia , lookup
Protein phosphorylation wikipedia , lookup
Protein moonlighting wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Protein structure prediction wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Epitranscriptome wikipedia , lookup
List of types of proteins wikipedia , lookup
Proteolysis wikipedia , lookup
Word exercise • Invention • Vacation • Application Creation Assimilation Conjugation Words mean something! • Many words that end in “tion” mean a process or action • Name a history word that ends in tion. Does it involve a process/action? • Name an English word that ends in “tion”. Does it involve action? • You are going to learn a lot of words in Biology that end in “tion”. Suffixes and prefixes can help you determine meaning. So remember “tion” makes a noun or a process out of an action verb! Central Dogma Central Dogma Protein synthesis occurs in new cells like skin cells during the G1(gap1) or growth phase of cell cycle http://www.cellsalive.com/cell_cycle.htm Making protein is an important function performed by cells For example, skin cells produce the protein keratin that hardens and forms a protective layer. Melanocyte cells form a protein-based pigment called melanin that protects us from UV damage. Protein enzymes are needed during DNA synthesis and G2-polymerase and helicase Protein Synthesis (making proteins) Involves 2 processes and several steps (image from London Health Sciences) A. Transcription-The first process. The literal definition of transcription is an action meaning “to transcribe”, copy, or convert something! A. Transcription • • Happens in the nucleus RNA polymerase, an enzyme, unzips the DNA. The DNA strand code is copied by mRNA, then DNA zips back up. Click on the picture to see a video. B. Translation-the 2nd Process in Protein SynthesisIn the cytoplasm of the cell! “tion” practice: • Based on your experience/knowledge so far. What does translation mean? • The process of translating a message. In the cell, the mRNA and ribosomes “translate” the DNA code or message to proteins! Review:Protein structureThe sequence or order of amino acids in a protein and hence protein function are determined by the genetic code and assembled by rRNA (ribosomes). -primary structure=order of amino acids -secondary structure is the shape of the polypeptide-alpha helix or beta sheet -tertiary contains both helix’s and beta sheets -quaternary is more than one polypeptide chain http://www.youtube.com/watch?v=Q7dxi4ob2 O4&feature=related Ribosomes translate message into proteins • mRNA decodes/copies the DNA nucleotides(e.g. AGT) into a matching codon sequence (e.g. UCA)that codes for specific amino acids like Serine. • The sequence is taken to the ribosomes (rRNA) to build the proteins. • The ribosomes read the codons to tRNA who can then get the proper amino acid to put into the polypeptide chain/protein. Click on the picture to see a video. Some of the proteins made by cell’s ribosomes during protein synthesis include enzymes like polymerase! Click on the picture to see a video. Describe to your partner what is happening in this picture. Label the correct process for each side of the picture: Protein Synthesis (making proteins)SUMMARY Involves 2 processes and several steps (image from London Health Sciences) How to read Genetic code • Codon – a group of 3 nucleotides in mRNA that specify an amino acid. • • There are 20 amino acids found in different combinations in proteins. Like a genetic message/sentence that needs punctuation: AUGUAGUACCUCAGA-RNA is broken into codon “words” AUG-UAG-UAC-CUC-AGA Codon sequence • • • Has start and stop codons – these do not code for an amino acid only to tell when to start and stop translation. Start = AUG = methionine (like “The”) Stop = UAA, UGA, UAG (like a period) • mRNA codons are paired up with their opposite codon or anti-codon on the tRNA. Ribosomes (rRNA) match the correct tRNA and amino acid to each mRNA codon. mRNA = codons = AUG GGA GUU UAA tRNA = anticodons = UAC CCU CAA AUU The above sequences reads as: “Start” Glycine (amino acid) Valine (amino acid) “Stop”. Below is a DNA sequence, Use the book page 244 to help you and your partner come up with: 1) The complementary mRNA codons 2) The amino acids coded for The first team to get a right answer is the winner! TACGGCCACGTTATAGGATAAATT MRNA=AUG-CCG-GUG-CAA-UAU-CCU-AUU-UAA met-pro-val-glu-try-pro-ile-stop Group Poster Without using any resources, can your group work together to remember at least 3 parts of protein synthesis from yesterday (illustrate and label)-They don’t have to be in order yet Then answer the following on your poster: • What is the first part/process of protein synthesis called? • Protein synthesis always starts in what part of the cell with what type of nucleic acid molecule (s)? • What is the mRNA codon for the following DNA bases: TAG • What is the second process of protein synthesis—what are the RNA molecules (at least 2) involved and where does it take place? • What is involved in the last step of “makin’ protein? List the molecules involved (there are 3 RNA molecules and 1 type of organic molecule)