Download Experimental procedures (detailed)

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Polycomb Group Proteins and Cancer wikipedia , lookup

Genomic library wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Epigenetics of human development wikipedia , lookup

RNA silencing wikipedia , lookup

Non-coding RNA wikipedia , lookup

History of RNA biology wikipedia , lookup

SNP genotyping wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Microsatellite wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

NEDD9 wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Primary transcript wikipedia , lookup

Metagenomics wikipedia , lookup

Mir-92 microRNA precursor family wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

RNA-Seq wikipedia , lookup

Transcript
Experimental procedures (detailed)
Plant materials
Greenhouse grown Plumbago zeylanica L. plants were used. Microspores and bicellular
pollen were staged according to Russell et al. (1996). For comparison, seedling stems,
roots, young leaves, petals, sepals, mature unpollinated ovules and early embryogenesis (72
h post-pollination) ovules were collected.
For sperm isolation, anthesis-stage pollen was placed in isolation buffer (10 mM
MOPS in 0.8 M mannitol, pH 4.6) for 5 min for sperm cell release and 12000 Sua and Svn
sperm cells were separated from MGUs according to size, shape, relative position and
association with vegetative nucleus (Zhang et al., 1998). Sperm cells were washed twice in
buffer, collected in 2 μl of mannitol solution, frozen in LN2 and stored at -80ºC.
The protocol of Zhang et al. (1998) used in this study provides highly purified Sua
and Svn sperm cells with higher intact cell percentages than centrifugation (Gou et al., 2001;
Okada et al., 2006a) or fluorescence-activated cell sorting (Engel et al., 2003). That
collections contained just one sperm type is supported by differential transcriptional
profiles for each sperm library and later results from real-time RT-PCR, custom
microarrays and in situ hybridization.
Total RNA isolation and cDNA synthesis
RNeasy plant mini kit (Qiagen, Valencia, CA) was used to purify total RNA for tissues.
Total RNA of sperm cells was isolated using Absolutely RNA microprep kit (Stratagene,
La Jolla, CA), precipitated by glycogen and ethanol.
RNA pellets of Sua and Svn were suspended in 3 µl RNase-free water and
immediately used for cDNA synthesis using the SMART PCR cDNA synthesis kit
(Clontech, Mountain View, CA). For comparable realtime RT-PCR analysis, 100 ng total
RNA of each sample (except Sua and Svn) were reverse transcribed to single-stranded cDNA
using Clontech SMART cDNA synthesis technology. The 10 µl reverse transcriptase
reaction contained 3 µl RNA, 1 μl 10 μM 3’-SMART CDS Primer IIA, 1 μl 10 µM
SMART IIA oligonucleotides. After denaturation at 70°C for 2 min, the reaction was
performed at 42°C for 1 h after mixed with 2 µl 5 first-strand buffer, 1 μl 20 mM DTT, 1
μl 10 mM dNTP each and 1 µl PowerScript reverse transcriptase. 40 µl TE buffer was
added to each reaction and long-distance PCR (LD-PCR) was used to amplify doublestranded cDNA from first-strand cDNA samples. The 100 µl reaction was composed of 4
µl first-strand cDNA template, 1X Advantage 2 PCR buffer, 0.2 mM dNTP each, 0.2 µM
5’ PCR Primer IIA and 2 µl 50X Advantage 2 polymerase mix. After denaturation at 95°C
for 1 min, PCR reactions were performed with 19 to 25 cycles (95°C 5 sec, 65°C 5 sec,
68°C 6 min). Optimal LD PCR cycle number was determined empirically to ensure all
cDNA samples were in exponential amplification phase. Usually, one cycle less than the
plateau of the PCR reaction was used to amplify experimental double-stranded cDNA from
the prepared SMART first-strand cDNA.
cDNA library construction
cDNA libraries were constructed using the Clontech SMART cDNA library construction
kit, which produces PCR-amplified cDNA with unique Sfi I sites, permitting size-
fractionated cDNA fragments to be ligated with Sfi I-cut lambda TriplEx2 arms. Ligation
reactions were packaged with Gigapack III Gold packaging reagents (Stratagene), with
