Download Cellular transcription factors that interact with p6 promoter elements

Journal
of General Virology (2001), 82, 1473–1480. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Cellular transcription factors that interact with p6 promoter
elements of parvovirus B19
Ulla Raab, Birgit Bauer, Andreas Gigler,† Karin Beckenlehner, Hans Wolf and Susanne Modrow
Institut fu$ r Medizinische Mikrobiologie und Hygiene, Universita$ t Regensburg, Franz-Josef-Strauß-Allee 11, D-93053 Regensburg,
Germany
All transcripts of the human parvovirus B19 identified so far are regulated by a single promoter at
map unit 6 of the viral genome, the so-called p6 promoter. This promoter is active in a wide variety
of different cells. In order to identify cellular transcription factors involved in regulating promoter
activity, we performed gel-retardation and supershift assays using the parts of the p6 promoter
sequence shown previously to be protected in footprint experiments. Thereby, binding was
demonstrated of the Oct-1 protein to an octamer motif within the p6 promoter and of the
transcription factor Sp1 to three GC boxes. A specific preferential interaction of the factor Sp3 with
one of these boxes was observed, indicating that the ratio Sp1: Sp3 may be involved in the
regulation of promoter activity. Consensus sites for the regulatory protein YY1 are located close
to the GC boxes and the octamer motif, to which this factor binds efficiently.
Introduction
Parvovirus B19, the only member of the family Parvoviridae
known to be pathogenic in humans, is associated with a
remarkable variety of diseases. It is, for instance, the causative
agent of the common childhood disease erythema infectiosum
(fifth disease) (Anderson et al., 1983) as well as acute and
persistent arthritis. In addition, it is the cause of aplastic crisis
in patients suffering from chronic haemolytic anaemia or
hydrops foetalis after transplacental infection during pregnancy (Brown, 1984 ; Pattison et al., 1981 ; Reid et al., 1985).
At both ends of the 5n6 kb single-stranded viral DNA
genome, there are identical inverted terminal repeats of 383
nucleotides in length. The distal 365 nucleotides of these
repeats are imperfect palindromes that form hairpin structures
that are necessary to prime DNA replication. The only
functionally active promoter within the viral genome, the p6
promoter, is located at the 5h palindrome and regulates the
synthesis of all nine viral transcripts (Blundell et al., 1987 ;
Doerig et al., 1990). Seven of these are mRNAs and are used for
Author for correspondence : Susanne Modrow.
Fax j49 941 944 6402.
e-mail susanne.modrow!klinik.uni-regensburg.de
† Present address : geneArt GmbH, Bio Park, Josef-Engertstr. 9, 93053
Regensburg, Germany.
0001-7491 # 2001 SGM
synthesis of a multifunctional protein, the so-called nonstructural protein 1 (NS1), two capsid proteins (VP1 and VP2)
and several smaller polypeptides with no known function
(Deiss et al., 1990 ; Luo & Astell, 1993 ; Ozawa et al., 1987).
Three cellular transcription factors have been shown to
regulate p6 promoter activity. The factor Sp1 has been
reported to be involved in regulating promoter activity and
the factor YY1 has been shown to bind to three different sites
in the upstream region of the p6 promoter, resulting in positive
regulation (Blundell & Astell, 1989 ; Momoeda et al., 1994).
Recently, the binding of Sp1 to a GC-box motif located
downstream of an Ets-binding site (EBS) in combination with
binding of human GA-binding proteins (hGABP) to EBS has
been demonstrated (Vassias et al., 1998). The p6 promoter is
highly active in different cell lines. Interaction of the virus NS1
protein with cellular transcription factors that have not been
identified may increase promoter activity further (Gareus et al.,
1998 ; Liu et al., 1991 ; Momoeda et al., 1994).
In this study, we characterized transcription factors from
various cell lines and analysed their capacity to interact with
the p6 promoter. Firstly, we tested the entire promoter region
by electrophoretic mobility shift assays (EMSA) to get an
overview of possible binding proteins. In a second approach,
three promoter regions (region D, nt k219 to k187 ; region
F, nt k133 to k92 ; region H, nt k76 to k35) that contain
an increased number of potential binding sites for cellular
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12
BEHD
U. Raab and others
transcription factors and have been shown to be complexed
with proteins (Liu et al., 1991) were selected for detailed study.
