![The neomuran origin of archaebacteria, the](http://s1.studyres.com/store/data/017399974_1-7c620bb2d14ed0d8cfee584061fef071-300x300.png)
The neomuran origin of archaebacteria, the
... mere bags of enzymes. Genes and enzymes are both fundamental, but play their vital roles as parts of highly organized growing and dividing cells. Their life depends on a mutualistic symbiosis of genes, catalysts, membranes and cell skeleton (Cavalier-Smith, 1987a, 1991a, b, 2001). Co-adaptation betw ...
... mere bags of enzymes. Genes and enzymes are both fundamental, but play their vital roles as parts of highly organized growing and dividing cells. Their life depends on a mutualistic symbiosis of genes, catalysts, membranes and cell skeleton (Cavalier-Smith, 1987a, 1991a, b, 2001). Co-adaptation betw ...
Regulation of Gene Expression by Coupling of Alternative Splicing
... The existence of numerous PTC+ isoforms was first inferred from EST data.12 One may wonder why EST evidence exists at all for isoforms that are expected to be degraded by NMD. As observed in numerous experiments (Table 1), NMD substantially reduces the abundance of PTC+ transcripts, but it does not ...
... The existence of numerous PTC+ isoforms was first inferred from EST data.12 One may wonder why EST evidence exists at all for isoforms that are expected to be degraded by NMD. As observed in numerous experiments (Table 1), NMD substantially reduces the abundance of PTC+ transcripts, but it does not ...
Bacterial protein toxins targeting Rho GTPases
... grated slower, suggesting a di¡erent type of modi¢cation than that induced by CNF [41]. The puzzle was solved when it was recognised that DNT possesses transglutaminase activity. DNT attaches primary amines onto Rho at position Gln63. Further comparison of the enzyme activities of DNT and CNFs revea ...
... grated slower, suggesting a di¡erent type of modi¢cation than that induced by CNF [41]. The puzzle was solved when it was recognised that DNT possesses transglutaminase activity. DNT attaches primary amines onto Rho at position Gln63. Further comparison of the enzyme activities of DNT and CNFs revea ...
Therapeutic Enzymes
... to immune reactions. Finally large quantities of DNA are released from damaged microbes and neutrophils at the site of infection. High molecular mass DNA is itself extremely viscous and increases substantially the viscosity of the respiratory mucus ...
... to immune reactions. Finally large quantities of DNA are released from damaged microbes and neutrophils at the site of infection. High molecular mass DNA is itself extremely viscous and increases substantially the viscosity of the respiratory mucus ...
embor2011116-sup-0001
... in the aggregation rate/propensity of a given protein following a given mutation, with this parameter estimated repeatedly using a number of single or multiple mutations. Our review aimed at evaluating the correlation between such experimental data and those estimated in silico by several algorithm ...
... in the aggregation rate/propensity of a given protein following a given mutation, with this parameter estimated repeatedly using a number of single or multiple mutations. Our review aimed at evaluating the correlation between such experimental data and those estimated in silico by several algorithm ...
Brown, V, Small, K, Lakkis, L, Feng, Y, Gunter, C, Wilkinson, KD and Warren, ST: Purified recombinant Fmrp exhibits selective RNA-binding as an intrinsic property of the fragile X mental retardation protein. Journal of Biological Chemistry 273:15521-15527 (1998).
... Fmrp Constructs—The baculoviral constructs used in wild type Fmrp production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the ...
... Fmrp Constructs—The baculoviral constructs used in wild type Fmrp production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the ...
Identification of proteins localized to the contractile vacuole of
... bloodstream, acidic phagolysosomes, and host cell cytosol. Thus, the parasites have mechanisms to respond to both hypo-osmotic and hyper-osmotic stresses. The contractile vacuole complex is an osmoregulatory organelle, which controls intracellular water balance by accumulating excess water and expel ...
