Download Protein Synthesis

Word exercise
• Invention
• Vacation
• Application
Creation
Assimilation
Conjugation
Words mean something!
• Many words that end in “tion” mean a process or
action
• Name a history word that ends in tion. Does it
involve a process/action?
• Name an English word that ends in “tion”. Does it
involve action?
• You are going to learn a lot of words in Biology
that end in “tion”. Suffixes and prefixes can help
you determine meaning. So remember “tion”
makes a noun or a process out of an action verb!
Central Dogma
Central Dogma
Protein synthesis occurs in new cells like skin cells
during the G1(gap1) or growth phase of cell cycle
http://www.cellsalive.com/cell_cycle.htm
Making protein is an important function performed by
cells
For example, skin cells produce the protein keratin
that hardens and forms a protective layer.
Melanocyte cells form a protein-based pigment called
melanin that protects us from UV damage.
Protein enzymes are needed during DNA synthesis
and G2-polymerase and helicase
Protein Synthesis (making
proteins)
Involves 2 processes and several
steps (image from London Health Sciences)
A. Transcription-The first
process. The literal
definition of
transcription is an
action meaning “to
transcribe”, copy, or
convert something!
A. Transcription
•
•
Happens in the
nucleus
RNA polymerase, an
enzyme, unzips the
DNA. The DNA
strand code is
copied by mRNA,
then DNA zips back
up.
Click on the picture to see a video.
B. Translation-the 2nd Process in Protein SynthesisIn the cytoplasm of the cell!
“tion” practice:
• Based on your experience/knowledge so far.
What does translation mean?
• The process of translating a message. In the
cell, the mRNA and ribosomes “translate” the
DNA code or message to proteins! 
Review:Protein structureThe sequence or order of amino acids
in a protein and hence protein function
are determined by the genetic code
and assembled by rRNA (ribosomes).
-primary structure=order of amino
acids
-secondary structure is the shape of the
polypeptide-alpha helix or beta sheet
-tertiary contains both helix’s and beta
sheets
-quaternary is more than one
polypeptide chain
http://www.youtube.com/watch?v=Q7dxi4ob2
O4&feature=related
Ribosomes translate message into proteins
•
mRNA decodes/copies the
DNA nucleotides(e.g.
AGT) into a matching
codon sequence (e.g.
UCA)that codes for specific
amino acids like Serine.
• The sequence is taken to
the ribosomes (rRNA) to
build the proteins.
• The ribosomes read the
codons to tRNA who can
then get the proper amino
acid to put into the
polypeptide chain/protein.
Click on the picture to see a video.
Some of the proteins
made by cell’s ribosomes
during protein synthesis
include enzymes like
polymerase!
Click on the picture to see a video.
Describe to
your partner
what is
happening
in this
picture.
Label the
correct
process for
each side of
the picture:
Protein Synthesis (making
proteins)SUMMARY
Involves 2 processes and several
steps (image from London Health Sciences)
How to read Genetic code
•
Codon – a group of 3 nucleotides in mRNA
that specify an amino acid.
•
•
There are 20 amino acids found in different
combinations in proteins.
Like a genetic message/sentence that needs
punctuation: AUGUAGUACCUCAGA-RNA is
broken into codon “words”
AUG-UAG-UAC-CUC-AGA
Codon sequence
•
•
•
Has start and stop codons – these do not
code for an amino acid only to tell when to
start and stop translation.
Start = AUG = methionine (like “The”)
Stop = UAA, UGA, UAG (like a period)
• mRNA codons are paired up with their opposite codon or
anti-codon on the tRNA. Ribosomes (rRNA) match the
correct tRNA and amino acid to each mRNA codon.
mRNA = codons = AUG GGA GUU UAA
tRNA = anticodons = UAC CCU CAA AUU
The above sequences reads as: “Start” Glycine (amino acid)
Valine (amino acid) “Stop”.
Below is a DNA sequence, Use the book page 244 to help
you and your partner come up with:
1) The complementary mRNA codons
2) The amino acids coded for
The first team to get a right answer is the winner!
TACGGCCACGTTATAGGATAAATT
MRNA=AUG-CCG-GUG-CAA-UAU-CCU-AUU-UAA
met-pro-val-glu-try-pro-ile-stop
Group Poster
Without using any resources, can your group work together to
remember at least 3 parts of protein synthesis from yesterday
(illustrate and label)-They don’t have to be in order yet 
Then answer the following on your poster:
• What is the first part/process of protein synthesis called?
• Protein synthesis always starts in what part of the cell with what
type of nucleic acid molecule (s)?
• What is the mRNA codon for the following DNA bases: TAG
• What is the second process of protein synthesis—what are the RNA
molecules (at least 2) involved and where does it take place?
• What is involved in the last step of “makin’ protein? List the
molecules involved (there are 3 RNA molecules and 1 type of
organic molecule)