Using these regions, we studied the interaction of DNAbinding proteins of three different nuclear extracts (from HeLa,
K562 and BJAB cells) with the regulatory elements. Finally,
these factors were characterized further by supershift assays
with specific antibodies.
Methods
Oligonucleotides. Oligonucleotides containing the consensus
binding sites for Sp1 and YY1 and respective unspecific oligonucleotides
were obtained from Santa Cruz Biotechnology and were ready for use.
Specific and mutated single-stranded oligonucleotides with consensus
binding sites for hGABP, Oct-1 and oligonucleotides spanning regions D
to H were obtained from Metabion and purified by HPLC. Annealing of
the complementary oligonucleotides was performed by heating to 95 mC
for 3 min followed by cooling to room temperature. The double-stranded
probes were radioactively labelled to a specific activity of " 100 c.p.m.\
µg by using T4 polynucleotide kinase and [γ-$#P]ATP (5000 Ci\mmol ;
Amersham) and subsequently purified by chromatography (Micro BioSpin 6, Bio-Rad). Unlabelled double-stranded probes were used as specific
and non-specific competitors in gel-retardation assays. The sequences of
the eight oligonucleotides used in the band-shift assays were : region A,
5hGAATTCCGCCAAATCAGATGCCGCCGGTCGCCGCCGGTAGGCGGGACT TCCGGT ; region B, 5h TTCCGGTACAAGATGGCGGACAATTA CGTCATTTGCTGTGA ; region C, 5h TGCTG
TGACGTCATTTCCTGTGACGTCACAGGAAATGACGTAATTGTTCGC ; region D, 5h GTTCGCCATCTTGTACCGGAAGTCCCGCCTACCGGCG ; region E, 5h CGGCGGCGACCGGCGGCATCT
GATTTGGTGTCTTCTTTTAAATTTTAGCGGGCTTTTTTCCCGCC ; region F, 5h TTTCCCGCCTTATGCAAATTGGCAGCCATTTTAAGTGTTTTACT ; region G, 5h TACTATAATTTTATTGGTTAGTTTTG ; and region H, 5h GTTTTGTAACGGTCAAAATGGGCGGAGCGTGGGCGGGGAATACAG.
Nuclear extracts. Preparation of nuclear extracts was performed at
4 mC ; all buffers were placed on ice. Except for PBS, all buffers contained
0n5 mM dithiothreitol and 0n2 mM PMSF, added immediately before use.
A modification of the method described by Dignam et al. (1983) for the
preparation of nuclear extracts was used. HeLa or BJAB cells (1i10*
cells\ml) were harvested (5 min, 750 g) and washed twice in PBS and
once in hypotonic buffer (10 mM HEPES–NaOH, pH 7n9, 10 mM KCl,
1n5 mM MgCl ). The cells were pelleted (5 min, 750 g), resuspended in 1
#
vol. hypotonic buffer and incubated for 10 min on ice. The suspension
was transferred to a Dounce homogenizer and cells were lysed by a
minimal number of strokes (20–30).
Nuclei were recovered by centrifugation (5 min, 750 g), suspended
gently in 1 ml hypotonic buffer and pelleted (5 min, 750 g). The nuclei
were suspended in 1 vol. (100–300 µl) high-salt extraction buffer (20 mM
HEPES–NaOH, pH 7n9, 25 % glycerol, 0n6 M KCl, 1n5 mM MgCl ,
#
0n2 mM EDTA) and incubated for 30 min at 4 mC with gentle rocking.
Following this incubation, the mixture was centrifuged (30 min,
100 000 g). The supernatant was dialysed at 4 mC for 3 h (10 mM
HEPES–NaOH, pH 7n9, 10 % glycerol, 100 mM NaCl, 1 mM EDTA).
After dialysis, the extract was cleared by centrifugation (30 min,
100 000 g) to remove the precipitate. Aliquots of the supernatant were
transferred quickly to liquid nitrogen and stored at k80 mC. The protein
concentrations of the extracts were determined as 2 µg\µl by the
Bradford method (Bio-Rad) with BSA as the standard.
K562 nuclear extracts were obtained from Santa Cruz Biotechnology.
