Download Supplemental Methods

Supplemental Methods
Materials and methods
Antibodies
Primary antibodies: Rabbit anti-PBK, rabbit anti-p53, and a mouse monoclonal
antibody against p21 were purchased from Cell Signaling Technology (Danvers
MA, USA); rabbit anti-Beta Actin, rabbit anti-GFP polyclonal antibodies and antiFLAG M2 monoclonal antibody were purchased from Sigma-Aldrich (St. Louis
MO, USA).
Secondary antibodies: Both HRP-conjugated donkey anti-Rabbit IgG and HRPconjugated sheep anti-Mouse IgG were purchased from GE Healthcare
Amersham (Piscataway, NJ, USA).
Cloning vectors
The mammalian expression vector p3xflag-cmv-7.1 was purchased from SigmaAldrich (St. Louis MO, USA). The mammalian expression vector pEGFP-N1 and
yeast two-hybrid vectors pGBKT7 and pGADT7 were purchased from Clontech
(Mountain View, CA, USA).
Gene microarray studies
HCT116-RS and HCT116-shPBK cells were treated with 1 M doxorubicin for 24
hrs. Cellular RNA was extracted from cells using the RNeasy Mini Kit from
Qiagen (Valencia, CA, USA). Experimental procedures and quality controls for
1
microarray analysis were performed by The Biopolymer/Genomics Core Facility
at University of Maryland School of Medicine according to the instructions of
Affymetrix. Labeled cRNA was hybridized onto Affymetrix (Santa Clara, CA,
USA) GeneChip® Human Gene 1.0 ST Array using recommended procedures
for hybridization, washing, and staining. The GeneChips were scanned, and
feature quantitation was done using Affymetrix MAS5.0 (www.affymetrix.com).
Data quality was accessed using Affymetix Expression Console and dChip
software (Li and Wong, 2001) (www.dchip.org).
The Human Gene 1.0 ST Array was analyzed with Expression Console software
from Affymetrix and aroma.affymetrix package in R (http://cran.rproject.org/web/packages/aroma.affymetrix/index.html). The data are
preprocessed with standard normalization procedures. Two-side standard T-test
with common variance is used to identify the statistical significant genes. Genes
are selected with both fold-change and P value (<=0.05).
Plasmid constructions
For PCR reactions and DNA cloning, a high fidelity DNA polymerase enzyme
Platinum Taq DNA Polymerase High Fidelity and 100 mM dNTP set were used
(Invitrogen, San Diego, CA, USA). Restriction enzymes BamHI, HindIII, NheI,
KpnI and a DNA ligase kit Quick Ligation™ Kit were purchased from New
England Biolabs (Ipswich, MA, USA).
p3xflag-PBK was constructed by inserting the cDNA sequence encoding PBK
2
into restriction sites EcoRI and KpnI of the mammalian expression vector
p3xflag-cmv-7.1.
The
primers
were:
catggaattcagaagggatcagtaatttcaagacac-3’;
forward
reverse
-
5’
5’-
catgggtaccgagctagacatctgtttccagagcttca-3’.
The PBK knockdown construct pRS-shPBK, empty vector pRS-vec and negative
control vector pGFP-V-RSs were purchased from Origene Technologies
(Rockville, MD, USA). The targeting sequences in pRS-shPBKs were: for pRSshPBK1, 5’- AGCCAATGATGGCAGTCTGTGTCTTGCTA-3’; for pRS-shPBK2, 5’ACTCTGGACTGAGAGTGGCTTTCACAATG-3’.
The p53 mammalian expression constructs were created by inserting the full or
partial cDNAs of the p53 coding sequence into restriction sites EcoRI and BamHI
of the pEGFP-N1 (Clontech, Mountain View, CA, USA). For pEGFP-p53-wt,
pEGFP-p53-mt1, pEGFP-p53-mt2, pEGFP-p53-mt3, the same reverse primer
was used for each mutant construct: 5’-catgggatcccagtctgagtcaggcccttctg-3’; the
forward primers were: 5’-catggaattcatggaggagccgcagtcag -3’ (mt1); 5’-catggaattc
atgaaaacctaccagggcagctac-3’ (mt2); 5'-catggaattcatggggagcactaagcgagcact-3
(mt3). For the pEGFP-p53-DBD plasmid construct, the primers were: forward: 5'catggaattcatgctgtcatcttctgtcccttccca-3'; reverse: 5'-catgggatccgcgggcagctcgtggtg
aggc-3'.