... bloodstream, acidic phagolysosomes, and host cell cytosol. Thus, the parasites have mechanisms to respond to both hypo-osmotic and hyper-osmotic stresses. The contractile vacuole complex is an osmoregulatory organelle, which controls intracellular water balance by accumulating excess water and expel ...
EFFECT OF VARIOUS BIOMOLECULES FOR NORMAL FUNCTIONING OF HUMAN SPERM... FERTILIZATION: A REVIEW Research Article
... fluids 3, 4. The functions of these free amino acids are largely unknown5. However, available literature reveals that, the seminal plasma proline and threonine is negatively correlated with the sperm motility6. Where as in bull semen there is a positive correlation between the concentration of amino ...
... fluids 3, 4. The functions of these free amino acids are largely unknown5. However, available literature reveals that, the seminal plasma proline and threonine is negatively correlated with the sperm motility6. Where as in bull semen there is a positive correlation between the concentration of amino ...
EMD Millipore Protease and Phosphatase Inhibitor Cocktails
... cells and a finely tuned balance exists between their rate of synthesis and breakdown that determines the concentration of any given protein. Protein degradation is an essential process whereby damaged, unwanted, or “used” proteins are continuously eliminated. The extraordinary complexities of prote ...
... cells and a finely tuned balance exists between their rate of synthesis and breakdown that determines the concentration of any given protein. Protein degradation is an essential process whereby damaged, unwanted, or “used” proteins are continuously eliminated. The extraordinary complexities of prote ...
The bicoid Protein Determines Position in the Drosophila Embryo in
... gene dosage. For the anterior pattern we demonstrated that the shifts in the fate map as revealed by early landmarks follow the changes in bcd protein concentration. The shifts of the anterior markers appear less pronounced than those of the respective protein concentrations (Figure 6). One explanat ...
... gene dosage. For the anterior pattern we demonstrated that the shifts in the fate map as revealed by early landmarks follow the changes in bcd protein concentration. The shifts of the anterior markers appear less pronounced than those of the respective protein concentrations (Figure 6). One explanat ...
Mechanisms of translational regulation in bacteria
... the growing peptide chain is determined by triplets of nucleotides, so called codons. However, there are only 20 amino acids but 64 different triplets of nucleotides encoding them. Consequently, the genetic code is degenerate: Except for tryptophan and methionine, the amino acids are encoded by two, ...
... the growing peptide chain is determined by triplets of nucleotides, so called codons. However, there are only 20 amino acids but 64 different triplets of nucleotides encoding them. Consequently, the genetic code is degenerate: Except for tryptophan and methionine, the amino acids are encoded by two, ...
A Comprehensive Mutational Analysis of the
... lesions; arrows indicate big necrotic lesions resulting from merge of small lesions. ...
... lesions; arrows indicate big necrotic lesions resulting from merge of small lesions. ...
p62/SQSTM1 Binds Directly to Atg8/LC3 to Facilitate Degradation of
... events with endosomes and/or lysosomes forming structures called amphisomes and autolysosomes, respectively (3–5). Autophagy is thought to be mainly a nonselective, bulk degradation pathway responsible for degradation of the majority of long lived proteins and some organelles. Two evolutionarily con ...
... events with endosomes and/or lysosomes forming structures called amphisomes and autolysosomes, respectively (3–5). Autophagy is thought to be mainly a nonselective, bulk degradation pathway responsible for degradation of the majority of long lived proteins and some organelles. Two evolutionarily con ...
InterPro Presentation - European Bioinformatics Institute
... Link related signatures - relationships 1) Parent - Child (subgroup of more closely related proteins) ...
... Link related signatures - relationships 1) Parent - Child (subgroup of more closely related proteins) ...
Early events in protein folding
... Surprisingly, the folding reactions of many of the other ultra-fast folding proteins appear to be ‘two-state’, and not barrier-less. These proteins show exponential folding kinetics, their folding rates are temperature-dependent, and the equilibrium unfolding reactions appear cooperative45,58. Thus, ...