BEHE
Electrophoretic mobility shift assays (EMSAs). Gel-retardation
assays were performed with 2n5 µl nuclear extract of HeLa, K562 or BJAB
cells, 1 µg poly(dI–dC) and 20 fmol labelled DNA in a final volume of
20 µl containing 8 µl binding buffer (100 mM Tris–HCl, pH 7n5, 500 mM
NaCl, 5 mM dithiothreitol), 5 mM MgCl , 10 % glycerol and 0n05 %
#
NP40. For controls, non-radiolabelled competitor oligonucleotides were
added to the mixture prior to the addition of labelled DNA probes.
Supershift assays were performed by adding specific antibodies to the
reaction mixture. All binding reactions were performed for 20 min at
room temperature. The samples were subjected to electrophoresis on
native 5 % polyacrylamide gels (37n5 : 1 acrylamide : bisacrylamide) containing 0n5i TBE. Gels were subsequently dried for autoradiography.
Antibodies. The polyclonal Oct-1-specific antiserum and monoclonal Sp1-, Sp3- and YY1-specific antibodies were obtained from Santa
Cruz Biotechnology. Monoclonal antibodies directed to viral VP1
protein were used as a negative control (Gigler et al., 1999). In gelmobility supershift experiments, 2 µl monoclonal antibody (2 µg\µl) or
10 µl Oct-1-specific antiserum (0n2 µg\µl) was added to the binding
reaction after 20 min of incubation, which was then continued for
additional 20 min.
Computer programs. Binding sites for transcription factors were
analysed by using the program TFSEARCH 1.3 (http :\\
pdap1.trc.rwcp.or.jp\research\db\TFSEARCH.html)
with
the
TRANSFAC matrix table 2.5 (Wingender et al., 2000).
Results
DNA-binding proteins of HeLa-cell extracts that
interact with the p6 region
In order to characterize regulatory proteins that interact
with the p6 promoter, we analysed the promoter sequence for
the presence of DNA elements known to bind cellular
transcription factors by using the TFSEARCH program. Within
the promoter sequence, three regions were identified as
containing elevated numbers of potential binding sites (region
D, nt k219 to k187 ; region F, k133 to k92 ; region H,
k76 to k35). Similar results were obtained in EMSAs with
eight double-stranded oligonucleotides spanning the entire p6
promoter. Various cellular proteins could be identified that
bind preferentially to these three promoter regions. These
regions are furthermore highly conserved in various B19
isolates and have been shown for the most part to be protected
by trans-acting proteins in footprint experiments (Liu et al.,
1991). Based on these data, regions D, F and H were selected
and used in detailed EMSA studies to test the binding of
regulatory factors in nuclear extracts of HeLa, K562 and BJAB
cells (Fig. 1).
With region D and nuclear extracts from HeLa cells, two
major and two minor retarded bands were observed (Fig. 2 A,
lane 2). Region F showed two major retarded bands and one
faint band (Fig. 3 A, lane 2). Region H gave rise to four major
and two minor bands (Fig. 4 A, lane 2). Competition assays
with unlabelled oligonucleotides demonstrated that all bands
represented specifically binding proteins, since complex for-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12
Characterization of the B19 p6 promoter
Fig. 1. Schematic representation of the
p6 promoter of parvovirus B19 with
potential binding sites for cellular
transcription factors. The position and
sequence of the double-stranded
oligonucleotides used in EMSAs (regions
D, F and H) are given. Promoter regions
that have been reported to be protected
in footprint analysis (Liu et al., 1991) are
marked by grey bars.
Fig. 2. Binding of cellular transcription factors to region D of the p6 promoter. EMSAs were performed with 32P-labelled
oligonucleotides and 5 µg nuclear extracts prepared from HeLa cells (A) and from K562 and BJAB cells (B). After
electrophoresis, the gels were exposed to X-ray film. The assignment of the complexes and the transcription factors that were
identified as parts of the complexes are given. Lanes : 1, radiolabelled oligonucleotides ; 2 : radiolabelled oligonucleotides
incubated with nuclear extracts (n.e.) ; 3, radiolabelled oligonucleotides incubated with nuclear extracts and specific (spec.)