resulting cDNA libraries amplified and stored in 7% DMSO at -80°C. Lambda phage
clones were converted to plasmid clones using the Clontech Cre loxP system.
Subtractive cDNA library construction used double-stranded cDNA synthesized
from ~12000 Sua and Svn sperm cells with the SMART PCR cDNA Synthesis kit.
Suppression subtractive hybridizations (SSH) between Sua and Svn sperm cells were
performed using the Clontech PCR-Select cDNA Subtraction kit, purified by QIAquick
PCR Purification Kit to eliminate small fragments.
Purified mixes were cloned into
pCR2.1-TOPO vector and transformed into Escherichia coli XL10-Gold cells.
Microarray experiments and data analysis
For each of the subtracted Sua and Svn cDNA libraries, 2304 putative recombinant white
colonies were selected and cultured in 96-well plates containing 140 μl ampicillin LB broth
overnight at 37°C. A 5 µl aliquot of the culture was used as template to amplify cDNA
inserts with universal primers NP1 (TCGAGCGGCCGCCCGGGCAGGT), and NP2R
(AGCGTGGTCGCGGCCGAGGT).
Quality and quantity of PCR products were
visualized using 1% agarose gel electrophoresis with 5 µl of PCR product and 0.2 μg/ml
ethidium bromide for eight of the 48 96-well plates, of which >95% produced one sharp
and bright band. PCR products were purified by ethanol precipitation, dissolved in 50%
DMSO, spotted onto Corning CMT-GAPS coated glass slides and air dried. Slides were
rehydrated over boiling water, dried again on a 90°C heating plate and crosslinked in a
Stratagene Stratalinker UV Crosslinker for prehybridization and hybridization. Targets
were prepared using unsubtracted cDNAs of Sua and Svn sperm cells labeled by indirect
random primer extension using Cy3 and Cy5 dye (Amersham Biosciences). Each 100 μl
labeling reaction contained 0.5 μg random hexamer oligonucleotide, 0.4 μM NP1 and 0.4
μM NP2R, 0.2 mM each dATP, dCTP, dGTP, 0.04 mM dTTP, 0.16 mM AA-dUTP, 10 μl
10X Advantage 2 PCR buffer and 2 μl Advantage 2 Polymerase Mix. After 5 min of
denaturation, the reaction was conducted using 3 cycles of 94°C for 1 min, 25°C for 1 min
30 sec, gradual warming (0.1°C/sec) to 50°C for 10 min and 68°C for 5 min. The AA–
dUTP labeled cDNAs were purified by QIAquick PCR purification kit, replacing PE buffer
with KPO4 washing buffer (5 mM KPO4, pH 8.0, 80% EtOH) (Hegde et al., 2000). The
purified labeling product aa-cDNAs then were dried and resuspended in 15 μl ddH2O.
Coupling reactions were performed 1 h at RT after 15 μl of 0.1 M sodium bicarbonate pH
9.0 and a Cy3 or Cy5 dye ester was added. Reactions were purified using the Qiaquick
PCR purification kit and eluted into 50 ddH2O.
Quality and quantity of the labeled cDNA were examined by measuring absorbance
at 260 nm, 550 nm for Cy3 and 650 nm for Cy5, with dye incorporation calculated
according to Hegde et al. (2000).
For each microarray hybridization, labeled targets
prepared with equal incorporation of 80 pmol of Cy3 or Cy5 dye were mixed, dried and
resuspended in 7.5 μl ddH2O. Five μl blocking oligos (0.3 mg/ml each NP1, NP2R and
complementary oligonucleotides) were added to the resuspended targets and denatured at
95°C for 3 min. After cooling on ice, targets and blocking oligos were mixed with 12.5 μl
4X hybridization buffer (RPK0325, Amersham Biosciences) and 25 μl formamide.
Hybridizations were performed at 42°C for 16 h after microarrays were prehybridized with
5X SSC, 0.2% SDS, 1% BSA, 100 µg/ml salmon sperm DNA at 42°C for 1 h. Post-
hybridization washing conditions were: 5 min, 0.5X SSC, 0.1% SDS; 2X 5 min, 0.1X SSC,
0.1% SDS; 5 min, 0.1X SSC. Slides were then dipped into water several times and dried.
Signal was detected using an Axon GenePix 4000A microarray scanner and data
were analyzed using GenePix Pro 4.0 software (Axon, Union City, CA). The GPR files of
the collected microarray data were transformed to TIGR MultiExperiment Viewer (MEV)
files by TIGR ExpressConverter (Version 1.7). MEV files of microarray data were then
introduced into Microarray Data Analysis System (MIDAS, version 2.19, TIGR) for
