Download Mutations KEY File

Mutations
Go to this site:
http://evolution.berkeley.edu/evolibrary/article/0_0_0/mutations_02
And answer the following questions
1. Give an example of how a silent substitution mutation could occur with the codon of GGA using
the table below and explain why it would be considered silent.
If you look at the table, the box on the bottom most right corner has all codons that start with
GG and they all code for the amino acid GLY. Therefore any one of those sequences
GGU
GGG
GGC
Would be considered silent because although there was a change to the base code, there was
NOT a change to the amino acid it coded for.
2. Divide up the amino acid sequence by putting spaces between the codons, then write out the
amino acid sequence for this strand of mRNA using the table above:
AUGAGAACUUUUUGUCGUGGUCCCCCCUGA
AUG AGA ACU UUU UGU CGU GGU CCC CCC UGA
Met
3.
Arg
Thr
Phe
Cys
Arg
Gly
Pro
Pro
Stop
Replace the second ”A” with “C”
AUGCGAACUUUUUGUCGUGGUCCCCCCUGA
a. What type of mutation is this? (substitution, insertion, or deletion?
Substitution
b. Would it be considered a frameshift mutation? Why or why not?
It would NOT be considered a frameshift mutation because it does not shift the reading
of the rest of the code… the amino acids after that mutation would still be the same.
c. Rewrite the amino acid sequence with the mutated strand.
Met
Arg Thr Phe
Cys
Arg
Gly
Pro Pro
Stop
d. Is this considered a “silent” mutation (a mutation that causes no changes) or is it an
“expressed” mutation (a mutation that causes a change in the amino acid sequence, and
therefore a change in the protein?)
It is a silent mutation because the amino acid sequence is unchanged.
4. Take the same strand and remove the 4th "A" then divide the strand up into codons by adding in
spaces.
AUGAGAACUUUUUGUCGUGGUCCCCCCUGA
AUG AGA CUU UUU GUC GUG GUC CCC CCU GA
a. What type of mutation is this? (substitution, insertion, or deletion?)
deletion
b. Would it be considered a frameshift mutation? Why or why not?
Yes, this is a frame shift mutation because all of the codons are changed after the
mutation.
c. Rewrite the amino acid sequence with the mutated strand.
Met Arg Lev Phe Val Val Val Pro Pro
d. Is this considered a “silent” mutation (a mutation that causes no changes) or is it an
“expressed” mutation (a mutation that causes a change in the amino acid sequence, and
therefore a change in the protein?)
This is an expressed mutation. The protein has changed because the amino acid
sequence has changed. Hopefully some students mention that the amino acid chain
would not detach from the ribosome as there is no stop codon triggering the release.
5. What are two sources of mutations?
Copying error and external influences
6. A chemical or agent that causes mutations are known as a “mutagen” do a google search to see
if you can identify 2 common mutagens that humans can be exposed to.
Some common mutagens might be x-rays and UV rays.
7. In what type of cell does a mutation have to occur to in order to pass the mutation on to an
offspring?
It would have to occur in a egg or sperm cell, which is called a germ line mutation
8. Spiderman was bitten by a radioactive spider that mutated the DNA in every cell of his body in
exactly the same way *(extremely unlikely to happen). If Spiderman has kids, will his kids get
the mutated DNA?
As long as it changed his sperm cells as well, he would pass this mutation on to his offspring
9. Define “phenotype” (use google)
The physical characteristics of an organism
10. What are 3 common effects of mutations?
No change is observable, small changes in the phenotype, big changes in the phenotype
11. Why are Hox Genes so powerful? Give an example of a mutation that can occur when a Hox
Gene is mutated.
Because they code for body layout. An example of a mutation would be in fruit flies where the
Hox gene was mutated the flies had legs growing where antennas should be.
Hemoglobin is a protein found in red blood cells. The function of hemoglobin is to
absorb oxygen from the lungs and release it to body cells that require oxygen.
Sickle cell anemia is a genetic disorder that causes a change in the shape of
hemoglobin
12. Look at the mutation in the DNA sequence that causes sickle cell. What type of mutation is this?
(insertion, deletion or substitution?)
Substitution
13. What happens to the hemoglobin that has the mutation?
The hemoglobin becomes linked together
14. What are the negative effects at the cellular and whole organism level?
The negative effects at the cellular level is that the red blood cell can be stuck in blood vessles
15. What is the positive effect of sickle cell anemia at the whole organism level?
The positive effect is that people who carry the sickle cell gene are resistant to malaria.
16. A scientist samples the occurrences of the sickle cell gene in two populations. One population is
near the equator in a hot, humid climate that breeds mosquitos whose bite can infect people
with malaria. The other population lives in a dry arid region that has few mosquitoes. Where
would you expect to have the higher occurrences of sickle cell genes and why?
You would expect to have the higher occurrences of sickle cell anemia in regions where there
are malaria bearing mosquitoes because it protects people who carry it against malaria. People
who carried the gene would survive and reproduce, passing the gene on. There is no benefit to
sickle cell anemia in regions that don’t have malaria bearing mosquitoes, so there would be a
lower incidence of the gene because people who expressed the trait would be more likely to die
and not pass on the trait.
17. Cleaning products, hand sanitizers and hand soaps can now be bought in an “antibacterial”
variety. Do you see any potential issues with constantly using antibacterial products?
The problem with constantly using antibacterial products is that you continually kill off the
bacteria that dies from antibiotics, but the ones that are resistant survive and reproduce. Then
you apply the antibacterial again, and kill off the weakest of that generation… each application
ensures that only the bacteria that survive are resistant to antibacterials until you have a strain
of bacteria that is resistant to antibacterial products.
18. Hospitals often use antibiotics to sterilize. Hospitals have also been the site of “super bacteria;”
bacteria that are resistant to many antibiotics. Why do you think these hospitals becoming
breeding grounds for these strains of bacteria? Why might this present a big problem?
Same reasoning as above, but here they exist in environments where many types of antibiotics
are used and create bacteria that are resistant to many different types of antibiotics. This is
problematic because strains of bacteria are popping up that can’t be killed. If someone gets an
infection they could be sick for months or die from it without having any antibiotics be effective
on the infection.