unlabelled oligonucleotides as competitors ; 4, radiolabelled oligonucleotides incubated with nuclear extracts and unspecific
(control) oligonucleotides ; 5, 7 and 9 (competition shifts), radiolabelled oligonucleotides incubated with nuclear extracts from
HeLa cells and specifically competing oligonucleotides (cons) containing the binding motifs for Sp1, EBS and YY1,
respectively ; 6, 8 and 10, radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and unspecifically
competing mutant oligonucleotides (mut) with substitutions in the binding sites for Sp1, EBS and YY1, respectively ; 11 and 13
(immunoshift), radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and control antibodies (α-C) ;
12 and 14, Radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and antibodies specifically binding
Sp1 (α-Sp1) and YY1 (α-YY1), respectively.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12
BEHF
U. Raab and others
Fig. 3. Binding of cellular transcription factors to region F of the p6 promoter. EMSAs were performed as described in the
legend to Fig. 2. Lanes : 1–4, as Fig. 2 ; 5 and 7 (competition shifts), radiolabelled oligonucleotides incubated with nuclear
extracts from HeLa cells and specifically competing oligonucleotides containing the binding motifs for Oct-1 and YY1,
respectively ; 6 and 8, radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and unspecifically
competing mutant oligonucleotides with substitutions in the binding sites for Oct-1 and YY1, respectively ; 9 and 11
(immunoshift), radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and control antibody ; 10 and 12,
radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and antibodies specifically binding Oct-1 and
YY1 proteins, respectively.
mation was completely inhibited (Figs 3 A, 4 A, 5 A ; lanes 3),
whereas 50-fold excesses of unspecific competitor DNA did
not show any effect (Figs 3 A, 4 A, 5 A ; lanes 4).
Competition assays with oligonucleotides containing
known consensus binding sites for cellular transcription factors
were performed in order to characterize the proteins involved
in complex formation. For controls, we used probes in which
two essential nucleotides of the consensus binding sites were
exchanged. None of these control oligonucleotides affected
formation of the respective complex (Fig. 2 A, lanes 6, 8 and
10 ; Fig. 3 A, lanes 6 and 8 ; Fig. 4 A, lanes 6 and 8). In region
D, the formation of complexes IV and V could be inhibited
completely by the YY1 consensus binding sequence (Fig. 2 A,
lane 9). In immunoshift assays, addition of the YY1-specific
antiserum inhibited the formation of complex IV only (Fig. 3 A,
lane 14), suggesting that the formation of complex V may be
due to a truncated YY1 protein (YY1*), as described previously
(Kalenik et al., 1997 ; Klug & Beato, 1996). This YY1* protein
did not interact with the antibodies used in the immunoshift
assays.
BEHG
In EMSA, both complexes II and III observed with region
D were not formed in the presence of oligonucleotides
corresponding to the EBS as competitors (Fig. 3 A, lane 7).
These data suggest that Ets-binding factors are parts of
complexes II and III. We did not characterize these two
complexes further because of the lack of appropriate antibodies.
Recently, however, Vassias et al. (1998) identified GABPα and
GABPβ, two members of the Ets family, as involved in the
formation of these complexes. As the authors demonstrated,
they correspond to heterodimers of GABPα\GABPβ1 and
GABPα\GABPβ2, respectively.
The formation of complex I was blocked in the presence of
unlabelled Sp1-consensus oligonucleotides (Fig. 2 A, lane 5),
indicating that Sp1 proteins are part of complex I. This was
confirmed by immunoshift assays with Sp1-specific monoclonal antibodies (Fig. 2 A, lane 12).
The analysis of region F showed that complexes VII and
VIII were equivalent to complexes IV and V of region D.
Competition analysis demonstrated that their formation was
inhibited in the presence of unlabelled YY1-consensus oligo-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12
Characterization of the B19 p6 promoter
Fig. 4. Binding of cellular transcription factors to region H of the p6 promoter. EMSAs were performed as described in the
legend to Fig. 2. Lanes : 1–4, as Fig. 2 ; 5 and 7 (competition shifts), radiolabelled oligonucleotides incubated with nuclear
extracts from HeLa cells and specifically competing oligonucleotides containing the binding motifs for Sp1 and YY1,
respectively ; 6 and 8, radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and unspecifically
competing mutant oligonucleotides with substitutions in the binding sites for Sp1 and YY1, respectively ; 9, 11, 13 and 15
(immunoshift), radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and antibodies specifically
binding Sp1, Sp3, both Sp1 and Sp3 (α-Sp1/Sp3 ; combination of two antibodies) and YY1, respectively ; 10, 12 and 14,
radiolabelled oligonucleotides incubated with nuclear extracts from HeLa cells and control antibodies (α-C).