For the yeast two-hybrid studies, the bait plasmid pGBKT7-PBK was constructed
3
by inserting the coding sequence of full length PBK into restriction sites EcoRI
and BamHI of bait vector pGBKT7. The primers were: forward: 5’ -catggaattcgaa
gggatcagtaatttcaagaca c-3’; reverse: 5’ -catgggatcccctagacatctgtttccagagcttca-3’.
Prey plasmids were constructed by inserting full length or fragments of p53
coding sequence amplified from a plasmid harboring the full length p53 cDNA
into prey vector pGADT7 using restriction sites EcoRI and BamHI. To ensure
that the fragments of p53 in the prey plasmids corresponded to those in the p53
mammalian expression constructs, the same forward primers were used while
the reverse primer was minimally modified so that the p53 coding sequences
were placed in frame into the pGADT7 vector. The reverse primer for pGADT7p53-wt,
pGADT7-p53-mt1,
pGADT7-p53-mt2,
pGADT7-p53-mt3
was:
5’-
catgggatccctcagtctgagtcaggcccttct -3’. The primers for pGADT7-p53-DBD were:
forward
-
5'-catggaattcctgtcatcttctgtcccttccca-3';
reverse:
5'-
catgggatccgctagggcagctcgtggtgaggc-3'.
The reporter construct pp53-TA-luc, in which luciferase expression is under
control of two p53 binding fragments, was purchased from Clontech (Mountain
View CA, USA). The p21 promoter reporter construct p21-luc was a generous gift
from Dr. Bert Vogelstein at Johns Hopkins University School of Medicine.
Cell lines, cell culture and transfection studies
The HCT116 human colon carcinoma cells were maintained in McCoy's 5A
4
medium supplemented with 10% fetal bovine serum (Quality Biological, Inc.
Gaithersburg, MD, USA), and 1% penicillin/streptomycin. HCT116 derivative cell
lines HCT116-p53-/- and HCT116-p53+/- were generously provided by Dr. Bert
Vogelstein at Johns Hopkins University School of Medicine. MCF7 cells were
maintained in DMEM medium supplemented with 10% fetal bovine serum and
1% penicillin/streptomycin. New stable cell lines obtained after transfection were
maintained in the same media supplemented with 2 g/ml puromycin. RNAis and
plasmids were transfected into cells using LipofectamineTM 2000 (Invitrogen, San
Diego, CA, USA) following the manufacturer’s instructions.
PBK Validated
Stealth RNAi, Stealth RNAi Negative Control, Dnase I and recombinant
RNAseOUT were purchased from Invitrogen (San Diego, CA, USA). Doxorubicin
was purchased from Sigma-Aldrich (St. Louis, MO, USA).
Immunoprecipitation studies
For co-immunoprecipitation of endogenous PBK and p53, HCT116 cells grown in
a 100mm Petri dish were lysed in standard radioimmunoprecipitation assay
(RIPA) buffer containing protease and phosphatase inhibitors.
Insoluble
materials were removed and the supernatant was precleared with 20 l protein
A-Agarose beads and 20 l protein G-Agarose beads
(Santa Cruz
Biotechnology, Santa Cruz, CA, USA) that had been prewashed three times with
RIPA buffer before use. Precleared cellular extract was evenly transferred to 2
new 1.5 ml microcentrifuge tubes. 2.5 g of primary antibody specific for either
PBK or GFP was added to one microcentrifuge tube and the same amount of
5
normal preimmune IgG from the same origin was added to another tube. After 1
hr incubation at 4°C, 20 l prewashed protein A-agarose beads (Santa Cruz
Biotechnology, Santa Cruz, CA, USA) and 20 l prewashed protein G-agarose
beads (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were added to each
tube and immunoprecipitation was performed by rocking overnight at 4 °C. The
immunoprecipitates were eluted by the 2x SDS sample buffer and 1% of input
and 20% of bound fractions were resolved by SDS PAGE for Western blot
analysis. To roughly estimate the robustness of the interaction between PBK and
p53, densitometry measurements were performed using AlphaEaseFC software
and the Spot Denso tool (version 4.0.0, Alpha Innotech, San Leandro, CA), and
immunoprecipitated fractions were calculated as a percentage of the input
fraction.
