Download Summer 2006

BBSI Research Proposal – Summer 2006
Michiko Kato
Possible Functional Role of Short Dispersed Repeats
Introduction
Both eukaryotic and prokaryotic genomes are known to have repetitive DNA
sequences. However, it was thought that repeats were rare in prokaryotic genomes due to
their compact genomes and minimal non-coding regions1. The advancement in
computational genome analysis has permitted a more thorough examination of DNA
sequences. As a result, it is now clear that repeat sequences are widespread in prokaryotic
genomes. Short interspersed repeats are widely distributed within and among different
bacterial species. One such sequence, REP (Repetitive Extragenic Palindrome), was first
identified in E.coli. REP sequence is characterized as a 38-nt palindromic sequence
capable of forming stem-loop or cruciform2, 3. Another dispersed sequence, ERIC
(Enterobacterial Repetitive Intergenic Consensus), is preferentially located in non-coding
transcribed regions and consists of conserved inverted repeats3. The ubiquitous presence
of these patterned sequences suggests a function that selects for their persistence and/or a
rapid means of propagation. Several functional roles of these dispersed sequences have
been hypothesized and tested, but no role is fully understood.
Short dispersed repeats (SDR) are a novel type of dispersed repeats found in
Nostoc genome. During the examination of heptameric tandem repeats in tRNAleu introns
by Costa el al., it was discovered that a few of the strains contain a short, non-repetitive
sequence within the repeat regions4. These inserts vary in size and sequence, and a few of
these sequences have been found in other parts of the genome. These repeated elements
were examined in Nostoc genome as well as other cyanobacteria.
Progress Report
We have learned so far that SDR elements are distributed throughout Nostoc
punctiforme genome as well as the genomes of related cyanobacteria. SDR elements are
categorized into eight groups by sequence similarities and patterns. For example, SDR1 is
characterized with 10-nt core sequence flanked by inverted repeats. SDR distribution is
more diverse in Nostoc genome. The hypothesis that SDR insertion was a recent event in
evolution was examined by comparing orthologs between three closely related species.
There are several instances where SDR insertion was found inside of protein-coding
genes. Upon comparing the orthologs, we found that there are few cases where the SDR
insertion was unique to Nostoc. This finding supports that SDR insertion occurred after
Nostoc diverged from its ancestral Anabaena species (figure 1).
SDR1
N. punctiforme
NpR3667
Anabaena 7120
All4690
A. variabilis
Av?1342
Figure 1: An example of ortholog
comparison between three closely
related cyanobacteria. In this case,
SDR1 is only present in the gene of
Nostoc.
The mechanism of SDR propagation is unknown, but we observed some patterns
that indicate how these elements might have spread in Nostoc genome. Several different
SDR elements are sometimes located in close proximity to each other, forming
“composites”. These composite SDR are often composed of SDR1, 4, and 6. Further
analysis showed that these elements are interrupting SDR1 sequence (figure 2). This
suggests that the presence of one SDR element somehow creates the site for other SDR
elements to jump in.
TTGGGAACTTGTACTGAGTTTCGACTGCGCTCAACTACCGCGCAGTCGTAAAGCCTGCGGCATAGCTACGCTTAGGGCGCAGCCTCTCGTAGAGAAGTATGGGAA
SDR1
SDR6
CTTGTACTGAGCGCAGTCGTA
SDR1
SDR4
Figure 2: Graphical representation of
composite NIS. SDR1 sequence is
interrupted by three different SDR elements
Research Plan for Summer 2006
Further study of SDR2 will be the main focus for this summer. SDR2 is
characterized as either 24-mer (SDR2a) or 25-mer (SDR2b) that possesses 10-nt core
inverted repeats and often flanked by 7-nt tandem repeats.
SDR2 elements are preferentially located at the 3’ end of genes. Most of them are
found between two genes in parallel or convergent orientation. The structural
characteristics and their location suggest that SDR2 may have a role in transcriptional
regulation.
Espéli et al. studied bacterial repeat elements called BIMEs (Bacterial
Interspersed Mosaic Elements) for their potential involvement in transcription attenuation
and mRNA stabilization. BIMEs are flanked by palindromic units (PUs) and either
located on 3’ end of transcriptional units or in between genes that belong to the same
operon. Insertion of BIMEs between two genes on artificial operons resulted in the
reduction of the level of full-length mRNA and in the accumulation of smaller mRNA,
which corresponds to the size of the upstream gene5.
In order to test the hypothesis that SDR2 may contribute in transcriptional
regulation, SDR2 sequence will be synthesized and inserted between two genes. The
vector will be expressed in Anabaena PCC 7120 and the level of mRNA will be
measured by real-time PCR.
Methods
SDR2 and control sequences will be constructed from two oligomers and will be
cloned into pRL559 (figure 3). pRL559 is a shuttle vector which is capable of replicating
in both E.coli and Anabaena. It bears glnA promoter upstream of luxAB gene. I will
construct an expression vector by inserting SDR in the intergenic region of luxAB. The
vector will be expressed in wild type Anabaena PCC 7120 and RNA will be extracted for
RT-PCR analysis.
Kmr/ Nmr
ori
pDU1
luxB
SDR2a
luxA
Figure3: Representation of a vector with
SDR2a inserted in luxAB intergenic region
PglnA
Possible Results and Their Implications
The result of this experiment will answer the question whether SDR2 is involved
in transcriptional attenuation. If SDR2 can cause transcriptional termination, upstream
mRNA (luxA gene transcript) will be expected to accumulate, and the amount of fulllength transcript will decrease. The biggest challenge will be dealing with the technical
difficulties of the experiment. It will take time to construct the vectors as planned and
palindromic nature of SDR2 may become an issue when cloning the fragments. It may be
difficult to create the planned constructs, express them and perform assay within the
given time period.
Reference
1. Rocha E.P.C, Danchin A, and Viari A (1999). Functional and evolutionary roles
of long repeats in prokaryotes. Res. Microbiology. 150: 725-733
2. Stern MJ, Ferro-Luzzi Ames G et al. (1984). Repetitive Extragenic Palindromic
Sequences: A major component of the bacterial genomes. Cell. 37: 1015-1026
3. Lupski JR and Weinstock GM (1992). Short, interspersed repetitive DNA
sequences in prokaryotic genomes. Journal of bacteriology. 174: 4525-4529.
4. Costa JL, Paulsrud P, and Lindblad P (2002). The cyanobacterial tRNAleu (UAA)
intron: Evolutionary paterns in a genetic marker. Mol. Biol. Evol. 19: 850-857.
5. Espéli O, Moulin L, and Boccard F (2001). Transcription attenuation associated
with bacterial repetitive extragenic BIME elements. Journal of Molecular
Biology. 314:375-386.