Download What are enzymes and how do they work

POGIL Cell Biology Activity 9 – PCR
Schivell
MODEL 1:
Note: For this activity you
will need colored pens or
pencils – black, blue, green,
and red.
This shows the black
molecule expanded at
two levels of detail:
Test
Tube
= enzyme that can synthesize the
black molecule and has an optimal
working temperature of 72°C
Each color reactant in the test tube is expanded in detail, by appropriate color. (Color is for
this activity only. In reality all molecules are colorless).
Questions:
1. For each color, write what type of molecule it is in as much detail as you can. (Black is given
as an example):
a. black: double stranded DNA b. red: ___________________________
c. green: ____________________ d. blue:____________________ e. gray: ____________________
2. Label the 5' and 3' ends of all nucleic acid strands in the model (except in the test tube).
3. a. Are the green and blue molecules complementary to each other? __________
b. Are the green and blue molecules complementary to a part of the black molecule? ______
c. Label the parts of the black molecule that are complementary to the green and blue ones.
1
POGIL Cell Biology Activity 9 – PCR
Schivell
MODEL 2:You reheat the test tube from Q #8 to 95°C. Hydrogen bonds break and
produce the four separated nucleic acid strands below:
.............TTGCCATAGTTCGGCCATTTAGCCAGGAAA..........
ATAGTTCGGCCATTTAGCCAGGAAA...........
.............AACGGTATCAAGCCGGTAAATCGGT
.............AACGGTATCAAGCCGGTAAATCGGTCCTTT............
MODEL 3:The DNA strands in the tube after cycle 2 are given for you below:
.............TTGCCATAGTTCGGCCATTTAGCCAGGAAA..........
ATAGTTCGGCCATTTAGCCAGGAAA...........
ATAGTTCGGCCATTTAGCCAGGAAA...........
ATAGTTCGGCCATTTAGCCA
TATCAAGCCGGTAAATCGGT
.............AACGGTATCAAGCCGGTAAATCGGT
.............AACGGTATCAAGCCGGTAAATCGGT
.............AACGGTATCAAGCCGGTAAATCGGTCCTTT............
2
POGIL Cell Biology Activity 9 – PCR
These questions refer to Model 1:
Schivell
4. Imagine that this test tube was heated up to about 95°C, a temperature at which all
hydrogen bonds are broken. Which of the following best represents what the black molecule
will look like? (Circle ONE)
5. Then imagine that the test tube was cooled to about 60°C, a temperature at which hydrogen
bonds can reform. Green, blue and black molecules can bind in two distinct ways. Sketch
each below.
(It is CRUCIAL that you use appropriate colors to indicate different molecules at this point.)
OR
6. Based on the concentrations of molecules seen in the test tube, which conformation in "5" is
more likely? Why?
7. Finally, the test tube is heated to 72°C. Using the conformation that is more likely from "5",
draw what you will find after the enzyme does its job. Again, it is CRUCIAL that you use
appropriate colors and write in all sequences.
.............TTGCCATAGTTCGGCCATTTAGCCAGGAAA..........
.............AACGGTATCAAGCCGGTAAATCGGTCCTTT............
8. How many new strands have you synthesized by completing steps 4, 5, and 7? _____
9. Have you "used up" or changed any of the original molecules in the test tube? Explain.
3
POGIL Cell Biology Activity 9 – PCR
These questions refer to Model 2:
Schivell
10. a. In Model 2, add in green and blue molecules in the locations that they will bind when
the test tube is cooled to 60°C.
b. In Model 2, draw in the red strands synthesized when the temperature is raised to 72°C.
11. a. How many new strands were synthesized in this 2nd cycle? ___________
b. How many strands of different lengths do you now have in the test tube?_________
(Ignore the original blue and green molecules)
c. What is the length of the shortest strand(s)? ____ How many are there of this length? _____
12. How does the enzyme know to stop synthesizing DNA? _____________________________
These questions refer to Model 3:
13. Repeat the steps in Q#10 to generate DNA from a 3rd cycle in Model 3. For red
nucleotides you can skip writing sequence and just use arrows.
14. a. How many new strands were synthesized in the 3rd cycle? _________
b. What is the length of the shortest strand(s)? ____ How many are there of this length? _____
15. Think about the original test tube – nothing has been added or taken away. For each color,
has the number of original molecules available for synthesis increased, decreased or stayed the
same?
black: _________
blue: _________ green: _________ red: _________
gray:_________
16. Using your answers to Q #s 8, 11a, and 14a, predict the number of new strands that will be
synthesized in... (you can use exponential notation).
... cycle 4: ______
... cycle 10: ______
... cycle 30: ______
4
POGIL Cell Biology Activity 9 – PCR
Schivell
17. This technique is referred to as the "Polymerase Chain Reaction" or PCR. What is the
connection between your answers in Q #16 and this name?
18. a. Using your answers to 11c and 14b, estimate the number of strands of the shortestlength
that will be synthesized in...
... cycle 4: ______
... cycle 10: ______
... cycle 30: ______
b. Will strands EVER get shorter than what you predicted in Q12 and 15? Explain.