... Surprisingly, the folding reactions of many of the other ultra-fast folding proteins appear to be ‘two-state’, and not barrier-less. These proteins show exponential folding kinetics, their folding rates are temperature-dependent, and the equilibrium unfolding reactions appear cooperative45,58. Thus, ...
Electrophoresis Basi..
... neutral pH’s are either basic or acidic depending upon their AA composition. Most proteins placed into basic conditions become negatively charged. Acidic conditions cause most proteins to develop a positive charge. ...
... neutral pH’s are either basic or acidic depending upon their AA composition. Most proteins placed into basic conditions become negatively charged. Acidic conditions cause most proteins to develop a positive charge. ...
Chicken Acidic Leucine-rich EGF-like Domain Containing Brain
... CALEB-encoding cDNAs were obtained by screening an adult chicken eye cDNA library constructed in lgt11 with mAb 4/1. Additional overlapping clones were found in the same library using the 1-kb insert of the initial cDNA clone as a probe. The amino acid sequence deduced from these overlapping cDNA cl ...
... CALEB-encoding cDNAs were obtained by screening an adult chicken eye cDNA library constructed in lgt11 with mAb 4/1. Additional overlapping clones were found in the same library using the 1-kb insert of the initial cDNA clone as a probe. The amino acid sequence deduced from these overlapping cDNA cl ...
Signals from the lysosome: a control centre for cellular clearance
... cation-dependent MPR (CD‑MPR), which dynamically shuttle between the trans-Golgi network (TGN) and late endosomes and are involved in the targeting of lysosomal enzymes to the lysosome32. Another example is sulphatase-modifying factor 1 (SUMF1), an endo plasmic reticulum (ER)‑resident protein that ...
... cation-dependent MPR (CD‑MPR), which dynamically shuttle between the trans-Golgi network (TGN) and late endosomes and are involved in the targeting of lysosomal enzymes to the lysosome32. Another example is sulphatase-modifying factor 1 (SUMF1), an endo plasmic reticulum (ER)‑resident protein that ...
Tomé, S., Manley, K., Simard, J.P., Clark, G.W., Slean, M.M., Swami
... in human HD and DM1 stem cells [38]. MMR is a pathway dedicated to protecting against mutations arising from mispaired nucleotides and insertion/deletion loops [39]. There are two heterodimeric protein complexes that recognize unpaired DNAs: MutSa consists of MSH2-MSH6, and MutSb is formed by MSH2–M ...
... in human HD and DM1 stem cells [38]. MMR is a pathway dedicated to protecting against mutations arising from mispaired nucleotides and insertion/deletion loops [39]. There are two heterodimeric protein complexes that recognize unpaired DNAs: MutSa consists of MSH2-MSH6, and MutSb is formed by MSH2–M ...
Pericentriolar material structure and dynamics
... centrosomes recruit a small amount of g-tubulin and NEDD1, indicating that they are similar, but not identical, to normal mitotic centrosomes [7,70]. These results hint that the core PCM proteins can self-assemble without external stimulation by mitotic kinases like polo. Under physiological conditi ...
... centrosomes recruit a small amount of g-tubulin and NEDD1, indicating that they are similar, but not identical, to normal mitotic centrosomes [7,70]. These results hint that the core PCM proteins can self-assemble without external stimulation by mitotic kinases like polo. Under physiological conditi ...
Signal Peptidases
... imported to the mitochondrial matrix typically are synthesized in a higher molecular form with a cleavable matrix signal peptide. The protein is imported across the outer and inner membranes via TOM and TIM. TOM is comprised of the receptors Tom20 and Tom70, and the general import pore (GIP) complex ...
... imported to the mitochondrial matrix typically are synthesized in a higher molecular form with a cleavable matrix signal peptide. The protein is imported across the outer and inner membranes via TOM and TIM. TOM is comprised of the receptors Tom20 and Tom70, and the general import pore (GIP) complex ...