To identify the p53 domain(s) responsible for protein-protein interaction between
PBK and p53 by co-immunoprecipitation, a mammalian expression construct
pEGFP-p53-wt was generated in which full length p53 cDNA was fused to the N
terminus of an EGFP tag. In addition, using the PCR products described above,
a series of GFP constructs were generated, each containing a p53 deletion
mutant lacking one or more functional domains. The first activation domain AD1
was deleted in pEGFP-p53-mt1; both activation domains AD1 and AD2 were
deleted in pEGFP-p53-mt2; both AD domains and the DBD domain (DNA
Binding Domain) were deleted in pEGFP-p53-mt3; and the pEGFP-p53-DBD
construct contained only the DBD domain. 10 g of plasmid p3xFlag-PBK, which
6
encodes a Flag-tagged PBK, together with 10 g of one of the above EGFP-p53
constructs expressing either the full length or deletion mutants of p53 were
cotransfected into HCT116 cells in 100 mm Petri dish plated on the previous day.
Transfected
cells
were
lysed
at
48
hrs
after
transfection
and
co-
immunoprecipitation was carried out as described above using cell lysates and a
monoclonal antibody for GFP (Sigma-Aldrich, St. Louis, MO, USA). 20% of each
precipitate was then resolved by SDS PAGE and blotted for PBK using a
monoclonal antibody against the Flag tag.
Yeast two-hybrid assay
All reagents for the Y2H assay were purchased from Clontech (Mountain View,
CA , USA) including the AH109 yeast host strain, the yeast transformation kit
Yeast Transformation Yeastmaker Systems 2, YPD medium, YPD agar medium,
Minimal SD Base, and -His/-Leu/-Trp Triple Dropout Supplements. The assay
was performed in accordance with the manufacturer’s instructions. The AH109
yeast strain was used for yeast two-hybrid analysis. Competent yeast cells were
made using Yeast Transformation Yeastmaker Systems 2 by following the
manufacturer’s protocol. 1 g of bait plasmid pGBKT7-PBK together with 1 g of
prey plasmid were used to transform competent AH109 cells. Transformants
were streaked on -His/-Leu/-Trp triple dropout plates and incubated at 25 °C for 7
days.
Pictures were taken using the BioSpectrumTM Imaging System (Ultra-
Violet Products, Cambridge, UK) to record the results.
7
Quantitative RT-PCR
HCT116 cells were transfected with PBK Validated Stealth RNAis and Scrambled
RNAi Negative Control. Total cellular RNAs were extracted 48 hrs after
transfection using RNeasy Mini Kit (Qiagen, Valencia, CA, USA). RNAs were
reverse transcribed into cDNA with the Reverse Transcription System (Promega,
Madison, WI, USA) according to the protocol provided by the manufacturer.
Quantitative RT-PCR analysis of p21 gene expression was carried out using
QuantiTect SYBR Green RT-PCR Kit from Qiagen (Valencia, CA, USA) on an
ABI 7900HT fast real-time PCR system, according to the manufacturer's
instructions.
The
primers
used
GGCAGACCAGCATGACAGATT
were
-3’;
as
follows:
reverse
forward
-
-
5’5’-
GCGGATTAGGGCTTCCTCTT -3’. Beta-actin transcripts were monitored as a
housekeeping control to quantify the transcripts of the p21 mRNA in each
sample, the primers used were: forward: 5'-aactccatcatgaagtgtgacg-3'; reverse 5gatccacatctgctggaagg-3'. To verify the results of the qPCR measurements, PCR
products were run on 3% agarose gels and sequenced after purification.
