Download Name - Humble ISD

Name: ____________________________
A Comparison of Genetic Relationships
I. Did you learn and remember… or memorize and forget? 
1. What is Chargaff’s rules for DNA base pairing?
2. How are the rules different when DNA nucleotides base pair with RNA nucleotides?
3. What are the two other ways RNA differs from DNA?
4. What is the name used to describe DNA wrapped in protein?
5. What term is used to describe the sequence of nucleotides in that DNA molecule that codes for a trait?
6. What is the term used to describe the sequence of nucleotides in mRNA that codes for an amino acid?
II Comparing Evolutionary Relationships Through Genetics
There are three partial DNA sequences listed below that code for a protein, hemoglobin in three different
organisms. Use base pairing rules and the codon chart in your book, to identify the amino acids specified by each
DNA sequence. Then answer the questions below.
Organism A
DNA
GCAGAGCTAGAGCATACCCAAGAGCGGGTA
mRNA
_____________________________________________________________________
Amino Acids _____________________________________________________________________
Organism B
DNA
GAGGAGCTAGAGCATACGCAAGAACGCGTA
mRNA
_____________________________________________________________________
Amino Acids _____________________________________________________________________
Organism C
DNA
GCAGAGCTAGAGCGGGAGCAAGAACGCGCA
mRNA
_____________________________________________________________________
Amino Acids _____________________________________________________________________
1. Compare B to A. How many amino acids do they share?
2. Compare C to A. How many amino acids do they share?
3. Which organism, B or C, is most closely related to organism A?
4. Organism A represents a human. Match the scientific classification for Organism B and Organism C.
Kingdom
Phylum
Class
Order
Family
Genus
Species
Animalia
Chordata
Mammalia
Primate
Hominidae
Troglodytes
beringei
Animalia
Chordata
Mammalia
Perissodactyla
Equidae
Equus
caballus
Organism
_______
________
Unit 12 Worksheet: Survival of the Fittest
Scenario: Consider the following fictional description
Warbels are small mammals that live in the desert and feed on seeds. All warbles
look exactly the same. The only variation found in warbles is the time of day they forage for
food-some warbles are nocturnal (active at night) and some warbles are diurnal (active
during the day). The primary predators of warbles are owls, which hunt only at night.
Analyze and Conclude:
1. Do you think nocturnal warbles and diurnal warbles have equal chances of being eaten by owls? Explain
your reasoning. __________________________________________________________________________
__________________________________________________________________________________________
2. Do you think that nocturnal warbles and diurnal warbles produce the equal number of offspring? Explain
__________________________________________________________________________________________
__________________________________________________________________________________________
3. Which type of warbles is more fit? Explain. ___________________________________________________
__________________________________________________________________________________________
4. Over long period of time, changes can occur in warbles as a result of evolution. Based on the answers you
have given in this activity, what sorts of changes do you think could occur in warbles due to
evolution/natural selection? Explain your reasoning. ____________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
Horsing around with Evolution:
As you know, evolution is a gradual process of change over time, and evolution is the result of natural selection.
What many people do not realize, however, is that the evolution of a species is a continuous process whit no
definite end. Modern plants and animals- and, of course, humans- are subject to the forces of natural selection
today, just as they were millions of years ago. In this activity, you will study the stages in the evolution of the
horse in order to answer the questions:
1. Study the diagram of the four stages of horse evolution. Describe all the changes that you see.
_______________________
_____________________________________
_____________________________________
_____________________________________
2. A species evolves because of selection
pressures in its environment. For example,
each species of Darwin’s finches evolved
a certain beak size and shape in response
to the kind of food available. Food
availability is only one of many factors
that influence the evolution of traits. What
aspects of a horse’s environment of
lifestyle do you think caused it to evolve as it did?
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
3. Modern horses are well adapted to today’s grassland ecosystem. Fifty million years from now, grasslands
may become mountains. If this happens, how do you think horses will change? Describe this future horse.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________