filtering and normalization. For raw data introduction, One Bad Channel Tolerance Policy
was set stringent and Channel A and B flags applied. Total intensity normalization was
applied using Cy3 as reference. Global mode of Lowess (Locfit) normalization was applied
to all experiments with smoothing parameter of 0.33. Slide Standard Deviation Regulation
was employed to normalize the data distribution among slides.
The resulting matrix was transformed to average log2 ratio value for each probe. A
4-fold or greater difference in probe expression between the Sua and Svn was used to
identify differentially-expressed genes in two sperm cell types of Plumbago zeylanica in
mature pollen.
Sequence analysis of Plumbago zeylanica sperm cell-generated ESTs
DNA sequencing reactions for representative cDNA libraries were performed using
TriplEx2 5’ Sequencing Primer (TCCGAGATCTGGACGAGC) and 3’ Sequencing
Primer (TAATACGACTCACTATAGGG). For clones from subtracted cDNA libraries,
M13 reverse primer was employed. Sequences were edited to omit sequences of linkers
and vectors.
To determine sequence identity, high quality cDNA sequences were searched
against GenBank non-redundant protein database and protein sequences of Arabidopsis
(TAIR 6.0 release) using BLASTX (Altschul et al., 1997) with Seqtools software interface
(http://www.seqtools.dk/). Transcripts were assigned as matches to a protein of known
identity if probability was <1.0×e-10. Genes with e-value >1.0×e-10 were also assigned if
nearly exact matches to sequences were observed. Clusters were assembled by Seqtools,
omitting unassembled ESTs shorter than 150 bp. Sequence identity between Sua and Svn
sperm cells, was indicated by local BLASTN searches with e-value <1.0×e-100. To compare
sequence similarities between ESTs of Plumbago zeylanica sperm cells and those of other
gamete-related cells or organs, local tBLASTx searches were performed with a cut-off
value of 1.0×e-10.
All EST sequences from representative sperm cDNA libraries and
subtracted sperm cDNA libraries have been deposited into GenBank.
Real-time RT-PCR analysis
Quantitative expression differences of sperm-derived transcripts were estimated by realtime RT-PCR using single-stranded cDNA from all samples pre-amplified before real-time
PCR using limited cycles, as described above. After purification and measurement, 10 ng
of double-stranded cDNA from each sample was used as template for real-time PCR, with
gene-specific primers in 20 μl reactions containing 1X SYBR buffer, 0.2 mM SYBR dNTP,
3 mM MgCl2, 50 nM each forward primer and reverse primer and 0.5 units of AmpliTaq
Gold DNA polymerase. Real-time PCR reactions were performed using 40 cycles (95°C
15 sec, 60°C 1 min 30 sec) with an ABI Prism 7000 SDS system (Applied Biosystems,
Foster City, CA). Data were analyzed using ABI Prism 7000 SDS Software. For each
examined gene, ΔCt between each tested sample and Sua was calculated. Expression levels
of each sample relative to Sua were shown by 2-ΔCt. Accession numbers of analyzed ESTs
and primers used are listed in Table S6.
Whole-mount in situ hybridization
Whole mount in situ hybridizations were conducted using published protocols (Bouget et
al., 1995, 1996; Torres et al., 1995). For nonradioactive whole mount in situ hybridization,
mature pollen was fixed in 1% glutaraldehyde in 50 mM Pipes buffer (pH 7.4) for 2 h at
RT, rinsed in Pipes buffer and stored in 70% ethanol at 4°C. After treating with xylene and
rehydration through a graded ethanol series, samples were treated by proteinase K.
Selected genes representative of different expression patterns were cloned into pBlueScript
II SK(+) vector (Stratagene). After templates were linearized, both sense and antisense
riboprobes were labeled with digoxigenin (DIG)-UTP using the DIG RNA Labeling Mix
(Roche Applied Science, Indianapolis, IN) and purified with a Qiagen RNeasy plant kit.
Hybridization signal was detected using a Roche alkaline phosphatase-conjugated anti-DIG
antibody with a DIG nucleic acid detection kit and counter-stained with DAPI to visualize
nuclei (Singh et al., 2002).