QNQKE Targeting Motif for the SMN-Gemin Multiprotein Complex in Neurons *
... show that over 40% of endogenous SMN granules in neurites and growth cones contain the ribonucleoproteins Gemin2 and Gemin3 (Zhang et al., 2006). Overexpression of SMN and Gemin proteins, tagged with different fluorescent proteins, demonstrates FRET interactions and cotransport (Zhang et al., 2006). ...
... show that over 40% of endogenous SMN granules in neurites and growth cones contain the ribonucleoproteins Gemin2 and Gemin3 (Zhang et al., 2006). Overexpression of SMN and Gemin proteins, tagged with different fluorescent proteins, demonstrates FRET interactions and cotransport (Zhang et al., 2006). ...
The LIR motif – crucial for selective autophagy
... Fig. 3. LIR motif consensus and structural determinants of LIR–ATG8 interactions. (A) Surface representation of LC3B bound to the p62-LIR peptide (top left), yeast Atg8 bound to the Atg19-LIR peptide (top right), GABARAP-L1 bound to the NBR1-LIR peptide (bottom left) and LC3C bound to the NDP52-LIR ...
... Fig. 3. LIR motif consensus and structural determinants of LIR–ATG8 interactions. (A) Surface representation of LC3B bound to the p62-LIR peptide (top left), yeast Atg8 bound to the Atg19-LIR peptide (top right), GABARAP-L1 bound to the NBR1-LIR peptide (bottom left) and LC3C bound to the NDP52-LIR ...
DIFFERENCES IN ENZYME CONTENT OF AZUROPHIL AND
... rabbit polymorphonuclear leukocytes (PMN) contain two types of granules which can be distinguished by differences in size and density and in their time and mode of origin during PMN maturation in the bone marrow. Azurophil granules are formed early in PMN development and are larger and denser than s ...
... rabbit polymorphonuclear leukocytes (PMN) contain two types of granules which can be distinguished by differences in size and density and in their time and mode of origin during PMN maturation in the bone marrow. Azurophil granules are formed early in PMN development and are larger and denser than s ...
Protein moonlighting
![](https://commons.wikimedia.org/wiki/Special:FilePath/3EL3.png?width=300)
Protein moonlighting (or gene sharing) is a phenomenon by which a protein can perform more than one function. Ancestral moonlighting proteins originally possessed a single function but through evolution, acquired additional functions. Many proteins that moonlight are enzymes; others are receptors, ion channels or chaperones. The most common primary function of moonlighting proteins is enzymatic catalysis, but these enzymes have acquired secondary non-enzymatic roles. Some examples of functions of moonlighting proteins secondary to catalysis include signal transduction, transcriptional regulation, apoptosis, motility, and structural.Protein moonlighting may occur widely in nature. Protein moonlighting through gene sharing differs from the use of a single gene to generate different proteins by alternative RNA splicing, DNA rearrangement, or post-translational processing. It is also different from multifunctionality of the protein, in which the protein has multiple domains, each serving a different function. Protein moonlighting by gene sharing means that a gene may acquire and maintain a second function without gene duplication and without loss of the primary function. Such genes are under two or more entirely different selective constraints.Various techniques have been used to reveal moonlighting functions in proteins. The detection of a protein in unexpected locations within cells, cell types, or tissues may suggest that a protein has a moonlighting function. Furthermore, sequence or structure homology of a protein may be used to infer both primary function as well as secondary moonlighting functions of a protein.The most well-studied examples of gene sharing are crystallins. These proteins, when expressed at low levels in many tissues function as enzymes, but when expressed at high levels in eye tissue, become densely packed and thus form lenses. While the recognition of gene sharing is relatively recent—the term was coined in 1988, after crystallins in chickens and ducks were found to be identical to separately identified enzymes—recent studies have found many examples throughout the living world. Joram Piatigorsky has suggested that many or all proteins exhibit gene sharing to some extent, and that gene sharing is a key aspect of molecular evolution. The genes encoding crystallins must maintain sequences for catalytic function and transparency maintenance function.Inappropriate moonlighting is a contributing factor in some genetic diseases, and moonlighting provides a possible mechanism by which bacteria may become resistant to antibiotics.