nucleotides (Fig. 3 A, lane 7), whereby, in immunoshift assays
with YY1-specific antibodies, the migration of complex VII in
the gel system was reduced (Fig. 3 A, lane 12). The formation
of complex VI could be blocked by oligonucleotides containing
the octamer binding motif (Fig. 3 A, lane 5). Further analysis
demonstrated that complex VI was supershifted after incubation with an Oct-1-specific antiserum (Fig. 3 A, lane 10). In
neither case did the use of unspecifically binding VP1-specific
monoclonal antibodies show any effect on the intensity or
mobility of the complexes.
Within region H, formation of complexes XIII and XIV was
inhibited by YY1 consensus binding sequences (Fig. 4 A, lane
7), whereas YY1-specific antibodies shifted only complex XIII
(Fig. 4 A, lane 15). This result is similar to that obtained from
analysis of regions D and F. The intensities of the three
complexes IX, X and XI were reduced by addition of unlabelled
Sp1-consensus oligonucleotides, suggesting that Sp1 binds
both of the GC boxes present in region H. Interestingly, the
formation of complex XII was inhibited totally by these
oligonucleotides (Fig. 4 A, lane 5). Supershift assays with Sp1-
specific monoclonal antibodies showed that Sp1 is involved in
the formation of the upper three complexes (Fig. 4 A, lane 9).
Supershift experiments with Sp3-specific antibodies revealed
that the transcription factor Sp3, which binds specifically to
GC-box motifs with an affinity similar to that of Sp1 (Dennig
et al., 1995 ; Hagen et al., 1994), is not only involved in the
formation of complex XII but is also part of the upper three
complexes, as indicated by the re-arrangement of these bands
after addition of Sp3-specific antibodies (Fig. 4 A, lane 11). The
formation of all four complexes was inhibited by a combination
of the two antibodies (Fig. 4 A, lane 13).
In conclusion, we have shown that the transcription factor
Sp1 interacts with three GC boxes located within regions D
and H of the p6 promoter of parvovirus B19 and that the factor
Sp3 binds preferentially to the GC box present in region H.
Binding of Sp3 to the GC box in region D could not be
demonstrated. It may be concluded that the ratio of Sp1 to Sp3
in the nucleus may regulate p6 promoter activity, as has been
shown for several promoters controlling gene expression in
various human cells (Hata et al., 1998 ; Nielsen et al., 1998). The
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12
BEHH
U. Raab and others
Oct-1 protein forms a complex with the octamer motif of
region F, the regulatory protein YY1 binds to the respective
consensus sites located in all three promoter regions and an
Ets-related transcription factor interacts with the EBS of region
D.
DNA-binding proteins in K562 and BJAB cells
By analysis of the activity of the p6 promoter in different
cell lines, enhanced promoter activity has been shown in the
erythroid cell line K562 as well as in the B-cell line BJAB
compared with epithelial HeLa cells (Gareus et al., 1998). For
this reason, we were interested in studying nuclear extracts of
K562 and BJAB cells by EMSA to detect additional transcription factors that regulate p6 promoter activity. In assays
with region D, we obtained a pattern of bands similar to that
of HeLa extracts (Fig. 2 B). The main difference was that neither
K562 nor BJAB nuclear extracts seemed to contain the
degradation product YY1*. Besides the absence of YY1*,
differences in complex formation were detected in region F
with nuclear extracts of BJAB cells. In addition to the factors
identified in nuclear extracts of HeLa cells, three further
complexes could be identified (Fig. 3 B, lane 2\BJAB). Complex
c was characterized by immunoshift assay as the B cell-specific
transcription factor Oct-2. Competition and immunoshift
assays revealed that both complexes a and b consisted of two
proteins (data not shown). Oct-1 and YY1 are involved in the
formation of complex a, whereas complex b consists of Oct-2
and YY1. In assays containing extracts of K562 cells, an
additional complex was formed with the oligonucleotide
spanning region H (Fig. 4 B, lane 2\K562).