Quantitative PCR was also used to validate expression changes of 8 additional
known p53 target genes that are involved in cell cycle regulation or/and cellular
apoptosis following PBK knockdown. Among them there were: Dusp1, Thbs1,
Noxa, Bak, Fas, CaspP10 (up-regulated), and Bcl-xL (down-regulated). G2e3, a
newly characterized gene that is involved in G2/M cell cycle progression, was
found to be suppressed by PBK knockdown, but has not been established to be
8
a p53 target gene. The primers used for these qPCR assays are shown below:
Dusp1
forward: 5’-GTACATCAAGTCCATCTGAC-3’
reverse: 5’-GGTTCTTCTAGGAGTAGACA-3’
G2e3
forward: 5’- CAG GAA GGA AGT GAA TAG AGC-3’
reverse: 5’-TCT CTC TGA AGT CCA CAT GGG-3’
Thbs1: 178 bp
forward: 5’-CTGCTCCAATGCCACAGTTC-3’
reverse: 5’-GGAGCCCTCACATCGGTTG-3’
Noxa
forward: 5’-TGGAAGTCGAGTGTGCTACTCAA-3’
reverse: 5’-CAGAAGAGTTTGGATATCAGATTCAGA-3’
Bak
forward: 5’-GAACAGGAGGCTGAAGGGGT-3’
reverse: 5’-TCAGGCCATGCTGGTAGACG-3’
Fas
forward: 5’-GGGGTGGCTTTGTCTTCTTCTTTTG-3’
reverse: 5’-ACCTTGGTTTTCCTTTCTGTGCTTTCT-3’
Casp10
forward: 5’-CTGTGGGAGCGAATCGAGG-3’
reverse: 5’-AGCGCAAGATGTCCATCAGG-3’
BCL-xL
forward: 5’-ATGGCAGCAGTAAAGCAAGC-3’
reverse: 5’-CGGAAGAGTTCATTCACTACCTGT-3’
Western blot analysis
For Western blot analysis, 20 g of protein were fractionated on NuPAGE 4-12%
Bis-Tris Gels (Invitrogen, San Diego, CA, USA), and transferred to PVDF
membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with
5% fat free milk for 1 hr at room temperature and then probed with 1:1000
9
dilution of primary antibody overnight at 4oC, followed by incubation with 1:10,
000 dilution of horseradish peroxidase(HRP)-linked secondary antibody.
The
antibody-antigen complex was visualized by ECL chemiluminescence (GE
Healthcare Amersham, Piscataway, NJ, USA) and developed on Kodak Biomax
Light Film (Sigma, St. Louis, MO, USA). Membranes were reblotted with antibeta-actin antibody to control for uneven protein loading.
Luciferase assay
HCT116 cells were seeded in 12-well plates and grown to 80% confluence. On
the following day, cells were transfected with plasmids as indicated. In each
case, correspondent empty vectors were used to balance the amount of plasmids
used in each transfection. Cell lysates were harvested 48 hrs after transfection.
Luciferase activity was measured with the Dual-Luciferase Reporter Assay
System (Promega, Madison, WI, USA) on a Mithras LB 940 multimode Reader
(Berthold Technologies, Wildbad, Germany). The protein content in each sample
was measured and used to normalize the luciferase activity.
Cell growth studies using PBK knockdown stable cell line HCT116shPBK
To establish stable PBK knockdown cell lines, 5 μg of pRS-shPBK1 or pRSshPBK2 were transfected into HCT116 or MCF7 cells with the Lipofectamine TM
2000 transfection reagent. Starting twenty-four hrs after transfection, cells were
selected in 2 μg/ml puromycin (Sigma, St. Louis, MO, USA) for 3 weeks. Control
10
cell lines HCT116-RS, HCT116-V-RS and MCF7-RS, MCF7-V-RS were
established by transfecting cells with 5 μg of pRS-vector or pGFP-V-RS that
expresses a 29-mer scrambled shRNA and selecting under the same conditions.