19. After 10 cycles, the majority of strands in the test tube will be of what length? ________
20. In your own words, describe the ultimate purpose of PCR.
21. In each PCR cycle there are three temperature steps. The names for the three steps are
"elongation", "melting (or denaturing)" and "annealing". Match these names with the
appropriate temperature:
95°C: ______________________________
60°C:______________________________
72°C: ______________________________
22. When scientists prepare a PCR reaction, they add the following items (in addition to some
buffers). Match each item with its appropriate color(s) from Model 1:
Template: __________________
Primers: __________________
Taq polymerase: __________________
dNTPs: __________________
5
POGIL Cell Biology Activity 9 – PCR
On Your Own:
Schivell
1. Imagine that instead the blue and green molecules were complementary to the same black
strand (shown below).
a. Using a new green primer: 5' TATGG 3', use the template below to draw out some products.
.............TTGCCATAGTTCGGCCATTTAGCCAGGAAA..........
b. After two cycles, would you have made any strands of the length you calculated in Q#11?
using the strand below and then explain your answer.
c. Would you expect to see an exponential increase in total DNA strand number from cycle to
cycle? Why or why not?
2. Compare DNA replication in vivo with PCR in vitro. For each replication component listed
in the table below, write the equivalent used in PCR in the blank, using the terms introduced
in Q#22. In some cases, a particular temperature is used instead of a component. Write that
temperature in. In other cases, the component is not needed, so write "not needed".
DNA replication (in vivo)
Polymerase Chain Reaction (PCR)
template DNA
primase enzyme
activated nucleotides
DNA polymerase III
DNA polymerase I
Ligase enzyme
Helicase enzyme
Topoisomerase enzyme
3. a. What is the most likely source for the "Taq DNA polymerase enzyme" used in PCR?
(Circle ONE)
- a bacterium living in Antarctica
- mouse cells
- human cells
- a bacterium living in a hot spring
6
POGIL Cell Biology Activity 9 – PCR
Schivell
b. Which type of bond found at the 3° level of protein structure is more prevalent in Taq
DNA polymerase compared to human DNA polymerase?
The following questions will make more sense after you have discussed "gel
electrophoresis" in lab this week:
4. A woman comes to you for help because she and her husband are having trouble getting
pregnant. You suspect there might be a mutation in an autosomal gene thought to be
essential for early cleavage of the zygote. Part of this gene's wild-type sequence (in the ORF)
is shown below. There are dotted lines every 5 base pairs (bp) to help you with counting, and
280 bp are left out.
Wild type: 5’ GAAATCCCGTAAAGATCGAT.... 280 bp ....ACGATAGCGGCCTCTAATGC 3’
3’ CTTTAGGGCATTTCTAGCTA....
....TGCTATCGCCGGAGATTACG 5’
a. Using the sequence above, design primers that amplify ONLY the target DNA (shown in
the box). Make your primers 8 nucleotides long. Please LABEL the 5' and 3' ends of your
primers.
____________________________________
____________________________________
b. Real PCR primers would be much longer than 8 nucleotides. Why would using primers
that are too short be bad for PCR when using a person's whole genome as a template?
(Circle the BEST reason)
- Taq polymerase cannot add new nucleotides to shorter primers
- Shorter primers would not bind to the template DNA
- Shorter primers are more likely to bind in many places in the template DNA
dad
c. After completing PCR reactions with appropriate
primers, you separate them on the gel to the right:
i. What are the genotypes of: Dad ____________
(use "300" and "100" for
the allele names)
Mom ____________
mom
ladder
bp
400
300
100
ii. Given your parental genotypes, what
are the possible embryonic genotypes? ____________________________
d. After fertilizing 50 of the woman's oocytes with the husband's sperm in the lab, you find
that ALL of them get fertilized, but none complete their first cell division. Why is the
embryonic phenotype the same for all embryos? (no more than 2 sentences)
7
POGIL Cell Biology Activity 9 – PCR
Schivell
e. Is the mutant allele dominant or recessive? How do you know? (No more than 2 sentences)
5. The two alleles of the PV92 locus (that you studied in lab) are shown below. The “+” allele
has the 300 bp “Alu” insertion sequence inserted into the “-“ allele as shown. The dotted lines
are placed every 5 bp to help with counting.
“-“ allele: 5’ GCGTGCAGATCGATACGATAGATCTTAATG 3’
3’ CGCACGTCTAGCTATGCTATCTAGAATTAC 5’
“+” allele
insertion:
5’ GGGCTCGTAC(280nt)TAAACGATAG 3’
3’ CCCGAGCATG(280nt)ATTTGCTATC 5’
a. Circle two of the following primers for PCR you could use to genotype individuals at the
PV92 locus.
5’CATTAAG3’
5’GGGCTCG3’
5’GCGTGCA3’
5’CTATCGT3’
5’CCCGAGC3’
b. What is the size of the strands
you would expect to amplify for each allele? “+“ allele: __________bp “-” allele:
__________bp
c. Which of the primers you chose in “a” would bind more “tightly” to the template DNA?
Why?
d. Using different PCR primers that give you fragments of 150 and 450 bp for the two PV92
alleles, you genotype 4 different classmates with diverse ancestries. You find the following
results after separating the PCR products by gel electrophoresis and staining: classmate #
i. Which classmates have the Alu insertion? ________
MMR
bp
400
ii. What is the simplest explanation for the odd
results you see in the gel? (1-2 sentences)
300
100
8
1
2
3
4