Discussion
In order to define further the mechanisms involved in
transcriptional regulation by the p6 promoter of parvovirus
B19, we selected three adjoining regions within the promoter
sequence to study the binding of cell-specific, trans-active
nuclear proteins by EMSA. All the identified binding motifs
within the p6 promoter are highly conserved in 19 isolates we
analysed by DNA sequencing (data not shown). Since the
isolates originated from patients with different parvovirus
B19-correlated symptoms and were collected in different
geographical regions, we speculate that these motifs are
essential for promoter activity.
We could demonstrate binding of the transcription factor
Sp1 to three GC boxes located in regions D and H as well as
the binding of the Oct-1 protein, a lymphoid cell-specific
factor, to an octamer motif within region F of the p6 promoter.
Binding of Sp1 to the GC box adjacent to the octamer motif of
region F could not be shown. This may be due to the fact that
the dominant band of complex VI (Fig. 3 A, lane 2), containing
the Oct-1 protein, has the same mobility as the proposed
complex with Sp1, and they would be superimposed. This
BEHI
hypothesis is, however, contradicted by the result of the
supershift assay with Oct-1-specific antibodies, which did not
reveal a co-migrating Sp1 complex. Also, incubation with
unlabelled Sp1-consensus oligonucleotides or with Sp1-specific
antibodies did not modify the migration of complex VI (data
not shown). It may be concluded that the binding of Sp1
proteins is sterically inhibited by the factor Oct-1, which binds
with high affinity to a binding site that partly overlaps the Sp1
motif. In addition to Sp1, both GC boxes located in region H
interacted with the factor Sp3. The faster-migrating Sp3
complex XII (Fig. 4 A, lane 2) could represent an aminoterminally truncated form of Sp3 containing a complete DNAbinding domain, as described previously (Hagen et al., 1992).
Definite binding of Sp3 to the GC box of region D could not
be demonstrated. These results indicate that different members
of the Sp transcription factor family exhibit different modes of
interaction with the GC boxes of the p6 promoter, suggesting
additional influences of the adjoining nucleotide sequences.
Alternatively, the ratio of Sp1 to Sp3, which has been shown
to vary according to cell type and cell cycle phase, may affect
the binding of the factors to the GC motifs (Kennett et al.,
1997 ; Nielsen et al., 1998). In competition with Sp1, binding of
Sp3 may repress or activate gene expression, as has been
shown for several human genes (Hagen et al., 1994 ; Kwon et
al., 1999 ; Qin et al., 1999) and virus genes (Tsai et al., 1999).
Recently, Wildhage et al. (1999) have shown that three GC
boxes located in the promoter controlling the expression of the
human glucagon-like peptide-1 receptor do not bind Sp1 and
Sp3 in equal amounts. Activator and\or repressor functions are
thereby exerted that regulate the basal promoter activity of the
receptor gene. Similar mechanisms may occur by interaction of
factors Sp1 and Sp3 with the GC boxes of the p6 promoter.
YY1-binding motifs are located in all three promoter
regions and YY1 proteins could be shown to form complexes
with all of these sites. In region D, an EBS is located directly
upstream of the GC box. Vassias et al. (1998) identified
hGABP, an Ets-related transcription factor, as binding the
CCGGAAGT motif formed by nucleotides k204 to k197,
and suggested a synergistic effect on promoter activation of
the formation of a complex between Sp1 and hGABP, an effect
that was partially reversed by upstream binding of YY1.
It has been shown previously that the p6 promoter is about
25 times more active in the erythroleukaemic cell line K562
and six times more active in the B-cell line BJAB compared
with its activity in HeLa cells. Cell-specific transcription factors
may play an essential role in enhanced activation of the virus
promoter. In BJAB cell extracts, we were able to identify the B
cell-specific transcription factor Oct-2 as interacting with the
octamer motif in region F. The additional complex that was
observed in nuclear extracts of K562 cells, which are the most
similar to the natural target cells of parvovirus B19 (Fig. 4 B,
lane 2), has yet not been characterized. This protein may be a
cell-specific factor that contributes to the high activity of the
p6 promoter in K562 cells. These factors must be identified
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12
Characterization of the B19 p6 promoter
before a final model for the regulation of parvovirus B19 gene
expression can be proposed.