Two separate HCT116 cell lines were established which expressed different PBK
shRNAs (HCT116-shPBK1 & HCT116shPBK2). Puromycin-resistant cells were
assayed for protein expression by immunoblotting with a monoclonal antibody
against PBK (Cell Signaling Technology, Danvers, MA, USA). 20,000 wild-type
HCT116-RS cells or PBK knockdown HCT116-shPBK cells were seeded on each
60 mm dish at day 0. Cells in 4 dishes of each cell line were counted using a
hemocytometer every 24 hrs for 5 days.
Chromatin immunoprecipitation assay
Chromatin immunoprecipitation assay was performed using the EZ ChIP kit by
following the supplier’s instructions (Milipore, Billerica, MA, USA). Briefly,
HCT116 cells were washed with PBS and treated with 1% formaldehyde for 10
min at room temperature. Fixation was quenched by addition of glycine 1.25M.
Cells were washed and scraped off the plates. Cells were then broken open with
SDS Lysis Buffer and sonicated 5 times for 15 s with a 1 min rest on ice
between each pulse on the sonicator at 20% output level to obtain fragments in
the 200-1000 pb range, as assessed by agarose electrophoresis. Samples were
aliquoted as 2x106 cell equivalent. The volume of aliquots was brought up to 1 ml
with Dilution Buffer and pre-cleared with salmon sperm DNA-blocked protein G.
10 ul of the precleared supernatant was set aside as Input. 2 g of a rabbit anti-
11
p53 antibody (Cell Signaling Technology, Danvers, MA, USA ) or the same
amount of control IgG was added to the rest of the supernatant and incubated
overnight at 4 °C. On the following day 60 l of Protein G Agarose was added to
each sample and incubated for another hour at 4 °C with rotation. Beads were
washed and immunocomplexes eluted into 200 l elution buffer. The DNA–
protein cross-linking was reversed with the DNA release buffer for 5 hrs at 65°C ,
followed by RNAse A treatment at 30 °C for 30 min and proteinase K treatment at
45 °C for 2 hrs. The DNA was purified using a column system included with the
kit. 1/25 of eluted DNA was subjected to 30 cycles of PCR amplification for
detection of p21 promoter fragment. The primers spanned a region of 287 bp
flanking the p53 responsive element on p21 promoter and the sequences were
as follow: forward- 5’- tggactgggcactcttgtc-3’; reverse - 5’-ct gtc gca agg atc tgc
tg-3’.
Site-directed mutagenesis
Site-directed mutagenesis was carried out using QuikChange® Site-Directed
Mutagenesis Kit Polymerase (Stratagene, La Jolla, CA, USA) according to the
manufacturer's instructions. The mutant constructs were sequenced to confirm
base changes before being used in yeast two-hybrid assays as described. The
sequences for the primers that were used are listed below:
R175H
forward: 5'- gaggttgtgaggcActgcccccaccatg-3'
reverse: 5'-catggtgggggcagTgcctcacaacctc-3'
R248W
12
forward: 5'- ggcggcatgaacTggaggcccatcctca-3'
reverse: 5'-tgaggatgggcctccAgttcatgccgcc-3'
R273H
forward: 5'- aacagctttgaggtgcAtgtttgtgcctgtcct -3'
reverse: 5'-aggacaggcacaaacaTgcacctcaaagctgtt-3'
G245S
forward: 5'- ttcctgcatgggcAgcatgaaccggagg -3'
reverse: 5'-cctccggttcatgcTgcccatgcaggaa-3'
R282W
forward: 5'-tcctgggagagacTggcgcacagaggaag-3'
reverse: 5'-cttcctctgtgcgccAgtctctcccagga-3'
Flow cytometry analysis
For FACS analysis, harvested cells were fixed in 80% ice-cold ethanol for 1 h.
Cells were then rehydrated in phosphate buffered saline (PBS), treated with the
propidium iodide staining solution (50 mg/ml propidium iodide and 0.5 mg/ml
RNaseA in PBS) for 30 min at room temperature and analyzed using an
FACSCalibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). The
percentage of apoptotic cells was determined by evaluating sub-G1 nuclei
accumulation.
Statistical analysis
Data are presented as means SD. The Student's t-test was used for statistical
analysis, with P<0.05 defined as significant. Longitudinal regression analysis
was conducted to compare the growth rates between the wild-type and PBK
knockdown cells.
13