Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Zinc finger nuclease wikipedia , lookup
DNA sequencing wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA profiling wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Biology 160 DNA Lab Names_________________________________ _________________________________ Lab Section: 1:00 pm 3:00 pm DNA, RNA and the Genetic Code Worksheet (complete & turn in during the lab period! – work together (in pairs) on this lab) Write the term that matches each phrase DNA and RNA are types of… ______________________________ Pyrimidine that pairs with adenine, in DNA ______________________________ Purine that pairs with cytosine, in DNA or RNA ______________________________ Chemical bonds that join complementary nitrogen bases ______________________________ Two molecules forming sides of the DNA “ladder” ______________________________ In DNA replication, what determines the sequence of nucleotides in the new strands of nucleotides that form? Fill in the sequence of complementary bases on the unlabeled strands below, for the two different situations. DNA replication: T A C G C T A G T C A G A T T mRNA production: T A C G C T A G T C A G A T T Comparison of DNA and RNA molecules: DNA RNA number of nucleotide strands nitrogenous base that is complimentary to “A” type of sugar in the “backbone” of the polymer number of different types location(s) in a cell where it can be found includes portions called “codons” and “anticodons” (yes or no) Do enzymes play important roles in building the molecule? (yes or no) Using the following five term: mRNA, Translation, Protein, DNA, Transcription fill in the blanks and arrows in the diagram to show the flow of genetic information: Bio160 DNA Lab Page 2 of 5 Fill in the blanks in the following statement, being as specific as possible: The process of ________________ copies information from ________________ to ________________. The process of ________________converts a sequence of ________________ to a sequence of ________________, which forms a protein. Write the term that matches each statement: carries the genetic code out of the nucleus __________________________ specifies a particular amino acid __________________________ sites of protein synthesis __________________________ carries amino acids to ribosomes __________________________ tRNA triplet that pairs with codon __________________________ codon that starts polypeptide synthesis __________________________ codons that stop polypeptide synthesis __________________________ Indicate the tRNA anticodons and the DNA base triplets associated with each amino acid described below. Then for the amino acid Val (valine) fill in two other possibilities. Amino Acid tRNA anticodon mRNA codon DNA base triplet Trp Lys Met Val Val Val ____________ ____________ ____________ ____________ ____________ ____________ UGG AAA AUG GUU ____________ ____________ ____________ ____________ ____________ ____________ ____________ ____________ The string of letters below represents one strand of DNA. First, transcribe the DNA strand into the mRNA sequence that would be produced from it. Then, identify the mRNA reading frame and draw vertical lines between the mRNA bases to separate the sequence into codons. Finally, use the genetic code table to determine the sequence of amino acids in the protein that would be produced from the mRNA strand TACTCCGATCATCCCTGCAGTTACGAATCGCGTGTGTAACCTGAAGTAACT mRNA: Amino Acids: ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ Bio160 DNA Lab Page 3 of 5 The following is another hypothetical strand of DNA. We’ll use this first template to explore the impact of mutations (arrows indicate the site of the mutations): translate the mRNA sequence, just as a ribosome would, to produce an amino acid sequence of a polypeptide chain. ORIGINAL DNA SEQUENCE i.e. non-mutant gene: DNA: T A C A G G C C G C A A T T T G A G A T T mRNA: AA: Base substitution #1 DNA: T A C A G G C C G C A A T T T G T G A T T mRNA: AA: Base Substitution #2 DNA: T A C A G G C C G G A A T T T G T G A T T mRNA: AA: Triplet Deletion DNA: T A C A G G C C G T T T G T G A T T mRNA: AA: Base deletion DNA: T A C A G G C C G C A A T T G A G A T T mRNA: AA: Base Addition DNA: T A C A G G C C G C A T A T T T G A G A T T mRNA: AA: Bio160 DNA Lab Page 4 of 5 Which mutation had the least amount of effect on the protein structure? Why? Which mutation had the largest effect on the protein structure? Why? Explain how DNA ultimately controls the functioning of cells (be specific!), and how/why mutations in DNA can disrupt proper functioning. Bio160 DNA Lab Page 5 of 5