On the basis of the results presented here and the
characterization of cis-active elements in the p6 promoter
achieved by using reporter constructs (Gareus et al., 1998), we
propose the following tentative model of activation by
regulatory proteins. The binding of YY1 to at least two of the
three binding sites facilitates the binding of further proteins to
the DNA. This directs the binding of at least two Sp1\Sp3
molecules in the direct vicinity of the TATA box. Moreover,
in the promoter region between nucleotides k125 and k195,
an additional molecule of Sp1 and the Ets-related transcription
factor hGABP may associate, whereas Oct-1 binds nucleotides
k125 to k118. By bridging of the Sp1 molecules bound to
regions D and H, a DNA loop may be formed, resulting in the
initiation of transcription of the viral genes. As soon as the
NS1 protein is synthesized, it may bind one of the molecules
associated with the promoter, thereby mediating strong
transcriptional activation and leading to significant enhancement of virus gene expression.
This work was supported by Deutsche Forschungsgemeinschaft grant
Mo620\5-3. A. G. was supported by a grant from the University of
Regensburg (Fo$ rderung des wissenschaftlichen Nachwuchses) and U. R.
was supported by an HSP III scholarship from the University of
Regensburg. We thank Simone Dorsch and Ba$ rbel Kaufmann for critical
reading of the manuscript and Heide Sommer and Arnd Dankesreiter for
helpful discussion.
References
Anderson, M. J., Jones, S. E., Fisher-Hoch, S. P., Lewis, E., Hall, S. M.,
Bartlett, C. L., Cohen, B. J., Mortimer, P. P. & Pereira, M. S. (1983).
Human parvovirus, the cause of erythema infectiosum (fifth disease)?
Lancet i, 1378.
Blundell, M. C. & Astell, C. R. (1989). A GC-box motif upstream of the
B19 parvovirus unique promoter is important for in vitro transcription.
Journal of Virology 63, 4814–4823.
Blundell, M. C., Beard, C. & Astell, C. R. (1987). In vitro identification
of a B19 parvovirus promoter. Virology 157, 534–538.
Brown, K. A. (1984). Another viral candidate. Nature 309, 582.
Deiss, V., Tratschin, J. D., Weitz, M. & Siegl, G. (1990). Cloning of the
human parvovirus B19 genome and structural analysis of its palindromic
termini. Virology 175, 247–254.
Dennig, J., Hagen, G., Beato, M. & Suske, G. (1995). Members of the
Sp transcription factor family control transcription from the uteroglobin
promoter. Journal of Biological Chemistry 270, 12737–12744.
Dignam, J. D., Lebovitz, R. M. & Roeder, R. G. (1983). Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucleic Acids Research 11, 1475–1489.
Doerig, C., Hirt, B., Antonietti, J. P. & Beard, P. (1990). Nonstructural
protein of parvoviruses B19 and minute virus of mice controls
transcription. Journal of Virology 64, 387–396.
Gareus, R., Gigler, A., Hemauer, A., Leruez-Ville, M., Morinet, F., Wolf,
H. & Modrow, S. (1998). Characterization of cis-acting and NS1 protein-
responsive elements in the p6 promoter of parvovirus B19. Journal of
Virology 72, 609–616.
Gigler, A., Dorsch, S., Hemauer, A., Williams, C., Kim, S., Young, N. S.,
Zolla-Pazner, S., Wolf, H., Gorny, M. K. & Modrow, S. (1999).
Generation of neutralizing human monoclonal antibodies against parvovirus B19 proteins. Journal of Virology 73, 1974–1979.
Hagen, G., Mu$ ller, S., Beato, M. & Suske, G. (1992). Cloning by
recognition site screening of two novel GT box binding proteins : a
family of Sp1 related genes. Nucleic Acids Research 20, 5519–5525.
Hagen, G., Muller, S., Beato, M. & Suske, G. (1994). Sp1-mediated
transcriptional activation is repressed by Sp3. EMBO Journal 13,
3843–3851.
Hata, Y., Duh, E., Zhang, K., Robinson, G. S. & Aiello, L. P. (1998).
Transcription factors Sp1 and Sp3 alter vascular endothelial growth
factor receptor expression through a novel recognition sequence. Journal
of Biological Chemistry 273, 19294–19303.
Kalenik, J. L., Chen, D., Bradley, M. E., Chen, S. J. & Lee, T. C. (1997).
Yeast two-hybrid cloning of a novel zinc finger protein that interacts with
the multifunctional transcription factor YY1. Nucleic Acids Research 25,
843–849.
Kennett, S. B., Udvadia, A. J. & Horowitz, J. M. (1997). Sp3 encodes
multiple proteins that differ in their capacity to stimulate or repress
transcription. Nucleic Acids Research 25, 3110–3117.
Klug, J. & Beato, M. (1996). Binding of YY1 to a site overlapping a weak
TATA box is essential for transcription from the uteroglobin promoter in
endometrial cells. Molecular and Cellular Biology 16, 6398–6407.
Kwon, H. S., Kim, M. S., Edenberg, H. J. & Hur, M. W. (1999). Sp3 and
Sp4 can repress transcription by competing with Sp1 for the core ciselements on the human ADH5\FDH minimal promoter. Journal of
Biological Chemistry 274, 20–28.
Liu, J. M., Green, S. W., Hao, Y. S., McDonagh, K. T., Young, N. S. &
Shimada, T. (1991). Upstream sequences within the terminal hairpin
positively regulate the P6 promoter of B19 parvovirus. Virology 185,
39–47.
Luo, W. & Astell, C. R. (1993). A novel protein encoded by small RNAs
of parvovirus B19. Virology 195, 448–455.
Momoeda, M., Kawase, M., Jane, S. M., Miyamura, K., Young, N. S. &
Kajigaya, S. (1994). The transcriptional regulator YY1 binds to the 5h-
terminal region of B19 parvovirus and regulates p6 promoter activity.
Journal of Virology 68, 7159–7168.
Nielsen, S. J., Præstegaard, M., Jørgensen, H. F. & Clark, B. F. C.
(1998). Different Sp1 family members differentially affect transcription
from the human elongation factor 1 A-1 gene promoter. Biochemical
Journal 333, 511–517.
Ozawa, K., Ayub, J., Hao, Y. S., Kurtzman, G., Shimada, T. & Young, N.
(1987). Novel transcription map for the B19 (human) pathogenic
parvovirus. Journal of Virology 61, 2395–2406.
Pattison, J. R., Jones, S. E., Hodgson, J., Davis, L. R., White, J. M.,
Stroud, C. E. & Murtaza, L. (1981). Parvovirus infections and
hypoplastic crisis in sickle-cell anaemia. Lancet i, 664–665.
Qin, H., Sun, Y. & Benveniste, E. N. (1999). The transcription factors
Sp1, Sp3, and AP-2 are required for constitutive matrix metalloproteinase2 gene expression in astroglioma cells. Journal of Biological Chemistry 274,
29130–29137.
Reid, D. M., Reid, T. M., Brown, T., Rennie, J. A. & Eastmond, C. J.
(1985). Human parvovirus-associated arthritis : a clinical and laboratory
description. Lancet i, 422–425.
Tsai, C. N., Lee, C. M., Chien, C. K., Kuo, S. C. & Chang, Y. S. (1999).
Additive effect of Sp1 and Sp3 in regulation of the ED-L1E promoter of
the EBV LMP 1 gene in human epithelial cells. Virology 261, 288–294.
Vassias, I., Hazan, U., Michel, Y., Sawa, C., Handa, H., Gouya, L. &
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12
BEHJ
U. Raab and others
Morinet, F. (1998). Regulation of human B19 parvovirus promoter
expression by hGABP (E4TF1) transcription factor. Journal of Biological
Chemistry 273, 8287–8293.
Wingender, E., Chen, X., Hehl, R., Karas, H., Liebich, I., Matys, V.,
Meinhardt, T., Pruß, M., Reuter, I. & Schacherer, F. (2000).
Wildhage, I., Trusheim, H., Goke, B. & Lankat-Buttgereit, B. (1999).
TRANSFAC : an integrated system for gene expression regulation.
Nucleic Acids Research 28, 316–319.
Gene expression of the human glucagon-like peptide-1 receptor is
regulated by Sp1 and Sp3. Endocrinology 140, 624–631.
Received 24 October 2000 ; Accepted 26 January 2001
BEIA
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 12 Jun 2017 07:12:12